Starting /dee2/code/volunteer_pipeline.sh SRR22215335 current disk space = 3055769104384 free memory = 1406657680 SRR22215335 SRAfilesize 7f5c1294a61c4fddaa480ab782a9cd65 SRR22215335.sra SRR22215335.sra file validated SRR22215335 is paired end SRR22215335 is conventional basespace SRR22215335 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215335_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.97625 37.0 37.0 37.0 37.0 37.0 2 35.97825 37.0 37.0 37.0 37.0 37.0 3 36.2275 37.0 37.0 37.0 37.0 37.0 4 36.2405 37.0 37.0 37.0 37.0 37.0 5 36.2105 37.0 37.0 37.0 37.0 37.0 6 36.3465 37.0 37.0 37.0 37.0 37.0 7 36.3405 37.0 37.0 37.0 37.0 37.0 8 36.218 37.0 37.0 37.0 37.0 37.0 9 36.223 37.0 37.0 37.0 37.0 37.0 10-14 36.338 37.0 37.0 37.0 37.0 37.0 15-19 36.2558 37.0 37.0 37.0 37.0 37.0 20-24 36.214999999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.195499999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.098 37.0 37.0 37.0 37.0 37.0 35-39 36.03 37.0 37.0 37.0 37.0 37.0 40-44 36.076 37.0 37.0 37.0 37.0 37.0 45-49 35.957899999999995 37.0 37.0 37.0 37.0 37.0 50-54 35.8732 37.0 37.0 37.0 37.0 37.0 55-59 35.8642 37.0 37.0 37.0 37.0 37.0 60-64 35.8363 37.0 37.0 37.0 37.0 37.0 65-69 35.712900000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.8086 37.0 37.0 37.0 37.0 37.0 75-79 35.8623 37.0 37.0 37.0 37.0 37.0 80-84 35.7389 37.0 37.0 37.0 37.0 37.0 85-89 35.7542 37.0 37.0 37.0 37.0 37.0 90-94 35.665800000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.6589 37.0 37.0 37.0 37.0 37.0 100-104 35.670100000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.5311 37.0 37.0 37.0 37.0 37.0 110-114 35.57869999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.5945 37.0 37.0 37.0 37.0 37.0 120-124 35.5194 37.0 37.0 37.0 37.0 37.0 125-129 35.3962 37.0 37.0 37.0 34.6 37.0 130-134 35.416999999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.34310000000001 37.0 37.0 37.0 34.6 37.0 140-144 35.3384 37.0 37.0 37.0 37.0 37.0 145-149 35.272600000000004 37.0 37.0 37.0 32.2 37.0 150-151 35.19525 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.0 23 3.0 24 2.0 25 5.0 26 9.0 27 21.0 28 19.0 29 33.0 30 59.0 31 70.0 32 103.0 33 154.0 34 212.0 35 449.0 36 2652.0 37 206.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.801203309100025 10.754575081474053 16.971672098270243 35.47254951115568 2 31.420696567276373 15.08393886244049 29.892257579554 23.60310699072914 3 26.775 21.349999999999998 23.825 28.050000000000004 4 28.9 25.324999999999996 21.325 24.45 5 26.875 30.125 23.575 19.425 6 18.75 31.825 26.5 22.925 7 12.275 28.549999999999997 39.75 19.425 8 16.55 26.450000000000003 32.5 24.5 9 18.35 22.0 33.324999999999996 26.325 10-14 19.42 30.575000000000003 27.325 22.68 15-19 19.895 29.325000000000003 27.99 22.79 20-24 19.825 29.32 28.044999999999998 22.81 25-29 20.155 28.744999999999997 27.534999999999997 23.565 30-34 19.585 29.235 27.800000000000004 23.380000000000003 35-39 20.255000000000003 29.09 27.145000000000003 23.51 40-44 19.2 29.409999999999997 27.96 23.43 45-49 20.285 28.58 27.284999999999997 23.849999999999998 50-54 19.975 29.360000000000003 26.985 23.68 55-59 20.794999999999998 29.470000000000002 26.765 22.97 60-64 19.869999999999997 28.845 27.544999999999998 23.74 65-69 20.415 29.225 27.245 23.115 70-74 20.555 29.235 27.13 23.080000000000002 75-79 20.34 28.34 