Starting /dee2/code/volunteer_pipeline.sh SRR22215337 current disk space = 3055170281472 free memory = 1576038064 SRR22215337 SRAfilesize 7b0691be1473f103e9678e94a8ab2384 SRR22215337.sra SRR22215337.sra file validated SRR22215337 is paired end SRR22215337 is conventional basespace SRR22215337 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215337_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.10125 37.0 37.0 37.0 37.0 37.0 2 35.9705 37.0 37.0 37.0 37.0 37.0 3 36.334 37.0 37.0 37.0 37.0 37.0 4 36.241 37.0 37.0 37.0 37.0 37.0 5 36.267 37.0 37.0 37.0 37.0 37.0 6 36.321 37.0 37.0 37.0 37.0 37.0 7 36.285 37.0 37.0 37.0 37.0 37.0 8 36.311 37.0 37.0 37.0 37.0 37.0 9 36.2365 37.0 37.0 37.0 37.0 37.0 10-14 36.281499999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.2503 37.0 37.0 37.0 37.0 37.0 20-24 36.2464 37.0 37.0 37.0 37.0 37.0 25-29 36.1486 37.0 37.0 37.0 37.0 37.0 30-34 36.0849 37.0 37.0 37.0 37.0 37.0 35-39 36.081599999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.0013 37.0 37.0 37.0 37.0 37.0 45-49 36.0048 37.0 37.0 37.0 37.0 37.0 50-54 35.943799999999996 37.0 37.0 37.0 37.0 37.0 55-59 35.9037 37.0 37.0 37.0 37.0 37.0 60-64 35.888400000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.8784 37.0 37.0 37.0 37.0 37.0 70-74 35.8689 37.0 37.0 37.0 37.0 37.0 75-79 35.817400000000006 37.0 37.0 37.0 37.0 37.0 80-84 35.7953 37.0 37.0 37.0 37.0 37.0 85-89 35.751200000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.693200000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.7344 37.0 37.0 37.0 37.0 37.0 100-104 35.681200000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.6791 37.0 37.0 37.0 37.0 37.0 110-114 35.638600000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.6404 37.0 37.0 37.0 37.0 37.0 120-124 35.5174 37.0 37.0 37.0 37.0 37.0 125-129 35.554899999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.4869 37.0 37.0 37.0 37.0 37.0 135-139 35.443200000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.3296 37.0 37.0 37.0 34.6 37.0 145-149 35.3381 37.0 37.0 37.0 34.6 37.0 150-151 35.03475 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 1.0 21 0.0 22 2.0 23 1.0 24 5.0 25 13.0 26 9.0 27 13.0 28 23.0 29 26.0 30 55.0 31 70.0 32 86.0 33 123.0 34 180.0 35 502.0 36 2720.0 37 170.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.91915641476274 10.318855134320863 15.792116495104192 39.9698719558122 2 30.471887550200805 14.106425702811245 34.61345381526104 20.80823293172691 3 26.525 20.45 23.400000000000002 29.625 4 28.599999999999998 27.05 20.8 23.549999999999997 5 26.200000000000003 29.125 24.575 20.1 6 20.125 32.2 26.525 21.15 7 14.45 29.299999999999997 39.175 17.075000000000003 8 18.0 23.125 34.0 24.875 9 17.95 22.45 34.325 25.275 10-14 19.99 30.104999999999997 27.389999999999997 22.515 15-19 20.74 28.42 27.889999999999997 22.95 20-24 20.064999999999998 28.985 28.035 22.915 25-29 20.29 29.165000000000003 27.455000000000002 23.09 30-34 19.97 29.195 27.73 23.105 35-39 20.205000000000002 28.88 27.169999999999998 23.745 40-44 19.830000000000002 28.939999999999998 27.875 23.355 45-49 20.015 28.405 27.265 24.315 50-54 20.415 28.395 27.215 23.974999999999998 55-59 20.285 