Starting /dee2/code/volunteer_pipeline.sh SRR22215338 current disk space = 3055707127808 free memory = 1469671632 SRR22215338 SRAfilesize 1dc6de776d2216495572f9168e332a7d SRR22215338.sra SRR22215338.sra file validated SRR22215338 is paired end SRR22215338 is conventional basespace SRR22215338 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215338_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.03275 37.0 37.0 37.0 37.0 37.0 2 35.94325 37.0 37.0 37.0 37.0 37.0 3 36.4135 37.0 37.0 37.0 37.0 37.0 4 36.1825 37.0 37.0 37.0 37.0 37.0 5 36.3685 37.0 37.0 37.0 37.0 37.0 6 36.2905 37.0 37.0 37.0 37.0 37.0 7 36.088 37.0 37.0 37.0 37.0 37.0 8 36.1595 37.0 37.0 37.0 37.0 37.0 9 36.1905 37.0 37.0 37.0 37.0 37.0 10-14 36.2782 37.0 37.0 37.0 37.0 37.0 15-19 36.157000000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.169200000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.074 37.0 37.0 37.0 37.0 37.0 30-34 36.0544 37.0 37.0 37.0 37.0 37.0 35-39 35.9979 37.0 37.0 37.0 37.0 37.0 40-44 35.9836 37.0 37.0 37.0 37.0 37.0 45-49 35.9583 37.0 37.0 37.0 37.0 37.0 50-54 35.853899999999996 37.0 37.0 37.0 37.0 37.0 55-59 35.8812 37.0 37.0 37.0 37.0 37.0 60-64 35.8292 37.0 37.0 37.0 37.0 37.0 65-69 35.8095 37.0 37.0 37.0 37.0 37.0 70-74 35.8037 37.0 37.0 37.0 37.0 37.0 75-79 35.7818 37.0 37.0 37.0 37.0 37.0 80-84 35.6976 37.0 37.0 37.0 37.0 37.0 85-89 35.673 37.0 37.0 37.0 37.0 37.0 90-94 35.6009 37.0 37.0 37.0 37.0 37.0 95-99 35.595200000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.530899999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.5364 37.0 37.0 37.0 37.0 37.0 110-114 35.4952 37.0 37.0 37.0 37.0 37.0 115-119 35.5009 37.0 37.0 37.0 37.0 37.0 120-124 35.4111 37.0 37.0 37.0 37.0 37.0 125-129 35.3817 37.0 37.0 37.0 37.0 37.0 130-134 35.3815 37.0 37.0 37.0 37.0 37.0 135-139 35.3735 37.0 37.0 37.0 34.6 37.0 140-144 35.2384 37.0 37.0 37.0 29.8 37.0 145-149 35.136799999999994 37.0 37.0 37.0 27.4 37.0 150-151 35.0175 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 7.0 25 7.0 26 19.0 27 15.0 28 31.0 29 41.0 30 58.0 31 80.0 32 97.0 33 122.0 34 204.0 35 493.0 36 2645.0 37 178.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.811761749183216 12.616235234983664 14.878110077909025 41.693892937924105 2 27.122464312546956 15.226646631605309 35.336839469070874 22.31404958677686 3 25.4 23.225 22.5 28.875 4 26.924999999999997 28.325 20.349999999999998 24.4 5 24.9 31.075000000000003 24.55 19.475 6 18.224999999999998 34.4 25.674999999999997 21.7 7 13.525 27.250000000000004 40.550000000000004 18.675 8 16.675 23.5 34.35 25.474999999999998 9 18.5 21.65 35.125 24.725 10-14 19.895 29.965000000000003 27.355 22.785 15-19 20.7 29.215000000000003 27.36 22.725 20-24 19.925 28.725 27.825 23.525 25-29 20.185 28.67 28.105000000000004 23.04 30-34 20.169999999999998 29.599999999999998 27.224999999999998 23.005 35-39 20.34 29.065 27.22 23.375 40-44 20.185 29.17 27.485 23.16 45-49 19.78 29.110000000000003 27.88 23.23 50-54 20.125 28.720000000000002 27.169999999999998 23.985 55-59 20.27 28.804999999999996 