27.91 23.41 80-84 20.8 28.660000000000004 27.505000000000003 23.035 85-89 20.825 28.285 27.200000000000003 23.69 90-94 20.465 28.310000000000002 27.435 23.79 95-99 20.68 28.71 26.965 23.645 100-104 20.555 28.455000000000002 27.3 23.69 105-109 20.630000000000003 28.360000000000003 27.779999999999998 23.23 110-114 20.585 28.37 27.544999999999998 23.5 115-119 21.04 28.825 27.02 23.115 120-124 20.705000000000002 28.194999999999997 27.805000000000003 23.294999999999998 125-129 20.69 28.33 27.334999999999997 23.645 130-134 21.315 28.249999999999996 26.82 23.615 135-139 21.37 28.410000000000004 26.965 23.255 140-144 21.495 27.935 26.66 23.91 145-149 21.709999999999997 29.099999999999998 25.705 23.485 150-151 22.7 28.462500000000002 25.6 23.2375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.5 22 1.5 23 1.5 24 5.0 25 4.0 26 8.5 27 13.5 28 13.5 29 18.0 30 23.5 31 34.5 32 44.5 33 54.0 34 65.5 35 75.5 36 86.0 37 106.0 38 139.5 39 162.5 40 184.5 41 213.0 42 232.0 43 254.0 44 264.0 45 252.5 46 243.5 47 238.0 48 217.5 49 191.5 50 175.5 51 144.5 52 110.5 53 90.5 54 68.5 55 52.0 56 42.0 57 34.0 58 24.0 59 15.0 60 12.5 61 11.0 62 12.0 63 9.0 64 4.5 65 5.5 66 6.0 67 4.0 68 4.0 69 8.0 70 5.0 71 2.5 72 3.0 73 1.0 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.22499999999999998 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.5 #Duplication Level Percentage of deduplicated Percentage of total 1 92.72972972972973 85.775 2 6.837837837837838 12.65 3 0.35135135135135137 0.975 4 0.0 0.0 5 0.02702702702702703 0.125 6 0.0 0.0 7 0.02702702702702703 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.02702702702702703 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCGCGTATGC 12 0.3 TruSeq Adapter, Index 7 (98% over 50bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC 7 0.17500000000000002 TruSeq Adapter, Index 7 (100% over 50bp) GGGAAACTTCTTCGCCAACTCGGCGAAGATTGGAGCAATCATTTTACATG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0125 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.32499999999999996 0.0 0.0 0.0 0.0 114-115 0.4375 0.0 0.0 0.0 0.0 116-117 0.5625 0.0 0.0 0.0 0.0 118-119 0.6875 0.025 0.0 0.0 0.0 120-121 0.875 0.025 0.0 0.0 0.0 122-123 1.0875 0.025 0.0 0.0 0.0 124-125 1.225 0.025 0.0 0.0 0.0 126-127 1.425 0.025 0.0 0.0 0.0 128-129 1.7000000000000002 0.025 0.0 0.0 0.0 130-131 2.0375 0.025 0.0 0.0 0.0 132-133 2.6 0.025 0.0 0.0 0.0 134-135 3.2375 0.025 0.0 0.0 0.0 136-137 3.8875 0.025 0.0 0.0 0.0 138-139 4.65 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAATGAT 10 0.006830828 145.0 1 GCAACAC 10 0.006830828 145.0 5 >>END_MODULE SRR22215335 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215335_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9585 37.0 37.0 37.0 37.0 37.0 2 36.2725 37.0 37.0 37.0 37.0 37.0 3 36.2645 37.0 37.0 37.0 37.0 37.0 4 36.155 37.0 37.0 37.0 37.0 37.0 5 36.244 37.0 37.0 37.0 37.0 37.0 6 36.2135 37.0 37.0 37.0 37.0 37.0 7 36.228 37.0 37.0 37.0 37.0 37.0 8 36.079 37.0 37.0 37.0 37.0 37.0 9 36.1765 37.0 37.0 37.0 37.0 37.0 10-14 36.1496 37.0 37.0 37.0 37.0 37.0 15-19 36.1055 37.0 37.0 37.0 37.0 37.0 20-24 36.0757 37.0 37.0 37.0 37.0 37.0 25-29 35.9608 37.0 37.0 37.0 37.0 37.0 30-34 35.938599999999994 37.0 37.0 37.0 37.0 37.0 35-39 35.8772 37.0 37.0 37.0 37.0 37.0 40-44 35.838800000000006 37.0 37.0 37.0 37.0 37.0 45-49 