Starting /dee2/code/volunteer_pipeline.sh SRR22215341 current disk space = 3055515770880 free memory = 1469209680 SRR22215341 SRAfilesize d1112bff77d01ab495e3c1756e6e4ba1 SRR22215341.sra SRR22215341.sra file validated SRR22215341 is paired end SRR22215341 is conventional basespace SRR22215341 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215341_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.914 37.0 37.0 37.0 37.0 37.0 2 36.022 37.0 37.0 37.0 37.0 37.0 3 36.2595 37.0 37.0 37.0 37.0 37.0 4 36.3 37.0 37.0 37.0 37.0 37.0 5 36.327 37.0 37.0 37.0 37.0 37.0 6 36.3575 37.0 37.0 37.0 37.0 37.0 7 36.2325 37.0 37.0 37.0 37.0 37.0 8 36.2825 37.0 37.0 37.0 37.0 37.0 9 36.226 37.0 37.0 37.0 37.0 37.0 10-14 36.29639999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.3026 37.0 37.0 37.0 37.0 37.0 20-24 36.2477 37.0 37.0 37.0 37.0 37.0 25-29 36.1688 37.0 37.0 37.0 37.0 37.0 30-34 36.078 37.0 37.0 37.0 37.0 37.0 35-39 36.10430000000001 37.0 37.0 37.0 37.0 37.0 40-44 35.942 37.0 37.0 37.0 37.0 37.0 45-49 35.88960000000001 37.0 37.0 37.0 37.0 37.0 50-54 35.764799999999994 37.0 37.0 37.0 37.0 37.0 55-59 35.846 37.0 37.0 37.0 37.0 37.0 60-64 35.7496 37.0 37.0 37.0 37.0 37.0 65-69 35.7255 37.0 37.0 37.0 37.0 37.0 70-74 35.7287 37.0 37.0 37.0 37.0 37.0 75-79 35.791700000000006 37.0 37.0 37.0 37.0 37.0 80-84 35.7688 37.0 37.0 37.0 37.0 37.0 85-89 35.6981 37.0 37.0 37.0 37.0 37.0 90-94 35.6493 37.0 37.0 37.0 37.0 37.0 95-99 35.6885 37.0 37.0 37.0 37.0 37.0 100-104 35.639500000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.594899999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.5152 37.0 37.0 37.0 37.0 37.0 115-119 35.569399999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.4469 37.0 37.0 37.0 37.0 37.0 125-129 35.452999999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.3775 37.0 37.0 37.0 37.0 37.0 135-139 35.3566 37.0 37.0 37.0 34.6 37.0 140-144 35.1826 37.0 37.0 37.0 29.8 37.0 145-149 35.2475 37.0 37.0 37.0 32.2 37.0 150-151 35.116749999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 1.0 19 0.0 20 0.0 21 1.0 22 2.0 23 5.0 24 2.0 25 4.0 26 8.0 27 16.0 28 27.0 29 41.0 30 45.0 31 72.0 32 120.0 33 115.0 34 223.0 35 509.0 36 2641.0 37 167.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.89552988448016 11.426418884982422 17.805123053741838 32.87292817679558 2 32.364729458917836 13.126252505010019 29.208416833667332 25.30060120240481 3 27.474999999999998 20.0 23.775 28.749999999999996 4 28.175 25.924999999999997 19.900000000000002 26.0 5 27.575 29.075 23.35 20.0 6 19.650000000000002 33.35 23.3 23.7 7 14.124999999999998 31.275 35.8 18.8 8 15.6 27.200000000000003 32.574999999999996 24.625 9 16.575 24.325 32.95 26.150000000000002 10-14 18.715 31.569999999999997 27.325 22.39 15-19 19.105 29.98 28.235 22.68 20-24 19.255 29.835 27.384999999999998 23.525 25-29 19.3 29.325000000000003 27.650000000000002 23.724999999999998 30-34 19.220000000000002 29.580000000000002 27.61 23.59 35-39 18.47 30.520000000000003 27.025 23.985 40-44 18.87 29.805 27.334999999999997 23.990000000000002 45-49 19.33 29.82 27.29 23.56 50-54 19.45 29.354999999999997 26.87 24.325 55-59 19.73 28.9 27.165 24.205 60-64 20.1 29.62 26.900000000000002 23.380000000000003 65-69 19.465 29.455 27.134999999999998 23.945 70-74 20.64 28.610000000000003 26.974999999999998 23.775 75-79 20.205000000000002 29.225 26.615 23.955000000000002 