27.46 23.465 60-64 20.0 28.744999999999997 28.139999999999997 23.115 65-69 20.24 28.54 27.735 23.485 70-74 20.275000000000002 28.9 27.384999999999998 23.44 75-79 20.05 29.45 26.895000000000003 23.605 80-84 20.755000000000003 28.04 27.315 23.89 85-89 20.785 28.23 27.51 23.474999999999998 90-94 20.54 28.77 27.589999999999996 23.1 95-99 20.200000000000003 28.535 27.525 23.74 100-104 20.14 28.42 28.305000000000003 23.135 105-109 20.72 28.63 27.339999999999996 23.31 110-114 20.445 28.185 27.965 23.405 115-119 20.565 28.925 27.24 23.27 120-124 20.57 28.634999999999998 27.345000000000002 23.45 125-129 20.46 28.88 27.145000000000003 23.515 130-134 20.355 29.005 27.77 22.869999999999997 135-139 21.27 28.405 26.540000000000003 23.785 140-144 21.065 28.37 27.205000000000002 23.36 145-149 21.765 28.904999999999998 26.22 23.11 150-151 21.775 29.625 26.087500000000002 22.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 2.5 20 3.5 21 2.5 22 3.0 23 4.0 24 3.5 25 3.0 26 6.5 27 9.5 28 10.5 29 18.0 30 27.0 31 38.5 32 43.0 33 45.5 34 58.0 35 74.5 36 97.5 37 117.5 38 137.0 39 161.0 40 183.0 41 209.5 42 228.5 43 252.5 44 272.5 45 260.5 46 250.0 47 239.0 48 211.0 49 186.0 50 168.5 51 142.5 52 111.0 53 89.0 54 73.5 55 50.5 56 31.5 57 31.5 58 33.5 59 25.5 60 19.5 61 17.5 62 9.5 63 6.0 64 7.5 65 4.5 66 2.5 67 2.0 68 2.5 69 3.0 70 2.0 71 1.5 72 1.5 73 0.5 74 1.0 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.525 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 91.43013100436681 83.75 2 7.996724890829694 14.649999999999999 3 0.5458515283842794 1.5 4 0.02729257641921397 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.15 0.0 0.0 0.0 0.0 116-117 0.2 0.0 0.0 0.0 0.0 118-119 0.2375 0.0 0.0 0.0 0.0 120-121 0.3 0.0 0.0 0.0 0.0 122-123 0.36250000000000004 0.0 0.0 0.0 0.0 124-125 0.5875 0.0 0.0 0.0 0.0 126-127 0.7875 0.0 0.0 0.0 0.0 128-129 0.9875 0.0 0.0 0.0 0.0 130-131 1.25 0.0 0.0 0.0 0.0 132-133 1.425 0.0 0.0 0.0 0.0 134-135 1.7625 0.0 0.0 0.0 0.0 136-137 2.3625 0.0 0.0 0.0 0.0 138-139 2.8375000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR22215338 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215338_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.6005 37.0 37.0 37.0 37.0 37.0 2 35.8785 37.0 37.0 37.0 37.0 37.0 3 35.8875 37.0 37.0 37.0 37.0 37.0 4 35.9005 37.0 37.0 37.0 37.0 37.0 5 35.929 37.0 37.0 37.0 37.0 37.0 6 35.959 37.0 37.0 37.0 37.0 37.0 7 35.962 37.0 37.0 37.0 37.0 37.0 8 35.947 37.0 37.0 37.0 37.0 37.0 9 35.9585 37.0 37.0 37.0 37.0 37.0 10-14 35.9645 37.0 37.0 37.0 37.0 37.0 15-19 35.998999999999995 37.0 37.0 37.0 37.0 37.0 20-24 35.9562 37.0 37.0 37.0 37.0 37.0 25-29 35.88340000000001 37.0 37.0 37.0 37.0 37.0 30-34 35.838800000000006 37.0 37.0 37.0 37.0 37.0 35-39 35.72860000000001 37.0 37.0 37.0 37.0 37.0 40-44 35.7795 37.0 37.0 37.0 37.0 37.0 45-49 35.7572 37.0 37.0 37.0 37.0 37.0 50-54 35.6996 37.0 37.0 37.0 37.0 37.0 55-59 35.651 37.0 37.0 37.0 37.0 37.0 60-64 35.605199999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.573899999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.569 