Starting /dee2/code/volunteer_pipeline.sh SRR22215340 current disk space = 3055526338560 free memory = 1454987300 SRR22215340 SRAfilesize e374a306c393aa19a7102720f1b12003 SRR22215340.sra SRR22215340.sra file validated SRR22215340 is paired end SRR22215340 is conventional basespace SRR22215340 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215340_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.96075 37.0 37.0 37.0 37.0 37.0 2 36.0975 37.0 37.0 37.0 37.0 37.0 3 36.286 37.0 37.0 37.0 37.0 37.0 4 36.252 37.0 37.0 37.0 37.0 37.0 5 36.28 37.0 37.0 37.0 37.0 37.0 6 36.3795 37.0 37.0 37.0 37.0 37.0 7 36.258 37.0 37.0 37.0 37.0 37.0 8 36.3215 37.0 37.0 37.0 37.0 37.0 9 36.238 37.0 37.0 37.0 37.0 37.0 10-14 36.3378 37.0 37.0 37.0 37.0 37.0 15-19 36.2739 37.0 37.0 37.0 37.0 37.0 20-24 36.2147 37.0 37.0 37.0 37.0 37.0 25-29 36.1728 37.0 37.0 37.0 37.0 37.0 30-34 36.073699999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.0544 37.0 37.0 37.0 37.0 37.0 40-44 36.0238 37.0 37.0 37.0 37.0 37.0 45-49 35.932399999999994 37.0 37.0 37.0 37.0 37.0 50-54 35.8553 37.0 37.0 37.0 37.0 37.0 55-59 35.8417 37.0 37.0 37.0 37.0 37.0 60-64 35.806000000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.7855 37.0 37.0 37.0 37.0 37.0 70-74 35.7496 37.0 37.0 37.0 37.0 37.0 75-79 35.7774 37.0 37.0 37.0 37.0 37.0 80-84 35.7364 37.0 37.0 37.0 37.0 37.0 85-89 35.7394 37.0 37.0 37.0 37.0 37.0 90-94 35.607800000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.6569 37.0 37.0 37.0 37.0 37.0 100-104 35.5869 37.0 37.0 37.0 37.0 37.0 105-109 35.55 37.0 37.0 37.0 37.0 37.0 110-114 35.6053 37.0 37.0 37.0 37.0 37.0 115-119 35.5068 37.0 37.0 37.0 37.0 37.0 120-124 35.4706 37.0 37.0 37.0 37.0 37.0 125-129 35.4203 37.0 37.0 37.0 37.0 37.0 130-134 35.4421 37.0 37.0 37.0 34.6 37.0 135-139 35.3292 37.0 37.0 37.0 34.6 37.0 140-144 35.2732 37.0 37.0 37.0 32.2 37.0 145-149 35.1661 37.0 37.0 37.0 32.2 37.0 150-151 35.0575 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 4.0 21 0.0 22 2.0 23 3.0 24 7.0 25 8.0 26 11.0 27 17.0 28 30.0 29 30.0 30 67.0 31 68.0 32 76.0 33 130.0 34 200.0 35 471.0 36 2714.0 37 162.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.24113653507669 10.91274830274076 18.481267286899673 37.36484787528288 2 28.521303258145362 16.11528822055138 31.403508771929822 23.959899749373434 3 26.150000000000002 23.525 22.125 28.199999999999996 4 26.474999999999998 30.8 19.275000000000002 23.45 5 24.825 33.75 22.35 19.075 6 17.45 36.525 25.324999999999996 20.7 7 12.9 28.025 40.050000000000004 19.025 8 16.1 26.150000000000002 32.9 24.85 9 18.6 22.85 33.475 25.074999999999996 10-14 19.705000000000002 31.105 26.845000000000002 22.345000000000002 15-19 19.869999999999997 29.835 27.189999999999998 23.105 20-24 19.93 29.165000000000003 27.925 22.98 25-29 19.325 29.75 27.92 23.005 30-34 18.925 29.43 28.405 23.24 35-39 19.25 29.830000000000002 27.175 23.745 40-44 19.7 28.965000000000003 28.585 22.75 45-49 20.105 29.285 27.73 22.88 50-54 19.98 29.439999999999998 27.54 23.04 55-59 19.400000000000002 29.744999999999997 27.544999999999998 23.31 60-64 19.03 29.09 27.884999999999998 23.995 65-69 19.375 29.565 27.185 23.875 70-74 20.015 29.075 27.38 23.53 