35.856399999999994 37.0 37.0 37.0 37.0 37.0 50-54 35.795 37.0 37.0 37.0 37.0 37.0 55-59 35.821799999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.71300000000001 37.0 37.0 37.0 37.0 37.0 65-69 35.70530000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.699 37.0 37.0 37.0 37.0 37.0 75-79 35.692499999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.6896 37.0 37.0 37.0 37.0 37.0 85-89 35.680800000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.64309999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.6022 37.0 37.0 37.0 37.0 37.0 100-104 35.525200000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.555600000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.528499999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.5302 37.0 37.0 37.0 37.0 37.0 120-124 35.4263 37.0 37.0 37.0 37.0 37.0 125-129 35.378 37.0 37.0 37.0 37.0 37.0 130-134 35.3258 37.0 37.0 37.0 32.2 37.0 135-139 35.321299999999994 37.0 37.0 37.0 34.6 37.0 140-144 35.183299999999996 37.0 37.0 37.0 27.4 37.0 145-149 35.121399999999994 37.0 37.0 37.0 25.0 37.0 150-151 35.04925 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 4.0 15 2.0 16 1.0 17 1.0 18 0.0 19 3.0 20 4.0 21 4.0 22 6.0 23 7.0 24 11.0 25 13.0 26 16.0 27 19.0 28 18.0 29 26.0 30 26.0 31 54.0 32 67.0 33 117.0 34 228.0 35 632.0 36 2480.0 37 260.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.6 21.2 17.325 27.875 2 28.675 27.625 30.275000000000002 13.425 3 23.849999999999998 31.15 28.325 16.675 4 26.25 36.1 21.25 16.400000000000002 5 25.75 35.949999999999996 22.35 15.950000000000001 6 20.25 39.074999999999996 23.375 17.299999999999997 7 19.55 18.0 41.725 20.724999999999998 8 23.95 23.724999999999998 28.625 23.7 9 23.974999999999998 23.974999999999998 29.349999999999998 22.7 10-14 24.84 28.64 26.165 20.355 15-19 23.995 27.83 28.084999999999997 20.09 20-24 24.395 27.884999999999998 27.63 20.09 25-29 24.395 28.410000000000004 27.805000000000003 19.39 30-34 24.415 27.6 28.075 19.91 35-39 24.055 27.515 27.810000000000002 20.62 40-44 24.59 28.585 27.284999999999997 19.54 45-49 24.18 28.42 26.979999999999997 20.419999999999998 50-54 24.375 27.389999999999997 28.17 20.064999999999998 55-59 24.279999999999998 28.144999999999996 27.889999999999997 19.685 60-64 23.695 28.349999999999998 27.48 20.474999999999998 65-69 24.0 28.655 27.85 19.495 70-74 24.425 27.089999999999996 28.28 20.205000000000002 75-79 24.310000000000002 27.465 28.310000000000002 19.915 80-84 24.505 27.495000000000005 28.08 19.919999999999998 85-89 24.42 28.02 27.705000000000002 19.855 90-94 24.5 27.634999999999998 28.01 19.855 95-99 24.355 27.6 28.335 19.71 100-104 23.96 27.92 28.084999999999997 20.035 105-109 23.799999999999997 27.810000000000002 28.285 20.105 110-114 24.6 27.57 28.03 19.8 115-119 24.67 27.155 28.384999999999998 19.79 120-124 24.349999999999998 27.525 28.38 19.744999999999997 125-129 24.415 27.965 27.810000000000002 19.81 130-134 24.365000000000002 27.965 27.779999999999998 19.89 135-139 24.375 28.000000000000004 28.139999999999997 19.485 140-144 25.569999999999997 28.144999999999996 26.974999999999998 19.31 145-149 25.86 27.68 27.095000000000002 19.365 150-151 26.7125 27.55 27.1375 18.6 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 1.5 15 1.5 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 1.5 22 2.0 23 1.5 24 2.5 25 3.0 26 5.0 