28.485 27.589999999999996 23.64 60-64 20.119999999999997 28.955 27.565 23.36 65-69 20.48 28.37 27.665 23.485 70-74 21.09 27.915 27.54 23.455000000000002 75-79 20.635 28.175 27.889999999999997 23.3 80-84 21.035 28.365000000000002 27.560000000000002 23.04 85-89 20.66 28.685 27.325 23.330000000000002 90-94 20.535 28.050000000000004 27.865000000000002 23.549999999999997 95-99 20.565 28.82 26.965 23.65 100-104 21.154999999999998 28.410000000000004 27.525 22.91 105-109 21.18 27.939999999999998 27.38 23.5 110-114 20.94 27.92 27.62 23.52 115-119 20.77 28.425 27.694999999999997 23.11 120-124 21.22 28.43 27.235 23.115 125-129 21.34 28.165000000000003 27.115000000000002 23.380000000000003 130-134 21.44 28.244999999999997 27.46 22.855 135-139 21.105 28.555000000000003 26.790000000000003 23.549999999999997 140-144 21.62 28.33 26.834999999999997 23.215 145-149 21.815 28.205000000000002 26.63 23.35 150-151 21.175 28.7 26.75 23.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 1.5 19 1.5 20 0.5 21 1.5 22 2.0 23 1.5 24 4.0 25 5.0 26 5.5 27 11.0 28 13.0 29 13.0 30 22.5 31 27.5 32 28.5 33 45.5 34 71.5 35 77.5 36 88.0 37 114.0 38 138.5 39 151.5 40 168.5 41 207.5 42 224.0 43 239.0 44 260.5 45 274.5 46 270.0 47 246.5 48 225.5 49 204.0 50 173.5 51 132.5 52 99.5 53 91.5 54 81.0 55 69.0 56 53.0 57 29.5 58 26.0 59 22.0 60 14.5 61 7.0 62 5.0 63 8.0 64 6.5 65 5.0 66 5.0 67 4.5 68 3.0 69 1.5 70 2.5 71 4.0 72 3.0 73 1.0 74 1.5 75 1.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.4 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.5 #Duplication Level Percentage of deduplicated Percentage of total 1 92.37837837837837 85.45 2 7.135135135135136 13.200000000000001 3 0.48648648648648646 1.35 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1375 0.0 0.0 0.0 0.0 110-111 0.1875 0.0 0.0 0.0 0.0 112-113 0.2375 0.0 0.0 0.0 0.0 114-115 0.32499999999999996 0.0 0.0 0.0 0.0 116-117 0.4625 0.0 0.0 0.0 0.0 118-119 0.6 0.0 0.0 0.0 0.0 120-121 0.75 0.0 0.0 0.0 0.0 122-123 1.0 0.0 0.0 0.0 0.0 124-125 1.1749999999999998 0.0 0.0 0.0 0.0 126-127 1.4 0.0 0.0 0.0 0.0 128-129 1.7125 0.0 0.0 0.0 0.0 130-131 1.9500000000000002 0.0 0.0 0.0 0.0 132-133 2.4375 0.0 0.0 0.0 0.0 134-135 2.95 0.0 0.0 0.0 0.0 136-137 3.5875000000000004 0.0 0.0 0.0 0.0 138-139 4.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR22215337 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215337_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.812 37.0 37.0 37.0 37.0 37.0 2 36.37 37.0 37.0 37.0 37.0 37.0 3 36.256 37.0 37.0 37.0 37.0 37.0 4 36.216 37.0 37.0 37.0 37.0 37.0 5 36.2135 37.0 37.0 37.0 37.0 37.0 6 36.126 37.0 37.0 37.0 37.0 37.0 7 36.155 37.0 37.0 37.0 37.0 37.0 8 36.241 37.0 37.0 37.0 37.0 37.0 9 36.309 37.0 37.0 37.0 37.0 37.0 10-14 36.1793 37.0 37.0 37.0 37.0 37.0 15-19 36.203199999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.171 37.0 37.0 37.0 37.0 37.0 25-29 36.1302 37.0 37.0 37.0 37.0 37.0 30-34 35.9963 37.0 37.0 37.0 37.0 37.0 35-39 36.01350000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.0156 37.0 37.0 37.0 37.0 37.0 45-49 35.967600000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.9471 37.0 37.0 37.0 37.0 37.0 55-59 