Starting /dee2/code/volunteer_pipeline.sh SRR22215336 current disk space = 3055700795392 free memory = 1484016228 SRR22215336 SRAfilesize 1c9d850d74b94273a5b2b59320a66ece SRR22215336.sra SRR22215336.sra file validated SRR22215336 is paired end SRR22215336 is conventional basespace SRR22215336 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215336_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.914 37.0 37.0 37.0 37.0 37.0 2 35.997 37.0 37.0 37.0 37.0 37.0 3 36.191 37.0 37.0 37.0 37.0 37.0 4 36.279 37.0 37.0 37.0 37.0 37.0 5 36.305 37.0 37.0 37.0 37.0 37.0 6 36.3385 37.0 37.0 37.0 37.0 37.0 7 36.177 37.0 37.0 37.0 37.0 37.0 8 36.175 37.0 37.0 37.0 37.0 37.0 9 36.2165 37.0 37.0 37.0 37.0 37.0 10-14 36.2967 37.0 37.0 37.0 37.0 37.0 15-19 36.281099999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.1814 37.0 37.0 37.0 37.0 37.0 25-29 36.1826 37.0 37.0 37.0 37.0 37.0 30-34 36.084799999999994 37.0 37.0 37.0 37.0 37.0 35-39 35.9651 37.0 37.0 37.0 37.0 37.0 40-44 35.9944 37.0 37.0 37.0 37.0 37.0 45-49 35.9325 37.0 37.0 37.0 37.0 37.0 50-54 35.908300000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.86 37.0 37.0 37.0 37.0 37.0 60-64 35.7968 37.0 37.0 37.0 37.0 37.0 65-69 35.8221 37.0 37.0 37.0 37.0 37.0 70-74 35.7749 37.0 37.0 37.0 37.0 37.0 75-79 35.8277 37.0 37.0 37.0 37.0 37.0 80-84 35.7571 37.0 37.0 37.0 37.0 37.0 85-89 35.778800000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.6762 37.0 37.0 37.0 37.0 37.0 95-99 35.7242 37.0 37.0 37.0 37.0 37.0 100-104 35.6717 37.0 37.0 37.0 37.0 37.0 105-109 35.6131 37.0 37.0 37.0 37.0 37.0 110-114 35.5938 37.0 37.0 37.0 37.0 37.0 115-119 35.608599999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.472699999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.430099999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.424699999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.4492 37.0 37.0 37.0 34.6 37.0 140-144 35.2498 37.0 37.0 37.0 32.2 37.0 145-149 35.2483 37.0 37.0 37.0 32.2 37.0 150-151 34.98475 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 6.0 25 13.0 26 6.0 27 19.0 28 32.0 29 46.0 30 57.0 31 71.0 32 97.0 33 125.0 34 201.0 35 400.0 36 2726.0 37 199.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.32429718875502 11.169678714859439 15.863453815261044 35.6425702811245 2 32.16432865731463 13.577154308617235 29.43386773547094 24.824649298597194 3 28.275 19.8 23.200000000000003 28.725 4 30.425 24.875 19.725 24.975 5 25.674999999999997 30.9 22.95 20.474999999999998 6 18.75 33.650000000000006 24.65 22.95 7 13.475000000000001 29.125 39.375 18.025 8 17.075000000000003 25.924999999999997 32.275 24.725 9 18.575 24.175 31.874999999999996 25.374999999999996 10-14 18.92 31.685000000000002 26.72 22.675 15-19 19.075 29.304999999999996 27.99 23.630000000000003 20-24 19.555 29.69 26.985 23.77 25-29 19.765 29.235 27.495000000000005 23.505000000000003 30-34 19.525000000000002 29.630000000000003 27.32 23.525 35-39 19.715 29.415000000000003 27.35 23.52 40-44 19.41 29.48 27.615000000000002 23.494999999999997 45-49 19.040000000000003 29.099999999999998 