75-79 19.715 29.354999999999997 27.334999999999997 23.595 80-84 20.305 29.330000000000002 26.784999999999997 23.580000000000002 85-89 19.77 29.125 27.445000000000004 23.66 90-94 20.085 29.335 27.145000000000003 23.435 95-99 20.349999999999998 29.24 27.01 23.400000000000002 100-104 20.185 29.244999999999997 27.169999999999998 23.400000000000002 105-109 19.905 28.665000000000003 27.93 23.5 110-114 20.495 28.810000000000002 27.41 23.285 115-119 20.325 29.085 27.800000000000004 22.79 120-124 19.84 28.615000000000002 27.889999999999997 23.655 125-129 20.165 28.515 27.744999999999997 23.575 130-134 20.285 28.970000000000002 27.985 22.759999999999998 135-139 20.585 28.355000000000004 27.169999999999998 23.89 140-144 20.905 28.79 26.729999999999997 23.575 145-149 21.295 28.935 26.43 23.34 150-151 20.275000000000002 30.0375 26.337500000000002 23.35 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 1.5 19 3.0 20 2.5 21 1.5 22 1.5 23 1.5 24 1.5 25 4.0 26 11.5 27 17.0 28 18.5 29 23.5 30 30.5 31 56.5 32 67.5 33 69.5 34 82.0 35 91.0 36 113.0 37 134.5 38 146.0 39 149.5 40 177.5 41 205.0 42 222.5 43 248.5 44 251.0 45 243.5 46 232.0 47 222.0 48 200.5 49 175.5 50 155.5 51 125.5 52 104.5 53 88.5 54 68.0 55 50.5 56 37.0 57 24.0 58 20.0 59 21.5 60 20.0 61 16.5 62 10.5 63 5.5 64 5.0 65 3.5 66 4.5 67 6.0 68 5.5 69 5.0 70 4.0 71 2.5 72 1.5 73 3.0 74 2.5 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.575 2 0.25 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.80000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 92.78017241379311 86.1 2 6.8157327586206895 12.65 3 0.3232758620689655 0.8999999999999999 4 0.05387931034482758 0.2 5 0.0 0.0 6 0.02693965517241379 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGC 6 0.15 TruSeq Adapter, Index 3 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.21250000000000002 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.32499999999999996 0.0 0.0 0.0 0.0 114-115 0.3625 0.0 0.0 0.0 0.0 116-117 0.4 0.0 0.0 0.0 0.0 118-119 0.4625 0.0 0.0 0.0 0.0 120-121 0.55 0.0 0.0 0.0 0.0 122-123 0.625 0.0 0.0 0.0 0.0 124-125 0.8375 0.0 0.0 0.0 0.0 126-127 1.025 0.0 0.0 0.0 0.0 128-129 1.2000000000000002 0.0 0.0 0.0 0.0 130-131 1.575 0.0 0.0 0.0 0.0 132-133 2.0625 0.0 0.0 0.0 0.0 134-135 2.425 0.0 0.0 0.0 0.0 136-137 3.075 0.0 0.0 0.0 0.0 138-139 3.7249999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGCCCA 10 0.0065789125 146.81013 1 AAACATT 10 0.0068343505 144.975 4 >>END_MODULE SRR22215340 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215340_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.3215 37.0 37.0 37.0 37.0 37.0 2 35.9815 37.0 37.0 37.0 37.0 37.0 3 35.955 37.0 37.0 37.0 37.0 37.0 4 35.851 37.0 37.0 37.0 37.0 37.0 5 35.9 37.0 37.0 37.0 37.0 37.0 6 36.0075 37.0 37.0 37.0 37.0 37.0 7 35.9785 37.0 37.0 37.0 37.0 37.0 8 35.893 37.0 37.0 37.0 37.0 37.0 9 35.957 37.0 37.0 37.0 37.0 37.0 10-14 35.866600000000005 37.0 37.0 37.0 37.0 37.0 15-19 35.8591 37.0 37.0 37.0 37.0 37.0 20-24 35.8762 37.0 37.0 37.0 37.0 37.0 25-29 35.741699999999994 37.0 37.0 37.0 37.0 37.0 30-34 35.6436 37.0 37.0 37.0 37.0 37.0 35-39 35.7173 37.0 37.0 37.0 37.0 37.0 40-44 35.616600000000005 37.0 37.0 37.0 