35.881800000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.9006 37.0 37.0 37.0 37.0 37.0 65-69 35.793400000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.7975 37.0 37.0 37.0 37.0 37.0 75-79 35.742599999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.6842 37.0 37.0 37.0 37.0 37.0 85-89 35.714 37.0 37.0 37.0 37.0 37.0 90-94 35.6804 37.0 37.0 37.0 37.0 37.0 95-99 35.568799999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.583800000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.590599999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.5378 37.0 37.0 37.0 37.0 37.0 115-119 35.462399999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.405300000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.3885 37.0 37.0 37.0 37.0 37.0 130-134 35.3583 37.0 37.0 37.0 34.6 37.0 135-139 35.359199999999994 37.0 37.0 37.0 34.6 37.0 140-144 35.2153 37.0 37.0 37.0 29.8 37.0 145-149 35.083999999999996 37.0 37.0 37.0 27.4 37.0 150-151 35.036249999999995 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 2.0 17 1.0 18 0.0 19 2.0 20 2.0 21 1.0 22 3.0 23 6.0 24 5.0 25 12.0 26 15.0 27 13.0 28 21.0 29 25.0 30 42.0 31 55.0 32 80.0 33 96.0 34 214.0 35 705.0 36 2479.0 37 220.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.875 19.15 16.325 34.65 2 26.5 27.925 31.275 14.299999999999999 3 22.225 30.9 27.224999999999998 19.650000000000002 4 25.825 35.35 20.724999999999998 18.099999999999998 5 26.375 36.775000000000006 21.25 15.6 6 18.475 40.2 24.725 16.6 7 20.925 18.975 40.6 19.5 8 21.825 22.3 30.049999999999997 25.825 9 22.825 23.724999999999998 27.725 25.724999999999998 10-14 23.54 28.435 26.650000000000002 21.375 15-19 23.335 28.33 27.73 20.605 20-24 23.380000000000003 28.065 27.345000000000002 21.21 25-29 23.095 28.225 27.839999999999996 20.84 30-34 23.599999999999998 28.244999999999997 27.51 20.645 35-39 23.435 27.85 27.77 20.945 40-44 23.735 28.4 27.375 20.49 45-49 23.125 28.044999999999998 27.685 21.145 50-54 23.575 28.515 27.57 20.34 55-59 23.23 28.139999999999997 28.07 20.560000000000002 60-64 22.91 27.845 28.499999999999996 20.745 65-69 23.215 27.900000000000002 28.134999999999998 20.75 70-74 23.43 27.439999999999998 28.139999999999997 20.990000000000002 75-79 24.07 26.834999999999997 27.845 21.25 80-84 24.04 27.500000000000004 27.694999999999997 20.765 85-89 23.885 27.92 28.165000000000003 20.03 90-94 23.235 27.700000000000003 27.779999999999998 21.285 95-99 23.25 28.215 27.79 20.745 100-104 23.945 28.044999999999998 27.465 20.544999999999998 105-109 23.695 27.21 28.060000000000002 21.035 110-114 23.325000000000003 28.53 27.915 20.23 115-119 23.44 27.800000000000004 28.305000000000003 20.455000000000002 120-124 24.07 27.534999999999997 27.955000000000002 20.44 125-129 23.905 28.025 27.72 20.349999999999998 130-134 23.785 28.43 27.644999999999996 20.14 135-139 23.64 28.58 27.665 20.115 140-144 24.245 28.499999999999996 27.305 19.950000000000003 145-149 24.72 28.165000000000003 26.685 20.43 150-151 25.224999999999998 28.625 26.7125 19.4375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 1.0 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.5 21 2.0 22 1.0 23 0.5 24 1.5 25 1.5 26 2.5 27 3.0 28 3.0 29 8.0 