27.089999999999996 24.77 50-54 19.55 28.585 27.750000000000004 24.115000000000002 55-59 19.665 29.515 26.97 23.849999999999998 60-64 19.45 28.915000000000003 27.52 24.115000000000002 65-69 20.0 29.244999999999997 26.715 24.04 70-74 19.825 29.37 26.76 24.044999999999998 75-79 19.49 29.79 26.815 23.905 80-84 19.88 28.965000000000003 27.065 24.09 85-89 20.05 28.625 27.245 24.08 90-94 20.115 28.13 27.275 24.48 95-99 20.18 28.395 27.465 23.96 100-104 19.34 29.080000000000002 27.42 24.16 105-109 19.744999999999997 28.249999999999996 27.875 24.13 110-114 19.57 28.975 27.41 24.044999999999998 115-119 20.064999999999998 28.660000000000004 27.52 23.755000000000003 120-124 19.915 28.360000000000003 27.47 24.255 125-129 20.28 28.405 26.88 24.435000000000002 130-134 20.39 27.72 27.639999999999997 24.25 135-139 19.85 28.83 26.779999999999998 24.54 140-144 19.805 28.715000000000003 27.805000000000003 23.674999999999997 145-149 20.66 27.97 26.825 24.545 150-151 21.099999999999998 28.725 26.575 23.599999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 1.5 22 2.5 23 2.0 24 2.5 25 5.5 26 7.5 27 8.5 28 12.5 29 16.5 30 21.5 31 30.0 32 39.0 33 50.5 34 74.0 35 92.5 36 88.0 37 103.5 38 138.5 39 159.5 40 180.5 41 183.0 42 228.0 43 259.0 44 264.0 45 282.5 46 258.0 47 228.0 48 220.0 49 201.5 50 164.5 51 138.0 52 111.5 53 91.0 54 67.0 55 50.0 56 52.0 57 42.0 58 22.5 59 19.5 60 14.5 61 10.0 62 11.0 63 8.5 64 6.5 65 4.5 66 2.0 67 3.0 68 3.5 69 4.0 70 3.0 71 1.5 72 0.5 73 1.0 74 2.0 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.3 #Duplication Level Percentage of deduplicated Percentage of total 1 91.21029572836802 83.275 2 8.07776560788609 14.75 3 0.6845564074479736 1.875 4 0.027382256297918947 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.16249999999999998 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.1875 0.0 0.0 0.0 0.0 114-115 0.2875 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.48750000000000004 0.0 0.0 0.0 0.0 120-121 0.5874999999999999 0.0 0.0 0.0 0.0 122-123 0.7125 0.0 0.0 0.0 0.0 124-125 0.825 0.0 0.0 0.0 0.0 126-127 0.975 0.0 0.0 0.0 0.0 128-129 1.1124999999999998 0.0 0.0 0.0 0.0 130-131 1.3375 0.0 0.0 0.0 0.0 132-133 1.6375 0.0 0.0 0.0 0.0 134-135 2.1 0.0 0.0 0.0 0.0 136-137 2.4124999999999996 0.0 0.0 0.0 0.0 138-139 2.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR22215336 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215336_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.6215 37.0 37.0 37.0 37.0 37.0 2 35.9535 37.0 37.0 37.0 37.0 37.0 3 35.9135 37.0 37.0 37.0 37.0 37.0 4 35.9115 37.0 37.0 37.0 37.0 37.0 5 35.866 37.0 37.0 37.0 37.0 37.0 6 35.9375 37.0 37.0 37.0 37.0 37.0 7 36.0035 37.0 37.0 37.0 37.0 37.0 8 35.9755 37.0 37.0 37.0 37.0 37.0 9 36.05 37.0 37.0 37.0 37.0 37.0 10-14 36.0115 37.0 37.0 37.0 37.0 37.0 15-19 35.938199999999995 37.0 37.0 37.0 37.0 37.0 20-24 35.9504 37.0 37.0 37.0 37.0 37.0 25-29 35.8371 37.0 37.0 37.0 37.0 37.0 30-34 35.782000000000004 37.0 37.0 37.0 37.0 37.0 35-39 35.7095 37.0 37.0 37.0 37.0 37.0 40-44 35.7848 37.0 37.0 37.0 37.0 37.0 45-49 