Starting /dee2/code/volunteer_pipeline.sh SRR22215339 current disk space = 3055723204608 free memory = 1207799784 SRR22215339 SRAfilesize 7ce58ba29171c3b02ebc6c7074566028 SRR22215339.sra SRR22215339.sra file validated SRR22215339 is paired end SRR22215339 is conventional basespace SRR22215339 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215339_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.00075 37.0 37.0 37.0 37.0 37.0 2 35.89725 37.0 37.0 37.0 37.0 37.0 3 36.242 37.0 37.0 37.0 37.0 37.0 4 36.1935 37.0 37.0 37.0 37.0 37.0 5 36.3035 37.0 37.0 37.0 37.0 37.0 6 36.331 37.0 37.0 37.0 37.0 37.0 7 36.1885 37.0 37.0 37.0 37.0 37.0 8 36.1445 37.0 37.0 37.0 37.0 37.0 9 36.2135 37.0 37.0 37.0 37.0 37.0 10-14 36.2707 37.0 37.0 37.0 37.0 37.0 15-19 36.241699999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.1913 37.0 37.0 37.0 37.0 37.0 25-29 36.08919999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.0666 37.0 37.0 37.0 37.0 37.0 35-39 35.988299999999995 37.0 37.0 37.0 37.0 37.0 40-44 35.9824 37.0 37.0 37.0 37.0 37.0 45-49 35.9468 37.0 37.0 37.0 37.0 37.0 50-54 35.9285 37.0 37.0 37.0 37.0 37.0 55-59 35.876400000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.822900000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.817699999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.803700000000006 37.0 37.0 37.0 37.0 37.0 75-79 35.8422 37.0 37.0 37.0 37.0 37.0 80-84 35.7633 37.0 37.0 37.0 37.0 37.0 85-89 35.6517 37.0 37.0 37.0 37.0 37.0 90-94 35.5624 37.0 37.0 37.0 37.0 37.0 95-99 35.6409 37.0 37.0 37.0 37.0 37.0 100-104 35.6039 37.0 37.0 37.0 37.0 37.0 105-109 35.547200000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.540499999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.5492 37.0 37.0 37.0 37.0 37.0 120-124 35.4232 37.0 37.0 37.0 34.6 37.0 125-129 35.3592 37.0 37.0 37.0 34.6 37.0 130-134 35.357600000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.3745 37.0 37.0 37.0 34.6 37.0 140-144 35.2902 37.0 37.0 37.0 32.2 37.0 145-149 35.1937 37.0 37.0 37.0 32.2 37.0 150-151 34.906 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 2.0 24 5.0 25 10.0 26 10.0 27 21.0 28 32.0 29 45.0 30 41.0 31 76.0 32 101.0 33 118.0 34 195.0 35 522.0 36 2625.0 37 195.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.10691823899371 12.251572327044025 15.69811320754717 38.943396226415096 2 28.449787127473076 13.323315802654644 34.56048084147258 23.6664162283997 3 26.474999999999998 20.525 24.45 28.549999999999997 4 28.275 25.3 21.4 25.025 5 27.900000000000002 30.225 22.8 19.075 6 19.975 33.525 24.025 22.475 7 13.8 28.499999999999996 39.574999999999996 18.125 8 17.25 25.674999999999997 31.85 25.224999999999998 9 17.424999999999997 22.5 35.949999999999996 24.125 10-14 19.595000000000002 30.53 26.87 23.005 15-19 19.855 29.425 27.905 22.814999999999998 20-24 19.495 29.69 27.625 23.189999999999998 25-29 20.28 28.804999999999996 28.165000000000003 22.75 30-34 19.56 28.925 27.47 24.044999999999998 35-39 19.905 29.65 27.375 23.07 40-44 20.09 29.115000000000002 27.675 23.119999999999997 45-49 19.735 28.99 28.060000000000002 23.215 50-54 