37.0 37.0 37.0 37.0 37.0 75-79 35.4717 37.0 37.0 37.0 37.0 37.0 80-84 35.4905 37.0 37.0 37.0 37.0 37.0 85-89 35.4281 37.0 37.0 37.0 37.0 37.0 90-94 35.3875 37.0 37.0 37.0 37.0 37.0 95-99 35.3708 37.0 37.0 37.0 37.0 37.0 100-104 35.342499999999994 37.0 37.0 37.0 34.6 37.0 105-109 35.3283 37.0 37.0 37.0 37.0 37.0 110-114 35.1942 37.0 37.0 37.0 29.8 37.0 115-119 35.225 37.0 37.0 37.0 29.8 37.0 120-124 35.1442 37.0 37.0 37.0 27.4 37.0 125-129 35.013 37.0 37.0 37.0 25.0 37.0 130-134 35.014 37.0 37.0 37.0 25.0 37.0 135-139 35.0969 37.0 37.0 37.0 27.4 37.0 140-144 34.8313 37.0 37.0 37.0 25.0 37.0 145-149 34.8906 37.0 37.0 37.0 25.0 37.0 150-151 34.72775 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 3.0 22 6.0 23 11.0 24 8.0 25 14.0 26 18.0 27 26.0 28 32.0 29 33.0 30 66.0 31 81.0 32 66.0 33 144.0 34 258.0 35 765.0 36 2296.0 37 169.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.125 20.275000000000002 17.724999999999998 33.875 2 26.5 28.15 31.7 13.65 3 20.150000000000002 30.825000000000003 29.425 19.6 4 24.875 37.574999999999996 20.525 17.025000000000002 5 24.45 38.9 21.9 14.75 6 18.099999999999998 40.375 23.95 17.575 7 18.05 17.075000000000003 42.85 22.025 8 21.275 21.675 30.55 26.5 9 23.1 24.425 28.925 23.549999999999997 10-14 23.27 28.754999999999995 26.86 21.115000000000002 15-19 22.795 27.500000000000004 28.425 21.279999999999998 20-24 23.145 28.78 27.689999999999998 20.385 25-29 23.52 27.975 28.22 20.285 30-34 23.474999999999998 28.68 27.675 20.169999999999998 35-39 23.59 28.189999999999998 27.450000000000003 20.77 40-44 23.06 28.785 27.474999999999998 20.68 45-49 23.775 27.889999999999997 27.384999999999998 20.95 50-54 23.015 28.465 27.839999999999996 20.68 55-59 23.150000000000002 29.060000000000002 26.915 20.875 60-64 23.14 27.474999999999998 28.485 20.9 65-69 23.41 28.53 27.785 20.275000000000002 70-74 23.155 28.105000000000004 27.810000000000002 20.93 75-79 23.165 28.144999999999996 28.375 20.315 80-84 23.68 27.76 28.095 20.465 85-89 23.82 28.439999999999998 27.365000000000002 20.375 90-94 23.31 27.67 28.610000000000003 20.41 95-99 23.630000000000003 27.1 28.92 20.349999999999998 100-104 23.830000000000002 28.08 28.155 19.935 105-109 23.200000000000003 27.46 28.725 20.615 110-114 23.82 26.66 28.884999999999998 20.635 115-119 23.46 27.500000000000004 28.88 20.16 120-124 23.48 27.61 28.705000000000002 20.205000000000002 125-129 23.715 28.08 28.33 19.875 130-134 24.12 28.095 27.62 20.165 135-139 23.985 28.15 27.750000000000004 20.115 140-144 24.715 27.46 27.815 20.01 145-149 24.235 27.950000000000003 28.015 19.8 150-151 24.875 28.375 27.55 19.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 1.5 22 2.0 23 3.5 24 6.0 25 5.0 26 6.0 27 7.5 28 6.0 29 11.0 30 19.0 31 28.0 32 35.0 33 39.5 34 49.0 35 74.0 36 98.0 37 115.0 38 137.5 39 157.0 40 198.5 41 228.5 42 246.0 43 271.5 44 273.0 45 281.5 46 278.5 47 250.5 48 224.0 49 195.5 50 161.0 51 137.5 52 104.5 53 65.5 54 57.5 55 47.5 56 34.5 57 29.0 58 21.0 59 16.5 60 15.0 61 10.0 62 6.0 63 6.0 64 6.0 65 4.5 66 4.0 67 3.0 68 1.5 69 2.0 70 2.5 71 2.5 72 1.0 73 0.5 74 2.5 75 2.5 76 1.0 77 0.