35.711 37.0 37.0 37.0 37.0 37.0 50-54 35.6706 37.0 37.0 37.0 37.0 37.0 55-59 35.6331 37.0 37.0 37.0 37.0 37.0 60-64 35.6288 37.0 37.0 37.0 37.0 37.0 65-69 35.6052 37.0 37.0 37.0 37.0 37.0 70-74 35.56570000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.5173 37.0 37.0 37.0 37.0 37.0 80-84 35.467200000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.4702 37.0 37.0 37.0 37.0 37.0 90-94 35.3733 37.0 37.0 37.0 34.6 37.0 95-99 35.3755 37.0 37.0 37.0 37.0 37.0 100-104 35.3086 37.0 37.0 37.0 34.6 37.0 105-109 35.4054 37.0 37.0 37.0 37.0 37.0 110-114 35.326299999999996 37.0 37.0 37.0 32.2 37.0 115-119 35.2889 37.0 37.0 37.0 34.6 37.0 120-124 35.149100000000004 37.0 37.0 37.0 25.0 37.0 125-129 35.1399 37.0 37.0 37.0 27.4 37.0 130-134 35.055099999999996 37.0 37.0 37.0 27.4 37.0 135-139 35.0548 37.0 37.0 37.0 25.0 37.0 140-144 34.9152 37.0 37.0 37.0 25.0 37.0 145-149 34.8423 37.0 37.0 37.0 25.0 37.0 150-151 34.72175 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 1.0 16 0.0 17 0.0 18 1.0 19 0.0 20 5.0 21 3.0 22 5.0 23 13.0 24 4.0 25 19.0 26 23.0 27 23.0 28 22.0 29 35.0 30 54.0 31 61.0 32 91.0 33 118.0 34 272.0 35 776.0 36 2304.0 37 169.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.324999999999996 22.400000000000002 18.05 28.225 2 28.425 27.525 30.7 13.350000000000001 3 25.424999999999997 29.299999999999997 28.849999999999998 16.425 4 26.0 34.35 22.05 17.599999999999998 5 27.075 36.199999999999996 21.375 15.35 6 20.45 39.425 24.05 16.075 7 20.05 19.25 40.975 19.725 8 22.225 24.425 30.049999999999997 23.3 9 25.575 23.325000000000003 29.099999999999998 22.0 10-14 24.775 28.475 25.865 20.885 15-19 24.795 27.415 28.345 19.445 20-24 24.795 27.66 27.915 19.63 25-29 25.080000000000002 27.595 28.22 19.105 30-34 24.565 28.315 27.500000000000004 19.62 35-39 24.36 28.63 27.900000000000002 19.11 40-44 25.064999999999998 27.634999999999998 28.005000000000003 19.295 45-49 25.25 27.46 27.584999999999997 19.705000000000002 50-54 24.285 28.46 27.700000000000003 19.555 55-59 24.154999999999998 28.205000000000002 27.49 20.150000000000002 60-64 24.5 28.23 27.765 19.505 65-69 24.32 28.34 28.110000000000003 19.23 70-74 24.55 27.965 27.625 19.86 75-79 24.23 28.155 28.575 19.040000000000003 80-84 24.654999999999998 27.205000000000002 28.449999999999996 19.689999999999998 85-89 24.11 27.6 28.665000000000003 19.625 90-94 24.26 27.529999999999998 28.29 19.919999999999998 95-99 24.375 27.650000000000002 28.58 19.395 100-104 24.740000000000002 27.51 28.34 19.41 105-109 24.645 26.484999999999996 28.810000000000002 20.06 110-114 24.19 28.08 28.365000000000002 19.365 115-119 24.779999999999998 27.345000000000002 28.715000000000003 19.16 120-124 23.549999999999997 28.33 28.615000000000002 19.505 125-129 24.87 28.09 27.675 19.365 130-134 24.29 27.544999999999998 28.485 19.68 135-139 24.705 27.415 28.389999999999997 19.49 140-144 24.605 28.744999999999997 27.825 18.825 145-149 25.430000000000003 27.93 27.41 19.23 150-151 25.4875 28.225 27.975 18.3125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.5 15 0.5 16 1.0 17 1.