20.380000000000003 29.455 27.089999999999996 23.075000000000003 55-59 19.975 28.725 28.02 23.28 60-64 19.950000000000003 29.12 27.700000000000003 23.23 65-69 19.785 28.565 27.965 23.685000000000002 70-74 20.255000000000003 29.110000000000003 27.405 23.23 75-79 19.96 28.999999999999996 27.150000000000002 23.89 80-84 20.415 28.99 26.974999999999998 23.62 85-89 19.845 28.99 27.395000000000003 23.77 90-94 20.165 28.884999999999998 27.425 23.525 95-99 20.365 28.815 27.500000000000004 23.32 100-104 20.169999999999998 28.465 27.389999999999997 23.974999999999998 105-109 20.4 28.28 27.779999999999998 23.54 110-114 20.724999999999998 28.470000000000002 27.900000000000002 22.905 115-119 20.235 28.544999999999998 27.42 23.799999999999997 120-124 20.885 28.255000000000003 27.894999999999996 22.965 125-129 20.825 28.08 27.52 23.575 130-134 20.849999999999998 27.715 28.415000000000003 23.02 135-139 20.695 28.349999999999998 27.48 23.474999999999998 140-144 21.17 28.544999999999998 26.625 23.66 145-149 20.724999999999998 29.225 26.565 23.485 150-151 21.95 28.425 26.1 23.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 2.0 21 4.0 22 3.5 23 3.0 24 5.5 25 7.0 26 7.0 27 9.0 28 11.0 29 18.0 30 30.5 31 38.5 32 50.5 33 61.0 34 73.5 35 82.0 36 95.5 37 121.0 38 142.0 39 166.0 40 191.0 41 206.5 42 218.0 43 238.0 44 272.5 45 267.0 46 234.5 47 232.5 48 215.0 49 187.5 50 160.0 51 121.5 52 93.5 53 82.0 54 74.0 55 59.0 56 38.5 57 31.5 58 29.0 59 23.5 60 16.5 61 10.0 62 9.0 63 7.0 64 6.0 65 6.0 66 5.5 67 4.0 68 4.5 69 3.5 70 1.5 71 1.5 72 0.5 73 2.0 74 4.0 75 3.5 76 2.5 77 1.0 78 1.5 79 1.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.625 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.375 #Duplication Level Percentage of deduplicated Percentage of total 1 93.33333333333333 87.15 2 6.238286479250334 11.65 3 0.428380187416332 1.2 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.05 0.0 102-103 0.1 0.0 0.0 0.05 0.0 104-105 0.125 0.0 0.0 0.05 0.0 106-107 0.125 0.0 0.0 0.05 0.0 108-109 0.1375 0.0 0.0 0.05 0.0 110-111 0.15 0.0 0.0 0.05 0.0 112-113 0.2 0.0 0.0 0.05 0.0 114-115 0.2375 0.0 0.0 0.05 0.0 116-117 0.3125 0.0 0.0 0.05 0.0 118-119 0.35 0.0 0.0 0.05 0.0 120-121 0.4375 0.0 0.0 0.05 0.0 122-123 0.5875 0.0 0.0 0.05 0.0 124-125 0.75 0.0 0.0 0.05 0.0 126-127 0.875 0.0 0.0 0.05 0.0 128-129 1.1375 0.0 0.0 0.05 0.0 130-131 1.45 0.0 0.0 0.05 0.0 132-133 1.8875000000000002 0.0 0.0 0.05 0.0 134-135 2.425 0.0 0.0 0.05 0.0 136-137 3.0875000000000004 0.0 0.0 0.05 0.0 138-139 3.75 0.0 0.0 0.05 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 30 0.0014437955 24.166668 100-104 >>END_MODULE SRR22215339 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215339_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.7275 37.0 37.0 37.0 37.0 37.0 2 36.1125 37.0 37.0 37.0 37.0 37.0 3 36.1545 37.0 37.0 37.0 37.0 37.0 4 36.0565 37.0 37.0 37.0 37.0 37.0 5 36.066 37.0 37.0 37.0 37.0 37.0 6 36.0025 37.0 37.0 37.0 37.0 37.0 7 36.1235 37.0 37.0 37.0 37.0 37.0 8 36.053 37.0 37.0 37.0 37.0 37.0 9 36.0405 37.0 37.0 37.0 37.0 37.0 10-14 36.1241 37.0 37.0 37.0 37.0 37.0 15-19 