30 13.0 31 20.0 32 28.5 33 41.0 34 60.5 35 69.5 36 79.0 37 102.5 38 128.0 39 154.0 40 187.5 41 228.5 42 246.0 43 261.0 44 275.0 45 277.0 46 283.0 47 276.5 48 239.5 49 200.5 50 172.5 51 136.0 52 103.0 53 82.5 54 71.0 55 50.5 56 35.5 57 31.5 58 26.0 59 16.5 60 10.0 61 12.5 62 13.0 63 9.0 64 6.0 65 3.5 66 3.0 67 2.0 68 1.0 69 1.5 70 1.5 71 1.0 72 1.0 73 1.0 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.4 #Duplication Level Percentage of deduplicated Percentage of total 1 92.23484848484848 85.225 2 7.332251082251082 13.55 3 0.4058441558441558 1.125 4 0.027056277056277056 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.16249999999999998 0.0 0.0 0.0 0.0 110-111 0.21250000000000002 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.48750000000000004 0.0 0.0 0.0 0.0 118-119 0.625 0.0 0.0 0.0 0.0 120-121 0.7749999999999999 0.0 0.0 0.0 0.0 122-123 1.025 0.0 0.0 0.0 0.0 124-125 1.2000000000000002 0.0 0.0 0.0 0.0 126-127 1.425 0.0 0.0 0.0 0.0 128-129 1.75 0.0 0.0 0.0 0.0 130-131 2.0125 0.0 0.0 0.0 0.0 132-133 2.4875 0.0 0.0 0.0 0.0 134-135 3.0250000000000004 0.0 0.0 0.0 0.0 136-137 3.7 0.0 0.0 0.0 0.0 138-139 4.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1758279 spots for SRR22215337.sra Written 1758279 spots for SRR22215337.sra Read 1758279 spots for SRR22215337.sra Written 1758279 spots for SRR22215337.sra Read 1758279 spots for SRR22215337.sra Written 1758279 spots for SRR22215337.sra Read 1758279 spots for SRR22215337.sra Written 1758279 spots for SRR22215337.sra Read 1758279 spots for SRR22215337.sra Written 1758279 spots for SRR22215337.sra Read 1758279 spots for SRR22215337.sra Written 1758279 spots for SRR22215337.sra Read 1758279 spots for SRR22215337.sra Written 1758279 spots for SRR22215337.sra Read 1758279 spots for SRR22215337.sra Written 1758279 spots for SRR22215337.sra Read 1758279 spots for SRR22215337.sra Written 1758279 spots for SRR22215337.sra Read 1758279 spots for SRR22215337.sra Written 1758279 spots for SRR22215337.sra Read 1758279 spots for SRR22215337.sra Written 1758279 spots for SRR22215337.sra Read 1758279 spots for SRR22215337.sra Written 1758279 spots for SRR22215337.sra Read 1758279 spots for SRR22215337.sra Written 1758279 spots for SRR22215337.sra Read 1758279 spots for SRR22215337.sra Written 1758279 spots for SRR22215337.sra Read 1758279 spots for SRR22215337.sra Written 1758279 spots for SRR22215337.sra Read 1758279 spots for SRR22215337.sra Written 1758279 spots for SRR22215337.sra Read 1758279 spots for SRR22215337.sra Written 1758279 spots for SRR22215337.sra Read 1758279 spots for SRR22215337.sra Written 1758279 spots for SRR22215337.sra Read 1758279 spots for SRR22215337.sra Written 1758279 spots for SRR22215337.sra Read 1758279 spots for SRR22215337.sra Written 1758279 spots for SRR22215337.sra SRR ids: ['SRR22215337.