27 9.5 28 11.0 29 13.5 30 16.0 31 22.0 32 31.5 33 40.5 34 51.0 35 62.5 36 80.5 37 101.0 38 127.5 39 176.5 40 209.5 41 218.0 42 250.5 43 273.5 44 276.0 45 277.5 46 254.5 47 240.5 48 227.0 49 181.5 50 147.5 51 136.0 52 129.5 53 103.0 54 69.5 55 57.5 56 41.0 57 24.5 58 22.0 59 17.5 60 10.0 61 7.0 62 6.5 63 5.5 64 4.5 65 3.5 66 2.5 67 2.5 68 1.5 69 2.0 70 3.5 71 2.5 72 1.0 73 0.5 74 1.0 75 0.5 76 0.5 77 1.0 78 1.0 79 0.5 80 0.0 81 0.0 82 0.5 83 1.5 84 1.0 85 1.0 86 1.5 87 1.5 88 1.5 89 0.5 90 1.0 91 2.5 92 1.5 93 0.5 94 1.0 95 1.0 96 1.0 97 0.5 98 0.5 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.30000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.2475884244373 87.0 2 6.350482315112541 11.85 3 0.37513397642015006 1.05 4 0.02679528403001072 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0125 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.07500000000000001 0.0 0.0 0.0 0.0 106-107 0.1375 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.30000000000000004 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.5375 0.0 0.0 0.0 0.0 118-119 0.6625 0.0 0.0 0.0 0.0 120-121 0.8500000000000001 0.0 0.0 0.0 0.0 122-123 1.0625 0.0 0.0 0.0 0.0 124-125 1.2000000000000002 0.0 0.0 0.0 0.0 126-127 1.4 0.0 0.0 0.0 0.0 128-129 1.7125 0.0 0.0 0.0 0.0 130-131 2.0625 0.0 0.0 0.0 0.0 132-133 2.6625 0.0 0.0 0.0 0.0 134-135 3.3 0.0 0.0 0.0 0.0 136-137 3.875 0.0 0.0 0.0 0.0 138-139 4.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGATGTG 10 0.006830828 145.0 4 AGGATGT 10 0.006830828 145.0 3 >>END_MODULE Read 1813555 spots for SRR22215335.sra Written 1813555 spots for SRR22215335.sra Read 1813555 spots for SRR22215335.sra Written 1813555 spots for SRR22215335.sra Read 1813563 spots for SRR22215335.sra Written 1813563 spots for SRR22215335.sra Read 1813555 spots for SRR22215335.sra Written 1813555 spots for SRR22215335.sra Read 1813555 spots for SRR22215335.sra Written 1813555 spots for SRR22215335.sra Read 1813555 spots for SRR22215335.sra Written 1813555 spots for SRR22215335.sra Read 1813555 spots for SRR22215335.sra Written 1813555 spots for SRR22215335.sra Read 1813555 spots for SRR22215335.sra Written 1813555 spots for SRR22215335.sra Read 1813555 spots for SRR22215335.sra Written 1813555 spots for SRR22215335.sra Read 1813555 spots for SRR22215335.sra Written 1813555 spots for SRR22215335.sra Read 1813555 spots for SRR22215335.sra Written 1813555 spots for SRR22215335.sra Read 1813555 spots for SRR22215335.sra Written 1813555 spots for SRR22215335.sra Read 1813555 spots for SRR22215335.sra Written 1813555 spots for SRR22215335.sra Read 1813555 spots for SRR22215335.sra Written 1813555 spots for SRR22215335.sra Read 1813555 spots for SRR22215335.sra Written 1813555 spots for SRR22215335.sra Read 1813555 spots for SRR22215335.sra Written 1813555 spots for SRR22215335.sra Read 1813555 spots for SRR22215335.sra Written 1813555 spots for SRR22215335.sra Read 1813555 spots for SRR22215335.sra Written 1813555 spots for SRR22215335.sra Read 1813555 spots for SRR22215335.sra Written 1813555 spots for SRR22215335.sra Read 1813555 spots for SRR22215335.sra Written 1813555 spots for SRR22215335.sra SRR ids: ['SRR22215335.