36.077200000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.1056 37.0 37.0 37.0 37.0 37.0 25-29 35.9683 37.0 37.0 37.0 37.0 37.0 30-34 35.9474 37.0 37.0 37.0 37.0 37.0 35-39 35.9204 37.0 37.0 37.0 37.0 37.0 40-44 35.8876 37.0 37.0 37.0 37.0 37.0 45-49 35.848 37.0 37.0 37.0 37.0 37.0 50-54 35.7656 37.0 37.0 37.0 37.0 37.0 55-59 35.8406 37.0 37.0 37.0 37.0 37.0 60-64 35.7261 37.0 37.0 37.0 37.0 37.0 65-69 35.6734 37.0 37.0 37.0 37.0 37.0 70-74 35.6032 37.0 37.0 37.0 37.0 37.0 75-79 35.57469999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.556400000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.6053 37.0 37.0 37.0 37.0 37.0 90-94 35.4794 37.0 37.0 37.0 37.0 37.0 95-99 35.436600000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.425 37.0 37.0 37.0 37.0 37.0 105-109 35.44199999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.3467 37.0 37.0 37.0 34.6 37.0 115-119 35.3769 37.0 37.0 37.0 37.0 37.0 120-124 35.3136 37.0 37.0 37.0 37.0 37.0 125-129 35.2076 37.0 37.0 37.0 27.4 37.0 130-134 35.1916 37.0 37.0 37.0 32.2 37.0 135-139 35.142399999999995 37.0 37.0 37.0 27.4 37.0 140-144 35.064 37.0 37.0 37.0 25.0 37.0 145-149 34.9989 37.0 37.0 37.0 25.0 37.0 150-151 34.858999999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 0.0 17 2.0 18 0.0 19 3.0 20 0.0 21 4.0 22 6.0 23 9.0 24 8.0 25 15.0 26 14.0 27 24.0 28 20.0 29 43.0 30 54.0 31 54.0 32 81.0 33 121.0 34 228.0 35 676.0 36 2415.0 37 221.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.599999999999998 22.0 16.325 31.075000000000003 2 27.800000000000004 29.575000000000003 29.299999999999997 13.325000000000001 3 21.8 31.75 27.675 18.775 4 25.174999999999997 34.075 22.675 18.075 5 27.950000000000003 36.075 21.45 14.524999999999999 6 19.675 40.525 22.75 17.05 7 21.349999999999998 17.775 40.150000000000006 20.724999999999998 8 21.975 25.15 28.349999999999998 24.525 9 23.674999999999997 24.625 28.999999999999996 22.7 10-14 24.495 28.59 26.155 20.76 15-19 24.02 28.125 27.965 19.89 20-24 24.04 28.945 26.924999999999997 20.09 25-29 23.98 28.075 27.925 20.02 30-34 23.669999999999998 29.104999999999997 27.26 19.965 35-39 23.465 28.16 27.29 21.085 40-44 23.505000000000003 28.125 27.595 20.775 45-49 23.34 27.92 28.305000000000003 20.435 50-54 23.615 27.700000000000003 28.235 20.45 55-59 24.07 27.544999999999998 27.694999999999997 20.69 60-64 23.895 27.905 27.925 20.275000000000002 65-69 23.445 27.689999999999998 27.794999999999998 21.07 70-74 22.900000000000002 27.935 28.63 20.535 75-79 23.69 27.235 28.794999999999998 20.28 80-84 23.445 27.115000000000002 28.875 20.565 85-89 23.585 27.595 28.04 20.78 90-94 23.599999999999998 28.470000000000002 27.744999999999997 20.185 95-99 23.669999999999998 27.74 28.345 20.244999999999997 100-104 24.19 28.395 27.525 19.89 105-109 23.48 27.975 28.610000000000003 19.935 110-114 23.47 28.18 28.139999999999997 20.21 115-119 23.28 28.455000000000002 28.275 19.99 120-124 23.87 28.134999999999998 27.800000000000004 20.195 125-129 23.119999999999997 27.950000000000003 28.975 19.955000000000002 130-134 23.965 28.185 28.34 19.509999999999998 135-139 24.245 28.005000000000003 27.925 