80-84 19.81 28.810000000000002 27.36 24.02 85-89 20.48 28.88 26.615 24.025 90-94 20.044999999999998 28.835 26.995 24.125 95-99 19.905 27.92 27.63 24.545 100-104 20.385 28.04 27.165 24.41 105-109 20.075000000000003 28.115000000000002 27.155 24.654999999999998 110-114 20.435 28.37 27.18 24.015 115-119 19.99 28.470000000000002 27.029999999999998 24.51 120-124 20.119999999999997 28.425 26.935 24.52 125-129 20.560000000000002 27.955000000000002 27.165 24.32 130-134 20.995 27.794999999999998 27.27 23.94 135-139 20.810000000000002 29.220000000000002 26.284999999999997 23.685000000000002 140-144 20.935000000000002 29.435 25.86 23.77 145-149 21.654999999999998 28.955 25.779999999999998 23.61 150-151 21.349999999999998 28.875 25.637500000000003 24.1375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 0.5 20 2.0 21 5.5 22 7.0 23 5.5 24 5.0 25 9.5 26 11.5 27 13.5 28 20.0 29 23.5 30 32.5 31 40.5 32 48.5 33 58.0 34 75.5 35 97.0 36 102.0 37 125.5 38 162.0 39 164.5 40 174.5 41 197.5 42 209.0 43 223.5 44 233.0 45 218.0 46 215.0 47 230.5 48 213.5 49 183.0 50 161.0 51 132.5 52 101.0 53 85.0 54 75.5 55 57.0 56 43.0 57 42.5 58 34.5 59 25.5 60 16.5 61 12.0 62 10.0 63 7.5 64 13.0 65 12.5 66 7.0 67 5.5 68 6.0 69 4.5 70 2.5 71 2.5 72 3.5 73 6.0 74 7.5 75 4.5 76 4.0 77 3.0 78 1.0 79 1.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.2 #Duplication Level Percentage of deduplicated Percentage of total 1 92.46203904555314 85.25 2 6.832971800433839 12.6 3 0.6236442516268981 1.725 4 0.05422993492407809 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.027114967462039046 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGGTTGG 9 0.22499999999999998 TruSeq Adapter, Index 8 (97% over 45bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.0625 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.11249999999999999 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.21250000000000002 0.0 0.0 0.0 0.0 112-113 0.225 0.0 0.0 0.0 0.0 114-115 0.2875 0.0 0.0 0.0 0.0 116-117 0.45 0.0 0.0 0.0 0.0 118-119 0.5875 0.0 0.0 0.0 0.0 120-121 0.8125 0.0 0.0 0.0 0.0 122-123 1.0625 0.0 0.0 0.0 0.0 124-125 1.225 0.0 0.0 0.0 0.0 126-127 1.5125000000000002 0.0 0.0 0.0 0.0 128-129 2.025 0.0 0.0 0.0 0.0 130-131 2.5125 0.0 0.0 0.0 0.0 132-133 3.125 0.0 0.0 0.0 0.0 134-135 3.925 0.0 0.0 0.0 0.0 136-137 4.7125 0.0 0.0 0.0 0.0 138-139 5.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGATGCC 15 1.1411342E-4 145.0 4 TGCCGCC 10 0.006830828 145.0 7 GATGCCG 10 0.006830828 145.0 5 CGGATGC 10 0.006830828 145.0 3 ATGCCGC 10 0.006830828 145.0 6 ACGGATG 10 0.006830828 145.0 2 CACGGAT 10 0.006830828 145.0 1 >>END_MODULE SRR22215341 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215341_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.6325 37.0 37.0 37.0 37.0 37.0 2 36.135 37.0 37.0 37.0 37.0 37.0 3 36.112 37.0 37.0 37.0 37.0 37.0 4 36.204 37.0 37.0 37.0 37.0 37.0 5 36.067 37.0 37.0 37.0 37.0 37.0 6 36.1255 37.0 37.0 37.0 37.0 37.0 7 36.041 37.0 37.0 37.0 37.0 37.0 8 36.165 37.0 37.0 37.0 37.0 37.0 9 36.2325 37.0 37.0 37.0 37.0 37.0 10-14 36.1025 37.0 37.0 37.0 37.0 37.0 15-19 36.0592 37.0 37.0 37.0 37.0 37.0 20-24 36.001999999999995 37.0 37.0 37.0 37.0 37.0 25-29 35.923700000000004 37.0 37.0 37.0 37.0 37.0 30-34 35.8443 37.0 37.0 37.0 37.0 37.0 35-39 35.853500000000004 37.0 37.0 37.0 37.0 37.0 40-44 35.7607 37.0 37.0 37.0 37.0 37.0 45-49 35.7756 37.0 