37.0 37.0 45-49 35.621300000000005 37.0 37.0 37.0 37.0 37.0 50-54 35.519099999999995 37.0 37.0 37.0 37.0 37.0 55-59 35.493399999999994 37.0 37.0 37.0 37.0 37.0 60-64 35.496500000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.4494 37.0 37.0 37.0 37.0 37.0 70-74 35.4863 37.0 37.0 37.0 37.0 37.0 75-79 35.3447 37.0 37.0 37.0 34.6 37.0 80-84 35.3497 37.0 37.0 37.0 37.0 37.0 85-89 35.3377 37.0 37.0 37.0 34.6 37.0 90-94 35.3147 37.0 37.0 37.0 34.6 37.0 95-99 35.35209999999999 37.0 37.0 37.0 34.6 37.0 100-104 35.2332 37.0 37.0 37.0 32.2 37.0 105-109 35.2116 37.0 37.0 37.0 29.8 37.0 110-114 35.2313 37.0 37.0 37.0 29.8 37.0 115-119 35.1324 37.0 37.0 37.0 25.0 37.0 120-124 35.0533 37.0 37.0 37.0 25.0 37.0 125-129 35.0025 37.0 37.0 37.0 25.0 37.0 130-134 34.9673 37.0 37.0 37.0 25.0 37.0 135-139 34.8654 37.0 37.0 37.0 25.0 37.0 140-144 34.8451 37.0 37.0 37.0 25.0 37.0 145-149 34.6795 37.0 37.0 37.0 25.0 37.0 150-151 34.711 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 0.0 17 0.0 18 2.0 19 5.0 20 3.0 21 2.0 22 5.0 23 8.0 24 13.0 25 21.0 26 19.0 27 29.0 28 34.0 29 36.0 30 45.0 31 73.0 32 90.0 33 138.0 34 287.0 35 885.0 36 2183.0 37 121.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.674999999999997 19.05 19.325 29.95 2 26.8 27.975 30.8 14.424999999999999 3 23.1 30.65 28.449999999999996 17.8 4 25.8 36.125 20.4 17.675 5 24.85 38.25 21.85 15.049999999999999 6 19.6 40.35 23.799999999999997 16.25 7 19.975 16.8 42.25 20.974999999999998 8 21.325 21.95 31.05 25.674999999999997 9 23.275000000000002 23.599999999999998 29.4 23.724999999999998 10-14 24.83 28.439999999999998 25.995 20.735 15-19 23.885 27.825 28.685 19.605 20-24 24.22 28.21 27.47 20.1 25-29 24.065 28.585 27.77 19.580000000000002 30-34 23.91 28.325 28.1 19.665 35-39 23.974999999999998 28.675 27.62 19.73 40-44 24.2 27.96 27.99 19.85 45-49 23.32 28.720000000000002 27.665 20.294999999999998 50-54 23.59 28.455000000000002 28.46 19.495 55-59 24.315 28.555000000000003 27.77 19.36 60-64 24.03 28.185 28.720000000000002 19.064999999999998 65-69 24.395 27.87 28.01 19.725 70-74 24.18 28.194999999999997 27.98 19.645000000000003 75-79 23.794999999999998 27.71 28.33 20.165 80-84 23.77 28.595 27.685 19.950000000000003 85-89 23.625 28.439999999999998 28.275 19.66 90-94 23.48 28.375 28.005000000000003 20.14 95-99 23.785 27.85 28.58 19.785 100-104 24.55 27.855 28.175 19.42 105-109 23.49 27.560000000000002 29.14 19.81 110-114 23.79 27.255000000000003 28.749999999999996 20.205000000000002 115-119 23.69 28.134999999999998 28.945 19.23 120-124 23.810000000000002 27.87 28.610000000000003 19.71 125-129 24.11 27.725 28.794999999999998 19.37 130-134 24.395 28.03 28.64 18.935 135-139 23.885 28.215 28.744999999999997 19.155 140-144 24.63 28.075 28.07 19.225 145-149 24.990000000000002 27.955000000000002 28.105000000000004 18.95 150-151 25.0 28.962500000000002 27.537499999999998 18.5 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 1.0 16 1.5 17 2.0 18 1.5 19 1.0 20 1.5 21 1.0 22 3.0 23 3.5 24 1.5 25 2.5 26 6.0 27 10.0 28 11.0 29 13.5 30 18.0 31 24.0 32 38.0 33 51.0 34 71.0 35 87.5 36 99.0 37 128.0 38 151.5 39 170.5 40 194.0 41 208.5 42 235.5 43 256.0 44 270.0 45 276.5 46 256.0 47 230.5 