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.5 25 2.5 26 3.5 27 5.5 28 7.5 29 12.0 30 15.5 31 25.5 32 31.0 33 36.0 34 54.5 35 68.0 36 89.5 37 122.5 38 143.5 39 157.0 40 178.5 41 222.0 42 264.5 43 277.5 44 271.5 45 255.0 46 257.5 47 248.0 48 217.0 49 200.5 50 189.5 51 156.5 52 112.0 53 87.5 54 70.0 55 51.0 56 35.5 57 25.5 58 17.5 59 13.5 60 13.0 61 12.0 62 9.5 63 6.0 64 2.5 65 2.0 66 2.0 67 1.0 68 1.0 69 1.0 70 1.5 71 1.0 72 0.0 73 1.0 74 2.0 75 1.0 76 0.5 77 1.0 78 0.5 79 0.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.5 91 0.5 92 0.5 93 1.0 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.75 #Duplication Level Percentage of deduplicated Percentage of total 1 91.82561307901908 84.25 2 7.384196185286103 13.55 3 0.7629427792915531 2.1 4 0.027247956403269755 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.16249999999999998 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.1875 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.3375 0.0 0.0 0.0 0.0 118-119 0.4625 0.0 0.0 0.0 0.0 120-121 0.5625 0.0 0.0 0.0 0.0 122-123 0.7 0.0 0.0 0.0 0.0 124-125 0.825 0.0 0.0 0.0 0.0 126-127 0.975 0.0 0.0 0.0 0.0 128-129 1.125 0.0 0.0 0.0 0.0 130-131 1.3125 0.0 0.0 0.0 0.0 132-133 1.6 0.0 0.0 0.0 0.0 134-135 2.075 0.0 0.0 0.0 0.0 136-137 2.3875 0.0 0.0 0.0 0.0 138-139 2.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1686183 spots for SRR22215336.sra Written 1686183 spots for SRR22215336.sra Read 1686183 spots for SRR22215336.sra Written 1686183 spots for SRR22215336.sra Read 1686183 spots for SRR22215336.sra Written 1686183 spots for SRR22215336.sra Read 1686183 spots for SRR22215336.sra Written 1686183 spots for SRR22215336.sra Read 1686183 spots for SRR22215336.sra Written 1686183 spots for SRR22215336.sra Read 1686183 spots for SRR22215336.sra Written 1686183 spots for SRR22215336.sra Read 1686183 spots for SRR22215336.sra Written 1686183 spots for SRR22215336.sra Read 1686183 spots for SRR22215336.sra Written 1686183 spots for SRR22215336.sra Read 1686183 spots for SRR22215336.sra Written 1686183 spots for SRR22215336.sra Read 1686183 spots for SRR22215336.sra Written 1686183 spots for SRR22215336.sra Read 1686183 spots for SRR22215336.sra Written 1686183 spots for SRR22215336.sra Read 1686183 spots for SRR22215336.sra Written 1686183 spots for SRR22215336.sra Read 1686183 spots for SRR22215336.sra Written 1686183 spots for SRR22215336.sra Read 1686183 spots for SRR22215336.sra Written 1686183 spots for SRR22215336.sra Read 1686183 spots for SRR22215336.sra Written 1686183 spots for SRR22215336.sra Read 1686183 spots for SRR22215336.sra Written 1686183 spots for SRR22215336.sra Read 1686183 spots for SRR22215336.sra Written 1686183 spots for SRR22215336.sra Read 1686183 spots for SRR22215336.sra Written 1686183 spots for SRR22215336.sra Read 1686183 spots for SRR22215336.sra Written 1686183 spots for SRR22215336.sra Read 1686189 spots for SRR22215336.sra Written 1686189 spots for SRR22215336.sra SRR ids: ['SRR22215336.