37.0 37.0 37.0 37.0 50-54 35.74849999999999 37.0 37.0 37.0 37.0 37.0 55-59 35.703199999999995 37.0 37.0 37.0 37.0 37.0 60-64 35.6823 37.0 37.0 37.0 37.0 37.0 65-69 35.683299999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.6428 37.0 37.0 37.0 37.0 37.0 75-79 35.600100000000005 37.0 37.0 37.0 37.0 37.0 80-84 35.571600000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.5323 37.0 37.0 37.0 37.0 37.0 90-94 35.54280000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.5379 37.0 37.0 37.0 37.0 37.0 100-104 35.5145 37.0 37.0 37.0 37.0 37.0 105-109 35.4696 37.0 37.0 37.0 37.0 37.0 110-114 35.481700000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.413500000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.3374 37.0 37.0 37.0 34.6 37.0 125-129 35.2556 37.0 37.0 37.0 29.8 37.0 130-134 35.2567 37.0 37.0 37.0 32.2 37.0 135-139 35.2686 37.0 37.0 37.0 32.2 37.0 140-144 35.1851 37.0 37.0 37.0 29.8 37.0 145-149 34.992599999999996 37.0 37.0 37.0 25.0 37.0 150-151 34.969 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 1.0 17 2.0 18 2.0 19 3.0 20 6.0 21 4.0 22 9.0 23 7.0 24 9.0 25 12.0 26 19.0 27 14.0 28 22.0 29 37.0 30 46.0 31 46.0 32 85.0 33 97.0 34 222.0 35 709.0 36 2426.0 37 221.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.025 21.8 15.85 27.325 2 29.375 28.15 27.325 15.15 3 24.175 31.275 28.15 16.400000000000002 4 26.474999999999998 34.625 22.0 16.900000000000002 5 27.175 36.0 21.65 15.174999999999999 6 20.9 40.300000000000004 22.875 15.925 7 21.4 19.575 40.25 18.775 8 23.575 23.275000000000002 30.049999999999997 23.1 9 25.2 23.375 28.549999999999997 22.875 10-14 25.474999999999998 28.515 25.665 20.345 15-19 24.855 28.265 27.33 19.55 20-24 25.180000000000003 28.475 27.400000000000002 18.945 25-29 24.97 28.02 27.49 19.52 30-34 25.014999999999997 27.97 27.675 19.34 35-39 24.88 28.155 27.125 19.84 40-44 24.725 28.365000000000002 27.450000000000003 19.46 45-49 25.555 27.37 27.295 19.78 50-54 24.865000000000002 27.634999999999998 27.58 19.919999999999998 55-59 25.045 27.235 28.050000000000004 19.67 60-64 24.505 27.26 28.73 19.505 65-69 24.42 27.79 28.275 19.515 70-74 25.105 26.985 28.265 19.645000000000003 75-79 24.645 26.979999999999997 28.799999999999997 19.575 80-84 25.014999999999997 27.544999999999998 28.134999999999998 19.305 85-89 24.915000000000003 27.339999999999996 28.165000000000003 19.580000000000002 90-94 25.11 27.389999999999997 28.28 19.220000000000002 95-99 24.9 27.485 28.52 19.095000000000002 100-104 24.779999999999998 27.54 28.355000000000004 19.325 105-109 24.43 27.615000000000002 29.049999999999997 18.905 110-114 25.264999999999997 27.905 28.02 18.81 115-119 24.834999999999997 26.97 28.860000000000003 19.335 120-124 24.695 27.139999999999997 28.925 19.24 125-129 25.314999999999998 27.305 28.225 19.155 130-134 25.324999999999996 27.42 27.900000000000002 19.355 135-139 25.929999999999996 27.42 28.105000000000004 18.545 140-144 25.674999999999997 27.3 28.044999999999998 18.98 145-149 26.174999999999997 28.365000000000002 26.900000000000002 18.56 150-151 27.437499999999996 27.474999999999998 26.937499999999996 18.15 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 1.0 17 1.5 18 1.0 19 1.5 20 2.0 21 3.5 22 3.5 23 2.5 24 3.0 25 5.0 26 10.0 27 10.5 28 10.5 29 19.0 30 20.5 31 19.0 32 27.0 33 45.5 34 62.0 35 76.0 36 94.5 37 108.0 38 133.5 39 163.5 40 182.0 41 207.0 42 233.0 43 244.5 44 259.5 45 274.0 46 251.5 47 213.0 48 203.0 49 192.0 50 161.0 51 129.0 52 114.0 53 97.5 54 82.0 55 68.5 56 42.0 57 32.0 58 33.0 59 27.0 60 17.0 61 10.0 62 8.5 63 11.0 64 10.0 65 6.5 66 3.0 67 3.0 68 4.0 69 3.0 70 2.5 71 3.0 72 5.0 73 5.5 74 4.5 75 3.0 76 1.5 77 1.5 78 2.0 79 2.0 80 1.0 81 0.5 82 1.5 83 1.5 84 1.0 85 1.0 86 0.5 87 0.5 88 1.0 89 1.0 90 1.5 91 2.0 92 1.0 93 1.0 94 1.5 95 0.5 96 1.0 97 1.