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_oh7opng0 SRR22215335.sra spots: 36271108 blocks: [[1, 1813555], [1813556, 3627110], [3627111, 5440665], [5440666, 7254220], [7254221, 9067775], [9067776, 10881330], [10881331, 12694885], [12694886, 14508440], [14508441, 16321995], [16321996, 18135550], [18135551, 19949105], [19949106, 21762660], [21762661, 23576215], [23576216, 25389770], [25389771, 27203325], [27203326, 29016880], [29016881, 30830435], [30830436, 32643990], [32643991, 34457545], [34457546, 36271108]] SRR22215335 file size 12304808 SRR22215335 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22215335 SRR22215335_1.fastq SRR22215335_2.fastq Input file: SRR22215335_1.fastq Paired file: SRR22215335_2.fastq trimmed: SRR22215335-trimmed-pair1.fastq, SRR22215335-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:25:22 2025 >> started Tue Feb 11 08:26:18 2025 >> done (56.134s) 36271108 read pairs processed; of these: 345 ( 0.00%) short read pairs filtered out after trimming by size control 129554 ( 0.36%) empty read pairs filtered out after trimming by size control 36141209 (99.64%) read pairs available; of these: 3962555 (10.96%) trimmed read pairs available after processing 32178654 (89.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 9 0.00% 20 7 0.00% 21 6 0.00% 22 4 0.00% 23 11 0.00% 24 3 0.00% 25 9 0.00% 26 6 0.00% 27 11 0.00% 28 4 0.00% 29 27 0.00% 30 8 0.00% 31 17 0.00% 32 7 0.00% 33 10 0.00% 34 14 0.00% 35 18 0.00% 36 12 0.00% 37 13 0.00% 38 12 0.00% 39 15 0.00% 40 16 0.00% 41 15 0.00% 42 13 0.00% 43 25 0.00% 44 17 0.00% 45 18 0.00% 46 13 0.00% 47 24 0.00% 48 23 0.00% 49 21 0.00% 50 24 0.00% 51 33 0.00% 52 40 0.00% 53 45 0.00% 54 35 0.00% 55 40 0.00% 56 49 0.00% 57 56 0.00% 58 46 0.00% 59 50 0.00% 60 53 0.00% 61 71 0.00% 62 69 0.00% 63 86 0.00% 64 68 0.00% 65 80 0.00% 66 104 0.00% 67 111 0.00% 68 113 0.00% 69 167 0.00% 70 150 0.00% 71 171 0.00% 72 223 0.00% 73 210 0.00% 74 253 0.00% 75 309 0.00% 76 371 0.00% 77 338 0.00% 78 420 0.00% 79 502 0.00% 80 545 0.00% 81 590 0.00% 82 660 0.00% 83 738 0.00% 84 787 0.00% 85 965 0.00% 86 1051 0.00% 87 1179 0.00% 88 1323 0.00% 89 1493 0.00% 90 1579 0.00% 91 1704 0.00% 92 1992 0.01% 93 2213 0.01% 94 2356 0.01% 95 2621 0.01% 96 2894 0.01% 97 3225 0.01% 98 3536 0.01% 99 3869 0.01% 100 4082 0.01% 101 4564 0.01% 102 4795 0.01% 103 5468 0.02% 104 5875 0.02% 105 6509 0.02% 106 7110 0.02% 107 7803 0.02% 108 8409 0.02% 109 9619 0.03% 110 10134 0.03% 111 11355 0.03% 112 12311 0.03% 113 13668 0.04% 114 15080 0.04% 115 16632 0.05% 116 18826 0.05% 117 20909 0.06% 118 23612 0.07% 119 26125 0.07% 120 28824 0.08% 121 32145 0.09% 122 35324 0.10% 123 38674 0.11% 124 43151 0.12% 125 47221 0.13% 126 52271 0.14% 127 58337 0.16% 128 64175 0.18% 129 70108 0.19% 130 77035 0.21% 131 83318 0.23% 132 89614 0.25% 133 96936 0.27% 134 102643 0.28% 135 110857 0.31% 136 119088 0.33% 137 127030 0.35% 138 135675 0.38% 139 145830 0.40% 140 154317 0.43% 141 161497 0.45% 142 170456 0.47% 143 177906 0.49% 144 185640 0.51% 145 193451 0.54% 146 200371 0.55% 147 207240 0.57% 148 217747 0.60% 149 225233 0.62% 150 237528 0.66% 151 32178654 89.04% 36141209 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=3.96 fanout-score-rank=23 prefix-density=0.29 prefix-fanout=3.2 sequence=GGTGCTGGAGCTGGAGC criterion=fanout-score sequence-density=0.11 sequence-density-rank=13 fanout-score=82.92 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=16.1 