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_za1qd7y6 SRR22215336.sra spots: 33723666 blocks: [[1, 1686183], [1686184, 3372366], [3372367, 5058549], [5058550, 6744732], [6744733, 8430915], [8430916, 10117098], [10117099, 11803281], [11803282, 13489464], [13489465, 15175647], [15175648, 16861830], [16861831, 18548013], [18548014, 20234196], [20234197, 21920379], [21920380, 23606562], [23606563, 25292745], [25292746, 26978928], [26978929, 28665111], [28665112, 30351294], [30351295, 32037477], [32037478, 33723666]] SRR22215336 file size 11439076 SRR22215336 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22215336 SRR22215336_1.fastq SRR22215336_2.fastq Input file: SRR22215336_1.fastq Paired file: SRR22215336_2.fastq trimmed: SRR22215336-trimmed-pair1.fastq, SRR22215336-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:38:26 2025 >> started Tue Feb 11 08:39:02 2025 >> done (35.842s) 33723666 read pairs processed; of these: 265 ( 0.00%) short read pairs filtered out after trimming by size control 93523 ( 0.28%) empty read pairs filtered out after trimming by size control 33629878 (99.72%) read pairs available; of these: 2462047 ( 7.32%) trimmed read pairs available after processing 31167831 (92.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 9 0.00% 20 9 0.00% 21 7 0.00% 22 3 0.00% 23 7 0.00% 24 4 0.00% 25 8 0.00% 26 3 0.00% 27 9 0.00% 28 8 0.00% 29 26 0.00% 30 7 0.00% 31 10 0.00% 32 8 0.00% 33 10 0.00% 34 7 0.00% 35 13 0.00% 36 8 0.00% 37 8 0.00% 38 9 0.00% 39 15 0.00% 40 4 0.00% 41 13 0.00% 42 11 0.00% 43 14 0.00% 44 12 0.00% 45 13 0.00% 46 12 0.00% 47 19 0.00% 48 18 0.00% 49 19 0.00% 50 20 0.00% 51 29 0.00% 52 18 0.00% 53 22 0.00% 54 31 0.00% 55 28 0.00% 56 19 0.00% 57 27 0.00% 58 30 0.00% 59 27 0.00% 60 30 0.00% 61 30 0.00% 62 27 0.00% 63 41 0.00% 64 37 0.00% 65 43 0.00% 66 40 0.00% 67 45 0.00% 68 49 0.00% 69 58 0.00% 70 63 0.00% 71 80 0.00% 72 76 0.00% 73 70 0.00% 74 78 0.00% 75 99 0.00% 76 118 0.00% 77 133 0.00% 78 117 0.00% 79 179 0.00% 80 179 0.00% 81 180 0.00% 82 223 0.00% 83 223 0.00% 84 262 0.00% 85 329 0.00% 86 332 0.00% 87 328 0.00% 88 399 0.00% 89 458 0.00% 90 514 0.00% 91 582 0.00% 92 590 0.00% 93 751 0.00% 94 739 0.00% 95 868 0.00% 96 965 0.00% 97 1089 0.00% 98 1090 0.00% 99 1227 0.00% 100 1370 0.00% 101 1539 0.00% 102 1593 0.00% 103 1804 0.01% 104 2015 0.01% 105 2287 0.01% 106 2507 0.01% 107 2954 0.01% 108 3209 0.01% 109 3689 0.01% 110 3948 0.01% 111 4193 0.01% 112 4867 0.01% 113 5486 0.02% 114 6139 0.02% 115 6957 0.02% 116 8079 0.02% 117 9073 0.03% 118 10489 0.03% 119 11581 0.03% 120 13179 0.04% 121 14990 0.04% 122 16837 0.05% 123 18745 0.06% 124 21326 0.06% 125 24217 0.07% 126 26832 0.08% 127 30388 0.09% 128 34112 0.10% 129 37877 0.11% 130 42441 0.13% 131 46547 0.14% 132 50957 0.15% 133 56114 0.17% 134 60203 0.18% 135 66091 0.20% 136 71487 0.21% 137 78397 0.23% 138 84980 0.25% 139 92799 0.28% 140 98773 0.29% 141 105209 0.31% 142 111821 0.33% 143 118313 0.35% 144 124909 0.37% 145 131154 0.39% 146 138914 0.41% 147 146154 0.43% 148 154869 0.46% 149 162251 0.48% 150 174059 0.52% 151 31167831 92.68% 33629878 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.74 