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.85 #Duplication Level Percentage of deduplicated Percentage of total 1 91.78007621121394 84.3 2 7.648339684267828 14.05 3 0.4899292324442025 1.35 4 0.08165487207403374 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.15 0.0 0.0 0.0 0.0 116-117 0.2 0.0 0.0 0.0 0.0 118-119 0.2375 0.0 0.0 0.0 0.0 120-121 0.3 0.0 0.0 0.0 0.0 122-123 0.36250000000000004 0.0 0.0 0.0 0.0 124-125 0.575 0.0 0.0 0.0 0.0 126-127 0.7625 0.0 0.0 0.0 0.0 128-129 0.9875 0.0 0.0 0.0 0.0 130-131 1.275 0.0 0.0 0.0 0.0 132-133 1.45 0.0 0.0 0.0 0.0 134-135 1.8125 0.0 0.0 0.0 0.0 136-137 2.45 0.0 0.0 0.0 0.0 138-139 2.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCCGC 10 0.006830828 145.0 7 TGATATT 10 0.006830828 145.0 4 TCAAACA 10 0.006830828 145.0 7 AGAGCGA 10 0.006830828 145.0 2 CGAGCCG 10 0.006830828 145.0 6 GAGAGCG 10 0.006830828 145.0 1 AGCCGCT 10 0.006830828 145.0 8 CAAACGC 10 0.006830828 145.0 145 AGCGAGC 10 0.006830828 145.0 4 GCGAGCC 10 0.006830828 145.0 5 >>END_MODULE Read 2259688 spots for SRR22215338.sra Written 2259688 spots for SRR22215338.sra Read 2259688 spots for SRR22215338.sra Written 2259688 spots for SRR22215338.sra Read 2259688 spots for SRR22215338.sra Written 2259688 spots for SRR22215338.sra Read 2259688 spots for SRR22215338.sra Written 2259688 spots for SRR22215338.sra Read 2259688 spots for SRR22215338.sra Written 2259688 spots for SRR22215338.sra Read 2259688 spots for SRR22215338.sra Written 2259688 spots for SRR22215338.sra Read 2259688 spots for SRR22215338.sra Written 2259688 spots for SRR22215338.sra Read 2259688 spots for SRR22215338.sra Written 2259688 spots for SRR22215338.sra Read 2259688 spots for SRR22215338.sra Written 2259688 spots for SRR22215338.sra Read 2259688 spots for SRR22215338.sra Written 2259688 spots for SRR22215338.sra Read 2259688 spots for SRR22215338.sra Written 2259688 spots for SRR22215338.sra Read 2259688 spots for SRR22215338.sra Written 2259688 spots for SRR22215338.sra Read 2259688 spots for SRR22215338.sra Written 2259688 spots for SRR22215338.sra Read 2259688 spots for SRR22215338.sra Written 2259688 spots for SRR22215338.sra Read 2259688 spots for SRR22215338.sra Written 2259688 spots for SRR22215338.sra Read 2259688 spots for SRR22215338.sra Written 2259688 spots for SRR22215338.sra Read 2259688 spots for SRR22215338.sra Written 2259688 spots for SRR22215338.sra Read 2259688 spots for SRR22215338.sra Written 2259688 spots for SRR22215338.sra Read 2259693 spots for SRR22215338.sra Written 2259693 spots for SRR22215338.sra Read 2259688 spots for SRR22215338.sra Written 2259688 spots for SRR22215338.sra SRR ids: ['SRR22215338.