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.675 #Duplication Level Percentage of deduplicated Percentage of total 1 92.68950633935798 85.9 2 6.74399784192069 12.5 3 0.5395198273536552 1.5 4 0.02697599136768276 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.0625 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.11249999999999999 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.21250000000000002 0.0 0.0 0.0 0.0 112-113 0.225 0.0 0.0 0.0 0.0 114-115 0.2875 0.0 0.0 0.0 0.0 116-117 0.45 0.0 0.0 0.0 0.0 118-119 0.5875 0.0 0.0 0.0 0.0 120-121 0.8125 0.0 0.0 0.0 0.0 122-123 1.0625 0.0 0.0 0.0 0.0 124-125 1.25 0.0 0.0 0.0 0.0 126-127 1.5750000000000002 0.0 0.0 0.0 0.0 128-129 2.05 0.0 0.0 0.0 0.0 130-131 2.525 0.0 0.0 0.0 0.0 132-133 3.125 0.0 0.0 0.0 0.0 134-135 3.925 0.0 0.0 0.0 0.0 136-137 4.6875 0.0 0.0 0.0 0.0 138-139 5.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCGATCG 10 0.006830828 145.0 3 TGCGATC 10 0.006830828 145.0 2 GATCAAT 10 0.006830828 145.0 9 TTGCGAT 10 0.006830828 145.0 1 CAGAAAG 10 0.006830828 145.0 1 ATCGATC 10 0.006830828 145.0 6 ATATAAC 10 0.006830828 145.0 6 CGATCGA 10 0.006830828 145.0 4 CGATCAA 10 0.006830828 145.0 8 >>END_MODULE Read 1627462 spots for SRR22215341.sra Written 1627462 spots for SRR22215341.sra Read 1627462 spots for SRR22215341.sra Written 1627462 spots for SRR22215341.sra Read 1627462 spots for SRR22215341.sra Written 1627462 spots for SRR22215341.sra Read 1627462 spots for SRR22215341.sra Written 1627462 spots for SRR22215341.sra Read 1627462 spots for SRR22215341.sra Written 1627462 spots for SRR22215341.sra Read 1627462 spots for SRR22215341.sra Written 1627462 spots for SRR22215341.sra Read 1627462 spots for SRR22215341.sra Written 1627462 spots for SRR22215341.sra Read 1627462 spots for SRR22215341.sra Written 1627462 spots for SRR22215341.sra Read 1627462 spots for SRR22215341.sra Written 1627462 spots for SRR22215341.sra Read 1627462 spots for SRR22215341.sra Written 1627462 spots for SRR22215341.sra Read 1627462 spots for SRR22215341.sra Written 1627462 spots for SRR22215341.sra Read 1627462 spots for SRR22215341.sra Written 1627462 spots for SRR22215341.sra Read 1627462 spots for SRR22215341.sra Written 1627462 spots for SRR22215341.sra Read 1627462 spots for SRR22215341.sra Written 1627462 spots for SRR22215341.sra Read 1627462 spots for SRR22215341.sra Written 1627462 spots for SRR22215341.sra Read 1627462 spots for SRR22215341.sra Written 1627462 spots for SRR22215341.sra Read 1627462 spots for SRR22215341.sra Written 1627462 spots for SRR22215341.sra Read 1627462 spots for SRR22215341.sra Written 1627462 spots for SRR22215341.sra Read 1627462 spots for SRR22215341.sra Written 1627462 spots for SRR22215341.sra Read 1627462 spots for SRR22215341.sra Written 1627462 spots for SRR22215341.sra SRR ids: ['SRR22215341.