19.825 140-144 23.74 28.294999999999998 27.99 19.975 145-149 24.65 28.255000000000003 27.255000000000003 19.84 150-151 24.712500000000002 28.5875 27.400000000000002 19.3 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 2.0 22 1.0 23 0.5 24 1.0 25 1.5 26 4.0 27 7.5 28 12.0 29 14.5 30 20.5 31 21.5 32 29.0 33 46.0 34 60.0 35 72.0 36 92.0 37 122.0 38 153.5 39 176.5 40 190.0 41 209.0 42 232.5 43 256.0 44 275.0 45 274.5 46 254.0 47 236.5 48 213.5 49 200.0 50 169.5 51 133.0 52 106.5 53 81.0 54 71.5 55 49.5 56 36.5 57 31.0 58 19.0 59 16.0 60 15.5 61 11.5 62 11.0 63 13.0 64 9.0 65 3.0 66 2.0 67 2.5 68 2.5 69 4.0 70 4.0 71 2.0 72 3.0 73 4.5 74 3.0 75 3.0 76 2.0 77 0.5 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 1.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.30000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.27438370846731 87.02499999999999 2 6.270096463022508 11.700000000000001 3 0.45551982851018225 1.275 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.21250000000000002 0.0 0.0 0.0 0.0 116-117 0.2875 0.0 0.0 0.0 0.0 118-119 0.3375 0.0 0.0 0.0 0.0 120-121 0.45 0.0 0.0 0.0 0.0 122-123 0.6125 0.0 0.0 0.0 0.0 124-125 0.75 0.0 0.0 0.0 0.0 126-127 0.875 0.0 0.0 0.0 0.0 128-129 1.0875 0.0 0.0 0.0 0.0 130-131 1.375 0.0 0.0 0.0 0.0 132-133 1.75 0.0 0.0 0.0 0.0 134-135 2.25 0.0 0.0 0.0 0.0 136-137 2.875 0.0 0.0 0.0 0.0 138-139 3.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATTATG 10 0.006830828 145.0 5 ATTATGT 10 0.006830828 145.0 6 >>END_MODULE Read 2030449 spots for SRR22215339.sra Written 2030449 spots for SRR22215339.sra Read 2030449 spots for SRR22215339.sra Written 2030449 spots for SRR22215339.sra Read 2030449 spots for SRR22215339.sra Written 2030449 spots for SRR22215339.sra Read 2030449 spots for SRR22215339.sra Written 2030449 spots for SRR22215339.sra Read 2030449 spots for SRR22215339.sra Written 2030449 spots for SRR22215339.sra Read 2030449 spots for SRR22215339.sra Written 2030449 spots for SRR22215339.sra Read 2030449 spots for SRR22215339.sra Written 2030449 spots for SRR22215339.sra Read 2030449 spots for SRR22215339.sra Written 2030449 spots for SRR22215339.sra Read 2030449 spots for SRR22215339.sra Written 2030449 spots for SRR22215339.sra Read 2030449 spots for SRR22215339.sra Written 2030449 spots for SRR22215339.sra Read 2030449 spots for SRR22215339.sra Written 2030449 spots for SRR22215339.sra Read 2030449 spots for SRR22215339.sra Written 2030449 spots for SRR22215339.sra Read 2030449 spots for SRR22215339.sra Written 2030449 spots for SRR22215339.sra Read 2030449 spots for SRR22215339.sra Written 2030449 spots for SRR22215339.sra Read 2030449 spots for SRR22215339.sra Written 2030449 spots for SRR22215339.sra Read 2030449 spots for SRR22215339.sra Written 2030449 spots for SRR22215339.sra Read 2030449 spots for SRR22215339.sra Written 2030449 spots for SRR22215339.sra Read 2030449 spots for SRR22215339.sra Written 2030449 spots for SRR22215339.sra Read 2030449 spots for SRR22215339.sra Written 2030449 spots for SRR22215339.sra Read 2030449 spots for SRR22215339.sra Written 2030449 spots for SRR22215339.sra SRR ids: ['SRR22215339.