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_srpmgq8w SRR22215338.sra spots: 45193765 blocks: [[1, 2259688], [2259689, 4519376], [4519377, 6779064], [6779065, 9038752], [9038753, 11298440], [11298441, 13558128], [13558129, 15817816], [15817817, 18077504], [18077505, 20337192], [20337193, 22596880], [22596881, 24856568], [24856569, 27116256], [27116257, 29375944], [29375945, 31635632], [31635633, 33895320], [33895321, 36155008], [36155009, 38414696], [38414697, 40674384], [40674385, 42934072], [42934073, 45193765]] SRR22215338 file size 15337118 SRR22215338 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22215338 SRR22215338_1.fastq SRR22215338_2.fastq Input file: SRR22215338_1.fastq Paired file: SRR22215338_2.fastq trimmed: SRR22215338-trimmed-pair1.fastq, SRR22215338-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:40:43 2025 >> started Tue Feb 11 08:41:38 2025 >> done (55.001s) 45193765 read pairs processed; of these: 128 ( 0.00%) short read pairs filtered out after trimming by size control 15393 ( 0.03%) empty read pairs filtered out after trimming by size control 45178244 (99.97%) read pairs available; of these: 3354913 ( 7.43%) trimmed read pairs available after processing 41823331 (92.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 6 0.00% 21 3 0.00% 22 1 0.00% 23 4 0.00% 24 3 0.00% 25 2 0.00% 26 9 0.00% 27 2 0.00% 28 4 0.00% 29 3 0.00% 30 2 0.00% 31 6 0.00% 32 5 0.00% 33 2 0.00% 34 6 0.00% 35 11 0.00% 36 6 0.00% 37 7 0.00% 38 9 0.00% 39 8 0.00% 40 9 0.00% 41 9 0.00% 42 10 0.00% 43 16 0.00% 44 12 0.00% 45 16 0.00% 46 10 0.00% 47 16 0.00% 48 17 0.00% 49 24 0.00% 50 20 0.00% 51 19 0.00% 52 21 0.00% 53 27 0.00% 54 20 0.00% 55 31 0.00% 56 26 0.00% 57 25 0.00% 58 40 0.00% 59 37 0.00% 60 34 0.00% 61 34 0.00% 62 43 0.00% 63 46 0.00% 64 49 0.00% 65 50 0.00% 66 49 0.00% 67 42 0.00% 68 66 0.00% 69 80 0.00% 70 72 0.00% 71 84 0.00% 72 96 0.00% 73 103 0.00% 74 111 0.00% 75 138 0.00% 76 141 0.00% 77 173 0.00% 78 179 0.00% 79 210 0.00% 80 225 0.00% 81 281 0.00% 82 253 0.00% 83 300 0.00% 84 334 0.00% 85 438 0.00% 86 429 0.00% 87 444 0.00% 88 469 0.00% 89 563 0.00% 90 641 0.00% 91 647 0.00% 92 758 0.00% 93 869 0.00% 94 936 0.00% 95 1121 0.00% 96 1162 0.00% 97 1241 0.00% 98 1406 0.00% 99 1585 0.00% 100 1712 0.00% 101 1927 0.00% 102 2117 0.00% 103 2499 0.01% 104 2635 0.01% 105 2973 0.01% 106 3392 0.01% 107 3817 0.01% 108 4389 0.01% 109 4759 0.01% 110 5417 0.01% 111 6165 0.01% 112 7083 0.02% 113 7930 0.02% 114 8986 0.02% 115 10038 0.02% 116 11838 0.03% 117 13393 0.03% 118 15315 0.03% 119 17522 0.04% 120 19846 0.04% 121 22647 0.05% 122 25195 0.06% 123 28621 0.06% 124 31833 0.07% 125 35654 0.08% 126 40553 0.09% 127 44939 0.10% 128 50050 0.11% 129 54474 0.12% 130 61103 0.14% 131 67155 0.15% 132 72813 0.16% 133 79244 0.18% 134 85577 0.19% 135 92737 0.21% 136 100502 0.22% 137 108907 0.24% 138 116465 0.26% 139 126313 0.28% 140 133397 0.30% 141 141730 0.31% 142 151023 0.33% 143 158239 0.35% 144 165785 0.37% 145 175787 0.39% 146 183931 0.41% 147 192948 0.43% 148 201005 0.44% 149 212135 0.47% 150 223987 0.50% 151 41823331 92.57% 45178244 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.77 fanout-score-rank=35 prefix-density=0.24 prefix-fanout=2.7 sequence=CTCCACACTTGTA criterion=fanout-score sequence-density=0.07 sequence-density-rank=23 fanout-score=76.39 