48 209.0 49 185.0 50 155.5 51 133.5 52 121.0 53 93.0 54 60.0 55 43.0 56 32.0 57 26.0 58 20.5 59 15.0 60 10.5 61 10.0 62 9.0 63 8.5 64 5.5 65 3.0 66 3.0 67 2.0 68 3.5 69 3.0 70 1.0 71 1.0 72 0.5 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.5 87 2.0 88 1.5 89 1.0 90 1.5 91 0.5 92 1.5 93 1.5 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.4 #Duplication Level Percentage of deduplicated Percentage of total 1 93.28158458244111 87.125 2 6.397216274089936 11.95 3 0.2944325481798715 0.8250000000000001 4 0.02676659528907923 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.2875 0.0 0.0 0.0 0.0 110-111 0.3 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.3875 0.0 0.0 0.0 0.0 116-117 0.425 0.0 0.0 0.0 0.0 118-119 0.48750000000000004 0.0 0.0 0.0 0.0 120-121 0.575 0.0 0.0 0.0 0.0 122-123 0.6499999999999999 0.0 0.0 0.0 0.0 124-125 0.8625 0.0 0.0 0.0 0.0 126-127 1.025 0.0 0.0 0.0 0.0 128-129 1.1749999999999998 0.0 0.0 0.0 0.0 130-131 1.5 0.0 0.0 0.0 0.0 132-133 1.9625 0.0 0.0 0.0 0.0 134-135 2.325 0.0 0.0 0.0 0.0 136-137 2.9625000000000004 0.0 0.0 0.0 0.0 138-139 3.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGAGTT 10 0.006830828 145.0 7 ATTGAGT 10 0.006830828 145.0 6 >>END_MODULE Read 1592450 spots for SRR22215340.sra Written 1592450 spots for SRR22215340.sra Read 1592450 spots for SRR22215340.sra Written 1592450 spots for SRR22215340.sra Read 1592450 spots for SRR22215340.sra Written 1592450 spots for SRR22215340.sra Read 1592450 spots for SRR22215340.sra Written 1592450 spots for SRR22215340.sra Read 1592450 spots for SRR22215340.sra Written 1592450 spots for SRR22215340.sra Read 1592450 spots for SRR22215340.sra Written 1592450 spots for SRR22215340.sra Read 1592450 spots for SRR22215340.sra Written 1592450 spots for SRR22215340.sra Read 1592450 spots for SRR22215340.sra Written 1592450 spots for SRR22215340.sra Read 1592450 spots for SRR22215340.sra Written 1592450 spots for SRR22215340.sra Read 1592450 spots for SRR22215340.sra Written 1592450 spots for SRR22215340.sra Read 1592450 spots for SRR22215340.sra Written 1592450 spots for SRR22215340.sra Read 1592466 spots for SRR22215340.sra Written 1592466 spots for SRR22215340.sra Read 1592450 spots for SRR22215340.sra Written 1592450 spots for SRR22215340.sra Read 1592450 spots for SRR22215340.sra Written 1592450 spots for SRR22215340.sra Read 1592450 spots for SRR22215340.sra Written 1592450 spots for SRR22215340.sra Read 1592450 spots for SRR22215340.sra Written 1592450 spots for SRR22215340.sra Read 1592450 spots for SRR22215340.sra Written 1592450 spots for SRR22215340.sra Read 1592450 spots for SRR22215340.sra Written 1592450 spots for SRR22215340.sra Read 1592450 spots for SRR22215340.sra Written 1592450 spots for SRR22215340.sra Read 1592450 spots for SRR22215340.sra Written 1592450 spots for SRR22215340.sra SRR ids: ['SRR22215340.