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yecg6k_b SRR22215337.sra spots: 35165580 blocks: [[1, 1758279], [1758280, 3516558], [3516559, 5274837], [5274838, 7033116], [7033117, 8791395], [8791396, 10549674], [10549675, 12307953], [12307954, 14066232], [14066233, 15824511], [15824512, 17582790], [17582791, 19341069], [19341070, 21099348], [21099349, 22857627], [22857628, 24615906], [24615907, 26374185], [26374186, 28132464], [28132465, 29890743], [29890744, 31649022], [31649023, 33407301], [33407302, 35165580]] SRR22215337 file size 11929102 SRR22215337 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22215337 SRR22215337_1.fastq SRR22215337_2.fastq Input file: SRR22215337_1.fastq Paired file: SRR22215337_2.fastq trimmed: SRR22215337-trimmed-pair1.fastq, SRR22215337-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:25:45 2025 >> started Tue Feb 11 09:26:42 2025 >> done (56.823s) 35165580 read pairs processed; of these: 104 ( 0.00%) short read pairs filtered out after trimming by size control 21762 ( 0.06%) empty read pairs filtered out after trimming by size control 35143714 (99.94%) read pairs available; of these: 3780348 (10.76%) trimmed read pairs available after processing 31363366 (89.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 1 0.00% 21 0 0.00% 22 6 0.00% 23 2 0.00% 24 3 0.00% 25 2 0.00% 26 2 0.00% 27 3 0.00% 28 4 0.00% 29 7 0.00% 30 5 0.00% 31 6 0.00% 32 9 0.00% 33 6 0.00% 34 7 0.00% 35 8 0.00% 36 7 0.00% 37 4 0.00% 38 10 0.00% 39 14 0.00% 40 9 0.00% 41 11 0.00% 42 6 0.00% 43 12 0.00% 44 12 0.00% 45 15 0.00% 46 9 0.00% 47 8 0.00% 48 25 0.00% 49 16 0.00% 50 20 0.00% 51 20 0.00% 52 25 0.00% 53 28 0.00% 54 32 0.00% 55 25 0.00% 56 39 0.00% 57 35 0.00% 58 33 0.00% 59 44 0.00% 60 65 0.00% 61 64 0.00% 62 64 0.00% 63 62 0.00% 64 78 0.00% 65 78 0.00% 66 101 0.00% 67 98 0.00% 68 113 0.00% 69 115 0.00% 70 148 0.00% 71 177 0.00% 72 166 0.00% 73 207 0.00% 74 220 0.00% 75 237 0.00% 76 313 0.00% 77 313 0.00% 78 353 0.00% 79 394 0.00% 80 425 0.00% 81 466 0.00% 82 537 0.00% 83 592 0.00% 84 649 0.00% 85 793 0.00% 86 859 0.00% 87 864 0.00% 88 956 0.00% 89 1119 0.00% 90 1238 0.00% 91 1350 0.00% 92 1556 0.00% 93 1533 0.00% 94 1752 0.00% 95 1964 0.01% 96 2137 0.01% 97 2337 0.01% 98 2517 0.01% 99 2732 0.01% 100 3056 0.01% 101 3262 0.01% 102 3777 0.01% 103 3987 0.01% 104 4487 0.01% 105 5042 0.01% 106 5534 0.02% 107 6169 0.02% 108 6875 0.02% 109 7480 0.02% 110 8588 0.02% 111 9468 0.03% 112 10483 0.03% 113 11853 0.03% 114 13375 0.04% 115 15152 0.04% 116 16983 0.05% 117 19170 0.05% 118 21905 0.06% 119 24234 0.07% 120 27614 0.08% 121 30667 0.09% 122 34052 0.10% 123 37763 0.11% 124 42180 0.12% 125 46204 0.13% 126 51349 0.15% 127 57393 0.16% 128 63074 0.18% 129 68645 0.20% 130 74773 0.21% 131 81169 0.23% 132 87301 0.25% 133 94065 0.27% 134 99643 0.28% 135 106853 0.30% 136 115908 0.33% 137 123199 0.35% 138 131312 0.37% 139 139651 0.40% 140 148141 0.42% 141 155131 0.44% 142 164501 0.47% 143 169578 0.48% 144 175748 0.50% 145 183269 0.52% 146 191322 0.54% 147 199806 0.57% 148 207814 0.59% 149 214741 0.61% 150 226323 0.64% 151 31363366 89.24% 35143714 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.48 fanout-score-rank=30 prefix-density=0.20 prefix-fanout=2.8 sequence=GAAGCAAAAATGTCCTTAGGAAGTAGCACCTTCTCAATCTTATAAATGGCTAGCTGGTTGTCCGTGTATACCGTGCCAGATAAACTTGTATTGGTAAGTCCTGTGGTTATGTTCACCGAGTTTGGATAACTTGT criterion=fanout-score sequence-density=0.08 sequence-density-rank=22 fanout-score=80.68 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=16.0 