sequence=CCACCACCATGGGCTCCCCAGCCACCATAGGTGTCAATAATGATCTTGCGTCCAGTGAGACCTGCATCACCATGAGGACCACCAATAACAAAACGGCCAGATGGGTTGAGGTGAAAGATAGTTTTCTCATCAAGGTACTTCTCCGGGATAACAGGCTTGATGACATACTCCTTTAGATCAGCGGCAATTTCATCATTTGTGACAGTCTCATCATGCTGAGTAGAGATGAGAACAGTGTGGACACGAACAGGGACCATTGCACCATTGTCATTGAAG criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=4.15 fanout-score-rank=21 prefix-density=0.21 prefix-fanout=3.2 sequence=AAGATCCAGGACAAGGAAGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=109.36 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=7.5 sequence=TCTTCTCTCTGTCTTCTTGATTCCTTGTTTTTCGTTCTGTTTATTACAGCAGCAATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGAAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCCGCAAAGCCTGCAGAAACCGTGGCTGCTGCATAATGTTTATAATACCAATATTTACTATGTGAAACTGTGTTCTACTGGGTTATAGTTAGTTGGGCTTTCTATGATCATGATGTGGATTCTGGATATCCAGCATGCTTTTACTGGGATGTAAGCTATAATAATTTCTCTGGTACATTCATATGGTTATC SRR22215335 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 08:26:58 Started mapping on | Feb 11 08:26:59 Finished on | Feb 11 08:30:04 Mapping speed, Million of reads per hour | 703.29 Number of input reads | 36141209 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 34405925 Uniquely mapped reads % | 95.20% Average mapped length | 297.92 Number of splices: Total | 27685488 Number of splices: Annotated (sjdb) | 27101650 Number of splices: GT/AG | 27260800 Number of splices: GC/AG | 338173 Number of splices: AT/AC | 31296 Number of splices: Non-canonical | 55219 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.02% Deletion average length | 2.19 Insertion rate per base | 0.02% Insertion average length | 1.81 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 639168 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 327987 % of reads mapped to too many loci | 0.91% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.79% % of reads unmapped: other | 0.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1096116 1096116 1096116 N_multimapping 639168 639168 639168 N_noFeature 1325959 33935032 1483698 N_ambiguous 469722 1769 155570 UnstrandedReadsAssigned:32610244 PositiveStrandReadsAssigned:469124 NegativeStrandReadsAssigned:32766657 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR22215335 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22215335-trimmed-pair1.fastq SRR22215335-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,141,209 reads, 33,343,936 reads pseudoaligned [quant] estimated average fragment length: 193.775 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,211 rounds 52401 SRR22215335.ke.tsv 34699 SRR22215335.se.tsv 87100 total ==> SRR22215335.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1825.23 1942 33.0672 Potri.005G024800.1.v4.1 1035 842.225 689.027 25.4257 Potri.004G059700.1.v4.1 961 768.231 103 4.16687 Potri.007G009000.2.v4.1 1416 1223.23 0 0 Potri.003G141000.2.v4.1 2943 2750.23 616.096 6.96218 Potri.016G087400.1.v4.1 270 82.3963 1480 558.237 Potri.015G069301.1.v4.1 564 371.27 0 0 Potri.010G195200.1.v4.1 1773 1580.23 150.613 2.96216 Potri.012G127500.1.v4.1 977 784.231 6023 238.69 ==> SRR22215335.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2455 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 838 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 164 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR22215335 completed mapping pipeline successfully