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j5sh07h2 SRR22215340.sra spots: 31849016 blocks: [[1, 1592450], [1592451, 3184900], [3184901, 4777350], [4777351, 6369800], [6369801, 7962250], [7962251, 9554700], [9554701, 11147150], [11147151, 12739600], [12739601, 14332050], [14332051, 15924500], [15924501, 17516950], [17516951, 19109400], [19109401, 20701850], [20701851, 22294300], [22294301, 23886750], [23886751, 25479200], [25479201, 27071650], [27071651, 28664100], [28664101, 30256550], [30256551, 31849016]] SRR22215340 file size 10801988 SRR22215340 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22215340 SRR22215340_1.fastq SRR22215340_2.fastq Input file: SRR22215340_1.fastq Paired file: SRR22215340_2.fastq trimmed: SRR22215340-trimmed-pair1.fastq, SRR22215340-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:06:10 2025 >> started Tue Feb 11 09:06:47 2025 >> done (37.685s) 31849016 read pairs processed; of these: 360 ( 0.00%) short read pairs filtered out after trimming by size control 80141 ( 0.25%) empty read pairs filtered out after trimming by size control 31768515 (99.75%) read pairs available; of these: 2948155 ( 9.28%) trimmed read pairs available after processing 28820360 (90.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 3 0.00% 20 9 0.00% 21 9 0.00% 22 6 0.00% 23 1 0.00% 24 4 0.00% 25 6 0.00% 26 2 0.00% 27 4 0.00% 28 4 0.00% 29 16 0.00% 30 10 0.00% 31 9 0.00% 32 10 0.00% 33 9 0.00% 34 8 0.00% 35 6 0.00% 36 7 0.00% 37 7 0.00% 38 7 0.00% 39 9 0.00% 40 8 0.00% 41 6 0.00% 42 3 0.00% 43 11 0.00% 44 8 0.00% 45 13 0.00% 46 15 0.00% 47 12 0.00% 48 14 0.00% 49 16 0.00% 50 22 0.00% 51 18 0.00% 52 18 0.00% 53 19 0.00% 54 24 0.00% 55 24 0.00% 56 26 0.00% 57 21 0.00% 58 32 0.00% 59 30 0.00% 60 27 0.00% 61 37 0.00% 62 39 0.00% 63 54 0.00% 64 51 0.00% 65 39 0.00% 66 69 0.00% 67 66 0.00% 68 85 0.00% 69 84 0.00% 70 98 0.00% 71 110 0.00% 72 89 0.00% 73 125 0.00% 74 123 0.00% 75 182 0.00% 76 173 0.00% 77 182 0.00% 78 208 0.00% 79 224 0.00% 80 249 0.00% 81 331 0.00% 82 362 0.00% 83 406 0.00% 84 412 0.00% 85 477 0.00% 86 519 0.00% 87 623 0.00% 88 629 0.00% 89 693 0.00% 90 799 0.00% 91 901 0.00% 92 1016 0.00% 93 1105 0.00% 94 1269 0.00% 95 1448 0.00% 96 1433 0.00% 97 1676 0.01% 98 1875 0.01% 99 2030 0.01% 100 2196 0.01% 101 2458 0.01% 102 2687 0.01% 103 3025 0.01% 104 3279 0.01% 105 3537 0.01% 106 3887 0.01% 107 4345 0.01% 108 4741 0.01% 109 5350 0.02% 110 5912 0.02% 111 6585 0.02% 112 7351 0.02% 113 8077 0.03% 114 9222 0.03% 115 10108 0.03% 116 11346 0.04% 117 13104 0.04% 118 14409 0.05% 119 16416 0.05% 120 18222 0.06% 121 20929 0.07% 122 23287 0.07% 123 25841 0.08% 124 28694 0.09% 125 32123 0.10% 126 35920 0.11% 127 40420 0.13% 128 44223 0.14% 129 48666 0.15% 130 53853 0.17% 131 59186 0.19% 132 64289 0.20% 133 69989 0.22% 134 76101 0.24% 135 82067 0.26% 136 87800 0.28% 137 95052 0.30% 138 102649 0.32% 139 109651 0.35% 140 116008 0.37% 141 123200 0.39% 142 130886 0.41% 143 137294 0.43% 144 144602 0.46% 145 151635 0.48% 146 158679 0.50% 147 166252 0.52% 148 172977 0.54% 149 179817 0.57% 150 188991 0.59% 151 28820360 90.72% 31768515 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.76 fanout-score-rank=28 prefix-density=0.17 prefix-fanout=2.6 sequence=CTCCACACTTGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=175.33 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=8.7 