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qltm0l8s SRR22215341.sra spots: 32549240 blocks: [[1, 1627462], [1627463, 3254924], [3254925, 4882386], [4882387, 6509848], [6509849, 8137310], [8137311, 9764772], [9764773, 11392234], [11392235, 13019696], [13019697, 14647158], [14647159, 16274620], [16274621, 17902082], [17902083, 19529544], [19529545, 21157006], [21157007, 22784468], [22784469, 24411930], [24411931, 26039392], [26039393, 27666854], [27666855, 29294316], [29294317, 30921778], [30921779, 32549240]] SRR22215341 file size 11039955 SRR22215341 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22215341 SRR22215341_1.fastq SRR22215341_2.fastq Input file: SRR22215341_1.fastq Paired file: SRR22215341_2.fastq trimmed: SRR22215341-trimmed-pair1.fastq, SRR22215341-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:10:25 2025 >> started Tue Feb 11 09:11:14 2025 >> done (48.966s) 32549240 read pairs processed; of these: 487 ( 0.00%) short read pairs filtered out after trimming by size control 215198 ( 0.66%) empty read pairs filtered out after trimming by size control 32333555 (99.34%) read pairs available; of these: 4246380 (13.13%) trimmed read pairs available after processing 28087175 (86.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 25 0.00% 20 11 0.00% 21 17 0.00% 22 5 0.00% 23 14 0.00% 24 9 0.00% 25 7 0.00% 26 6 0.00% 27 39 0.00% 28 12 0.00% 29 89 0.00% 30 15 0.00% 31 42 0.00% 32 21 0.00% 33 30 0.00% 34 15 0.00% 35 21 0.00% 36 18 0.00% 37 16 0.00% 38 17 0.00% 39 16 0.00% 40 28 0.00% 41 23 0.00% 42 27 0.00% 43 29 0.00% 44 27 0.00% 45 29 0.00% 46 39 0.00% 47 31 0.00% 48 50 0.00% 49 50 0.00% 50 55 0.00% 51 67 0.00% 52 67 0.00% 53 66 0.00% 54 75 0.00% 55 89 0.00% 56 97 0.00% 57 60 0.00% 58 105 0.00% 59 64 0.00% 60 77 0.00% 61 72 0.00% 62 85 0.00% 63 96 0.00% 64 91 0.00% 65 115 0.00% 66 128 0.00% 67 109 0.00% 68 121 0.00% 69 169 0.00% 70 195 0.00% 71 199 0.00% 72 234 0.00% 73 306 0.00% 74 319 0.00% 75 308 0.00% 76 352 0.00% 77 392 0.00% 78 456 0.00% 79 482 0.00% 80 506 0.00% 81 582 0.00% 82 688 0.00% 83 758 0.00% 84 856 0.00% 85 1010 0.00% 86 1041 0.00% 87 1116 0.00% 88 1316 0.00% 89 1371 0.00% 90 1522 0.00% 91 1755 0.01% 92 1910 0.01% 93 2152 0.01% 94 2277 0.01% 95 2581 0.01% 96 2751 0.01% 97 3056 0.01% 98 3220 0.01% 99 3672 0.01% 100 3970 0.01% 101 4363 0.01% 102 4717 0.01% 103 5215 0.02% 104 5820 0.02% 105 6289 0.02% 106 6989 0.02% 107 7668 0.02% 108 8402 0.03% 109 9261 0.03% 110 10253 0.03% 111 11053 0.03% 112 12574 0.04% 113 13609 0.04% 114 15223 0.05% 115 17322 0.05% 116 19349 0.06% 117 21628 0.07% 118 24271 0.08% 119 27546 0.09% 120 30271 0.09% 121 33745 0.10% 122 37107 0.11% 123 41284 0.13% 124 45871 0.14% 125 51028 0.16% 126 56836 0.18% 127 62966 0.19% 128 69006 0.21% 129 76513 0.24% 130 83869 0.26% 131 90146 0.28% 132 97513 0.30% 133 105686 0.33% 134 111400 0.34% 135 120568 0.37% 136 127859 0.40% 137 137891 0.43% 138 148558 0.46% 139 159764 0.49% 140 167083 0.52% 141 177004 0.55% 142 184094 0.57% 143 190640 0.59% 144 198273 0.61% 145 204232 0.63% 146 213568 0.66% 147 219785 0.68% 148 233033 0.72% 149 241460 0.75% 150 253822 0.79% 151 28087175 86.87% 32333555 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=4.11 fanout-score-rank=22 prefix-density=0.29 prefix-fanout=3.4 sequence=GGTGCTGGAGCTGGAGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=49.21 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=1.9 