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5_6314sy SRR22215339.sra spots: 40608980 blocks: [[1, 2030449], [2030450, 4060898], [4060899, 6091347], [6091348, 8121796], [8121797, 10152245], [10152246, 12182694], [12182695, 14213143], [14213144, 16243592], [16243593, 18274041], [18274042, 20304490], [20304491, 22334939], [22334940, 24365388], [24365389, 26395837], [26395838, 28426286], [28426287, 30456735], [30456736, 32487184], [32487185, 34517633], [34517634, 36548082], [36548083, 38578531], [38578532, 40608980]] SRR22215339 file size 13779007 SRR22215339 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22215339 SRR22215339_1.fastq SRR22215339_2.fastq Input file: SRR22215339_1.fastq Paired file: SRR22215339_2.fastq trimmed: SRR22215339-trimmed-pair1.fastq, SRR22215339-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:31:51 2025 >> started Tue Feb 11 08:32:40 2025 >> done (49.084s) 40608980 read pairs processed; of these: 99 ( 0.00%) short read pairs filtered out after trimming by size control 28389 ( 0.07%) empty read pairs filtered out after trimming by size control 40580492 (99.93%) read pairs available; of these: 4184076 (10.31%) trimmed read pairs available after processing 36396416 (89.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 6 0.00% 20 3 0.00% 21 7 0.00% 22 5 0.00% 23 6 0.00% 24 3 0.00% 25 7 0.00% 26 7 0.00% 27 5 0.00% 28 10 0.00% 29 5 0.00% 30 2 0.00% 31 6 0.00% 32 6 0.00% 33 3 0.00% 34 10 0.00% 35 8 0.00% 36 12 0.00% 37 8 0.00% 38 10 0.00% 39 15 0.00% 40 12 0.00% 41 9 0.00% 42 11 0.00% 43 20 0.00% 44 20 0.00% 45 15 0.00% 46 20 0.00% 47 19 0.00% 48 15 0.00% 49 19 0.00% 50 19 0.00% 51 22 0.00% 52 28 0.00% 53 24 0.00% 54 23 0.00% 55 36 0.00% 56 29 0.00% 57 26 0.00% 58 33 0.00% 59 57 0.00% 60 42 0.00% 61 44 0.00% 62 45 0.00% 63 60 0.00% 64 66 0.00% 65 68 0.00% 66 72 0.00% 67 85 0.00% 68 98 0.00% 69 88 0.00% 70 150 0.00% 71 154 0.00% 72 179 0.00% 73 167 0.00% 74 190 0.00% 75 212 0.00% 76 245 0.00% 77 246 0.00% 78 268 0.00% 79 340 0.00% 80 332 0.00% 81 425 0.00% 82 474 0.00% 83 480 0.00% 84 614 0.00% 85 649 0.00% 86 722 0.00% 87 817 0.00% 88 927 0.00% 89 1052 0.00% 90 1123 0.00% 91 1171 0.00% 92 1488 0.00% 93 1517 0.00% 94 1660 0.00% 95 1906 0.00% 96 2062 0.01% 97 2463 0.01% 98 2528 0.01% 99 2848 0.01% 100 3155 0.01% 101 3402 0.01% 102 3575 0.01% 103 4126 0.01% 104 4414 0.01% 105 4955 0.01% 106 5616 0.01% 107 6024 0.01% 108 6823 0.02% 109 7402 0.02% 110 8340 0.02% 111 8909 0.02% 112 10154 0.03% 113 11364 0.03% 114 12577 0.03% 115 14432 0.04% 116 16307 0.04% 117 18811 0.05% 118 20948 0.05% 119 23563 0.06% 120 26266 0.06% 121 29403 0.07% 122 32653 0.08% 123 36898 0.09% 124 40838 0.10% 125 46176 0.11% 126 50889 0.13% 127 57791 0.14% 128 64057 0.16% 129 70771 0.17% 130 77905 0.19% 131 84432 0.21% 132 91368 0.23% 133 99413 0.24% 134 107101 0.26% 135 115260 0.28% 136 125744 0.31% 137 134178 0.33% 138 145276 0.36% 139 158551 0.39% 140 165900 0.41% 141 176841 0.44% 142 186021 0.46% 143 195101 0.48% 144 203989 0.50% 145 213411 0.53% 146 222230 0.55% 147 232542 0.57% 148 244857 0.60% 149 255665 0.63% 150 