sequence=AAGCAAAGACAGACGGTCACATTTGATCCACAAAACACATCACTCGAAAATAAAGTCACGTCTGAAACAGGTATCAATGTATATCGCGTTTTTTCGAAGATGAATAGTATTGTTGTTCAGGGAATAAGCTTGCTACCAGCAACATCGACAACGAATCTATATCTCACATCATTTTTCTCAAGCCTCTCGAATGCTGTGTTGATATAATCCATTTTGATCACTTCAATCATGGAGGCCAATCCCTTTTCCTTGCAGAACTCAAGCATCTCCTCTGTCTCCTTCATGCTCCCTATGAAGCTCCCGGTGATTGACTTTCTCCCAAGCATAACCATAGGCGTAACAAACTGCAATGGGGCATTAATAACACCCATCAAGATCAGCTTGCCATCAAGCTTCAATAGAGAAAGGTAAGGCTCGAGAGGGTGAACCACAGGCACAGTATCGATGATATAGTCAAGTTGATCAGCAGCTTTTTGCATGCTTTCCACATCCGAGCTGACCAAGTATTCAT criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=4.79 fanout-score-rank=27 prefix-density=0.30 prefix-fanout=3.2 sequence=ATCCAGAAGGAGTCCACCCTCCACTTGGTGCT criterion=fanout-score sequence-density=0.08 sequence-density-rank=18 fanout-score=303.12 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=27.9 sequence=AAGAAGAAGAAG SRR22215340 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:07:31 Started mapping on | Feb 11 09:07:31 Finished on | Feb 11 09:10:16 Mapping speed, Million of reads per hour | 693.13 Number of input reads | 31768515 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 29869853 Uniquely mapped reads % | 94.02% Average mapped length | 298.34 Number of splices: Total | 21356057 Number of splices: Annotated (sjdb) | 20847621 Number of splices: GT/AG | 21011188 Number of splices: GC/AG | 262198 Number of splices: AT/AC | 29709 Number of splices: Non-canonical | 52962 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.21 Insertion rate per base | 0.02% Insertion average length | 1.82 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 688650 % of reads mapped to multiple loci | 2.17% Number of reads mapped to too many loci | 415814 % of reads mapped to too many loci | 1.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.02% % of reads unmapped: other | 0.48% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1210012 1210012 1210012 N_multimapping 688650 688650 688650 N_noFeature 1286357 29454842 1428856 N_ambiguous 427193 2015 153777 UnstrandedReadsAssigned:28156303 PositiveStrandReadsAssigned:412996 NegativeStrandReadsAssigned:28287220 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR22215340 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22215340-trimmed-pair1.fastq SRR22215340-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,768,515 reads, 29,074,937 reads pseudoaligned [quant] estimated average fragment length: 196.817 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,120 rounds 52401 SRR22215340.ke.tsv 34699 SRR22215340.se.tsv 87100 total ==> SRR22215340.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1822.18 5014 94.151 Potri.005G024800.1.v4.1 1035 839.183 1519 61.9346 Potri.004G059700.1.v4.1 961 765.183 75 3.35373 Potri.007G009000.2.v4.1 1416 1220.18 0 0 Potri.003G141000.2.v4.1 2943 2747.18 646.113 8.04736 Potri.016G087400.1.v4.1 270 79.7626 1400.43 600.753 Potri.015G069301.1.v4.1 564 368.264 0 0 Potri.010G195200.1.v4.1 1773 1577.18 84 1.82234 Potri.012G127500.1.v4.1 977 781.183 11655 510.495 ==> SRR22215340.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1943 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 650 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 86 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 7 SRR22215340 completed mapping pipeline successfully