sequence=ACCAGAAATATATATCTGCACCCAGGCCAGGCCCCAGCTTATGTAACTCATGAATGTATTATTGCACCAAACGCACAGCTGACTGCAAGAAGCAAGGCGTTGTTATGCAGAAAAAGCAGAGCTGGAGCACCAGAAATATCCTTAGGAGCAGTAGGGCTCTCTGCATCGGGTGCTGCTTTCCTAGGCTTTCCCAGTGCTGGCTCGGGAGCAGGGGCTGGAGGCTTAGGAGTAAATATGTCCAAAGGAAATAGTACCTTATCAAGTTGATAAATAGCAAGCTGGCT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=4.55 fanout-score-rank=14 prefix-density=0.29 prefix-fanout=3.2 sequence=ATCCAGAAGGAGTCCACCCT criterion=fanout-score sequence-density=0.02 sequence-density-rank=44 fanout-score=73.45 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=5.7 sequence=TCTTCTCTCTGTCTTCTTGATTCCTTGTTTTTCGTTCTGTTTATTACAGCAGCAATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGAAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCCGCAAAGCCTGCAGAAACCGTGGCTGCTGCATAATGTTTATAATACCAATATTTACTATGTGAAACTGTGTTCTACTGGGTTATAGTTAGTTGGGCTTTCTATGATCATGATGTGGATTCTGGATATCCAGCATGCTTTTACTGGGATGTAAGCTATAATAATTTCTCTGGTACATTCATATGGTTATCTGTATTATCATTATT SRR22215341 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:12:05 Started mapping on | Feb 11 09:12:05 Finished on | Feb 11 09:16:29 Mapping speed, Million of reads per hour | 440.91 Number of input reads | 32333555 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 29206366 Uniquely mapped reads % | 90.33% Average mapped length | 297.31 Number of splices: Total | 20887847 Number of splices: Annotated (sjdb) | 20411643 Number of splices: GT/AG | 20574179 Number of splices: GC/AG | 246448 Number of splices: AT/AC | 21518 Number of splices: Non-canonical | 45702 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.02% Deletion average length | 2.19 Insertion rate per base | 0.02% Insertion average length | 1.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 630309 % of reads mapped to multiple loci | 1.95% Number of reads mapped to too many loci | 525712 % of reads mapped to too many loci | 1.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.62% % of reads unmapped: other | 1.47% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2496880 2496880 2496880 N_multimapping 630309 630309 630309 N_noFeature 1176169 28765667 1316617 N_ambiguous 438734 1851 137352 UnstrandedReadsAssigned:27591463 PositiveStrandReadsAssigned:438848 NegativeStrandReadsAssigned:27752397 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR22215341 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22215341-trimmed-pair1.fastq SRR22215341-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,333,555 reads, 28,663,581 reads pseudoaligned [quant] estimated average fragment length: 188.701 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,189 rounds 52401 SRR22215341.ke.tsv 34699 SRR22215341.se.tsv 87100 total ==> SRR22215341.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1830.3 4249 76.7134 Potri.005G024800.1.v4.1 1035 847.299 2158 84.163 Potri.004G059700.1.v4.1 961 773.304 169 7.22176 Potri.007G009000.2.v4.1 1416 1228.3 0 0 Potri.003G141000.2.v4.1 2943 2755.3 655.114 7.85696 Potri.016G087400.1.v4.1 270 86.2286 1578 604.731 Potri.015G069301.1.v4.1 564 376.334 0 0 Potri.010G195200.1.v4.1 1773 1585.3 51 1.06308 Potri.012G127500.1.v4.1 977 789.299 6534 273.555 ==> SRR22215341.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 916 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 573 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 141 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR22215341 completed mapping pipeline successfully