268968 0.66% 151 36396416 89.69% 40580492 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=5.55 fanout-score-rank=27 prefix-density=0.18 prefix-fanout=4.2 sequence=GGTGCTGGAGCTGGAGC criterion=fanout-score sequence-density=0.07 sequence-density-rank=18 fanout-score=318.85 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=29.2 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=4.88 fanout-score-rank=19 prefix-density=0.17 prefix-fanout=3.5 sequence=AAGATCCAGGACAAGGAAGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=17 fanout-score=332.93 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=28.6 sequence=AAGAAGAAGAAG SRR22215339 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 08:33:27 Started mapping on | Feb 11 08:33:27 Finished on | Feb 11 08:37:31 Mapping speed, Million of reads per hour | 598.73 Number of input reads | 40580492 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 37440849 Uniquely mapped reads % | 92.26% Average mapped length | 298.20 Number of splices: Total | 29824150 Number of splices: Annotated (sjdb) | 29240054 Number of splices: GT/AG | 29361747 Number of splices: GC/AG | 357946 Number of splices: AT/AC | 36675 Number of splices: Non-canonical | 67782 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.05 Insertion rate per base | 0.02% Insertion average length | 1.87 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 907595 % of reads mapped to multiple loci | 2.24% Number of reads mapped to too many loci | 1115031 % of reads mapped to too many loci | 2.75% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.94% % of reads unmapped: other | 0.81% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2232048 2232048 2232048 N_multimapping 907595 907595 907595 N_noFeature 1697965 36990118 1865846 N_ambiguous 466097 2482 181599 UnstrandedReadsAssigned:35276787 PositiveStrandReadsAssigned:448249 NegativeStrandReadsAssigned:35393404 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR22215339 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22215339-trimmed-pair1.fastq SRR22215339-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 40,580,492 reads, 36,614,827 reads pseudoaligned [quant] estimated average fragment length: 193.695 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,197 rounds 52401 SRR22215339.ke.tsv 34699 SRR22215339.se.tsv 87100 total ==> SRR22215339.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1825.31 4076 60.4932 Potri.005G024800.1.v4.1 1035 842.305 938 30.1676 Potri.004G059700.1.v4.1 961 768.305 217 7.65127 Potri.007G009000.2.v4.1 1416 1223.31 0 0 Potri.003G141000.2.v4.1 2943 2750.31 1243.14 12.2447 Potri.016G087400.1.v4.1 270 82.1425 1642 541.519 Potri.015G069301.1.v4.1 564 371.33 0 0 Potri.010G195200.1.v4.1 1773 1580.31 79 1.35423 Potri.012G127500.1.v4.1 977 784.305 11003 380.044 ==> SRR22215339.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1960 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 836 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 164 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR22215339 completed mapping pipeline successfully