fanout-score-rank=37 prefix-density=0.19 prefix-fanout=2.7 sequence=GTGGACTCCTTCTGGAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=112.51 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=7.9 sequence=ATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGCAGCCACAGTTTCCTCCACAGCAAGACATTTTCTGTTGGAAAAGAAGGA criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=6.25 fanout-score-rank=21 prefix-density=0.29 prefix-fanout=3.7 sequence=ATCCAGAAGGAGTCCACCCTCCACTTGGT criterion=fanout-score sequence-density=0.09 sequence-density-rank=18 fanout-score=100.86 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=17.5 sequence=GCTGCTGCTGCT SRR22215336 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 08:39:43 Started mapping on | Feb 11 08:39:43 Finished on | Feb 11 08:42:40 Mapping speed, Million of reads per hour | 684.00 Number of input reads | 33629878 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 31937420 Uniquely mapped reads % | 94.97% Average mapped length | 299.10 Number of splices: Total | 27287997 Number of splices: Annotated (sjdb) | 26720170 Number of splices: GT/AG | 26892656 Number of splices: GC/AG | 322275 Number of splices: AT/AC | 24722 Number of splices: Non-canonical | 48344 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.11 Insertion rate per base | 0.02% Insertion average length | 1.79 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 594626 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 406246 % of reads mapped to too many loci | 1.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.64% % of reads unmapped: other | 0.42% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1097832 1097832 1097832 N_multimapping 594626 594626 594626 N_noFeature 1132553 31559501 1251546 N_ambiguous 395253 1583 135422 UnstrandedReadsAssigned:30409614 PositiveStrandReadsAssigned:376336 NegativeStrandReadsAssigned:30550452 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR22215336 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22215336-trimmed-pair1.fastq SRR22215336-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,629,878 reads, 31,154,246 reads pseudoaligned [quant] estimated average fragment length: 199.328 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,306 rounds 52401 SRR22215336.ke.tsv 34699 SRR22215336.se.tsv 87100 total ==> SRR22215336.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1819.67 1201 20.9141 Potri.005G024800.1.v4.1 1035 836.672 470 17.8005 Potri.004G059700.1.v4.1 961 762.683 29 1.20488 Potri.007G009000.2.v4.1 1416 1217.67 0 0 Potri.003G141000.2.v4.1 2943 2744.67 647 7.46969 Potri.016G087400.1.v4.1 270 76.9087 2320 955.876 Potri.015G069301.1.v4.1 564 365.758 0 0 Potri.010G195200.1.v4.1 1773 1574.67 132 2.65627 Potri.012G127500.1.v4.1 977 778.683 5821 236.878 ==> SRR22215336.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1771 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 637 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 21 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR22215336 completed mapping pipeline successfully