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=15.0 sequence=TCAGCAACACTGGTAGA criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=2.53 fanout-score-rank=35 prefix-density=0.12 prefix-fanout=2.5 sequence=TAACCATCTTTGCACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=580.36 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=22.4 sequence=GCAAGAAAATTAATTTGTTCATATATATAGTTGAGATACAGAAATATGGAGGCTCCTCTTAAATTCATCGGTCTTCTGGGATTGCTTGTGCTTTTGAGTGTTGCTGGAGGGGCTGATGCTGCGGGGGAATGTGGAAAATCTTCCCCAGACAATGAAGCCATGAAGCTGGCTCCTTGT SRR22215338 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 08:42:27 Started mapping on | Feb 11 08:42:27 Finished on | Feb 11 08:47:02 Mapping speed, Million of reads per hour | 591.42 Number of input reads | 45178244 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 42928110 Uniquely mapped reads % | 95.02% Average mapped length | 299.09 Number of splices: Total | 36376450 Number of splices: Annotated (sjdb) | 35592443 Number of splices: GT/AG | 35816310 Number of splices: GC/AG | 445729 Number of splices: AT/AC | 42663 Number of splices: Non-canonical | 71748 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.02% Deletion average length | 2.19 Insertion rate per base | 0.01% Insertion average length | 1.94 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 850333 % of reads mapped to multiple loci | 1.88% Number of reads mapped to too many loci | 535706 % of reads mapped to too many loci | 1.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.55% % of reads unmapped: other | 0.36% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1399801 1399801 1399801 N_multimapping 850333 850333 850333 N_noFeature 1675720 42339016 1888615 N_ambiguous 566778 3038 188777 UnstrandedReadsAssigned:40685612 PositiveStrandReadsAssigned:586056 NegativeStrandReadsAssigned:40850718 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR22215338 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22215338-trimmed-pair1.fastq SRR22215338-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 45,178,244 reads, 41,658,443 reads pseudoaligned [quant] estimated average fragment length: 200.071 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,266 rounds 52401 SRR22215338.ke.tsv 34699 SRR22215338.se.tsv 87100 total ==> SRR22215338.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1818.93 2106 27.4786 Potri.005G024800.1.v4.1 1035 835.929 431 12.2366 Potri.004G059700.1.v4.1 961 761.934 140 4.36077 Potri.007G009000.2.v4.1 1416 1216.93 0 0 Potri.003G141000.2.v4.1 2943 2743.93 956.745 8.27515 Potri.016G087400.1.v4.1 270 76.1542 2213 689.668 Potri.015G069301.1.v4.1 564 364.993 0 0 Potri.010G195200.1.v4.1 1773 1573.93 219 3.30226 Potri.012G127500.1.v4.1 977 777.934 10135 309.196 ==> SRR22215338.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4030 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 1030 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 241 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR22215338 completed mapping pipeline successfully