sequence=TCAGCAACACTGGTAGACAGGACCTCGACCTCCTCCACACCTAATGCATGGAAGCA criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.67 fanout-score-rank=32 prefix-density=0.19 prefix-fanout=2.5 sequence=ACAAGTTATCCAAACTCGGTGAACATAACCACAGGACTTACCAATACAAGTTTATCTGGCACGGTATACACGGACAACCAGCTAGCCATTTATAAGATTGAGAAGGTGCTACTTCCTAAGGACATTTTTGCTTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=124.57 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=6.0 sequence=TCTTCTCTCTGTCTTCTTGATTCCTTGTTTTTCGTTCTGTTTATTACAGCAGCAATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGAAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCCGCAAAGCCTGCAGAAACCGTGGCTGCTGCATAATGTTTATAATACCAATATTTACTATGTGAAACTGTGTTCTACTGGGTTATAGTTAGTTGGGCTTTCTATGATCATGATG SRR22215337 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:27:22 Started mapping on | Feb 11 09:27:22 Finished on | Feb 11 09:30:35 Mapping speed, Million of reads per hour | 655.53 Number of input reads | 35143714 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 33534182 Uniquely mapped reads % | 95.42% Average mapped length | 298.06 Number of splices: Total | 26774755 Number of splices: Annotated (sjdb) | 26216780 Number of splices: GT/AG | 26376366 Number of splices: GC/AG | 313156 Number of splices: AT/AC | 32879 Number of splices: Non-canonical | 52354 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.02% Deletion average length | 2.24 Insertion rate per base | 0.01% Insertion average length | 1.92 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 662048 % of reads mapped to multiple loci | 1.88% Number of reads mapped to too many loci | 223969 % of reads mapped to too many loci | 0.64% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.83% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 947484 947484 947484 N_multimapping 662048 662048 662048 N_noFeature 1225780 33080565 1369959 N_ambiguous 464764 1830 154381 UnstrandedReadsAssigned:31843638 PositiveStrandReadsAssigned:451787 NegativeStrandReadsAssigned:32009842 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR22215337 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22215337-trimmed-pair1.fastq SRR22215337-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,143,714 reads, 32,574,501 reads pseudoaligned [quant] estimated average fragment length: 193.552 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,289 rounds 52401 SRR22215337.ke.tsv 34699 SRR22215337.se.tsv 87100 total ==> SRR22215337.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1825.45 4629 77.9318 Potri.005G024800.1.v4.1 1035 842.448 667 24.3321 Potri.004G059700.1.v4.1 961 768.448 152 6.07892 Potri.007G009000.2.v4.1 1416 1223.45 0 0 Potri.003G141000.2.v4.1 2943 2750.45 676 7.55336 Potri.016G087400.1.v4.1 270 82.0179 1746 654.233 Potri.015G069301.1.v4.1 564 371.479 0 0 Potri.010G195200.1.v4.1 1773 1580.45 66 1.2834 Potri.012G127500.1.v4.1 977 784.448 4510 176.689 ==> SRR22215337.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2034 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 731 Potri.001G212900.v4.1 15 Potri.001G182400.v4.1 166 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR22215337 completed mapping pipeline successfully