Starting /dee2/code/volunteer_pipeline.sh SRR22215342 current disk space = 3055577186304 free memory = 1331679420 SRR22215342 SRAfilesize 076227c3158c9a1ae81ad3370cab2902 SRR22215342.sra SRR22215342.sra file validated SRR22215342 is paired end SRR22215342 is conventional basespace SRR22215342 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215342_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.956 37.0 37.0 37.0 37.0 37.0 2 36.02325 37.0 37.0 37.0 37.0 37.0 3 36.2245 37.0 37.0 37.0 37.0 37.0 4 36.331 37.0 37.0 37.0 37.0 37.0 5 36.3295 37.0 37.0 37.0 37.0 37.0 6 36.3425 37.0 37.0 37.0 37.0 37.0 7 36.3515 37.0 37.0 37.0 37.0 37.0 8 36.2625 37.0 37.0 37.0 37.0 37.0 9 36.374 37.0 37.0 37.0 37.0 37.0 10-14 36.3018 37.0 37.0 37.0 37.0 37.0 15-19 36.2668 37.0 37.0 37.0 37.0 37.0 20-24 36.1965 37.0 37.0 37.0 37.0 37.0 25-29 36.180699999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.0724 37.0 37.0 37.0 37.0 37.0 35-39 36.0291 37.0 37.0 37.0 37.0 37.0 40-44 35.972899999999996 37.0 37.0 37.0 37.0 37.0 45-49 35.843 37.0 37.0 37.0 37.0 37.0 50-54 35.8697 37.0 37.0 37.0 37.0 37.0 55-59 35.763 37.0 37.0 37.0 37.0 37.0 60-64 35.728699999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.75749999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.710899999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.7823 37.0 37.0 37.0 37.0 37.0 80-84 35.794599999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.7448 37.0 37.0 37.0 37.0 37.0 90-94 35.6289 37.0 37.0 37.0 37.0 37.0 95-99 35.6165 37.0 37.0 37.0 37.0 37.0 100-104 35.571600000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.51129999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.56249999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.5898 37.0 37.0 37.0 37.0 37.0 120-124 35.3783 37.0 37.0 37.0 37.0 37.0 125-129 35.305400000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.3845 37.0 37.0 37.0 34.6 37.0 135-139 35.3822 37.0 37.0 37.0 37.0 37.0 140-144 35.213499999999996 37.0 37.0 37.0 27.4 37.0 145-149 35.2378 37.0 37.0 37.0 32.2 37.0 150-151 34.998 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 2.0 21 2.0 22 5.0 23 3.0 24 2.0 25 7.0 26 11.0 27 27.0 28 27.0 29 37.0 30 45.0 31 68.0 32 103.0 33 118.0 34 213.0 35 490.0 36 2659.0 37 180.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.422960725075534 11.983887210473315 17.396777442094663 35.196374622356494 2 31.730528424743298 14.450288004007012 30.277986476333584 23.541197094916104 3 26.025 22.400000000000002 23.575 28.000000000000004 4 25.4 28.725 20.775 25.1 5 25.7 31.624999999999996 22.55 20.125 6 18.975 32.550000000000004 25.974999999999998 22.5 7 12.55 28.825 38.7 19.925 8 15.6 28.525 31.65 24.224999999999998 9 18.65 23.175 33.15 25.025 10-14 18.685 32.074999999999996 26.955000000000002 22.285 15-19 19.040000000000003 30.335 27.865000000000002 22.759999999999998 20-24 19.03 30.214999999999996 27.950000000000003 22.805 25-29 19.005 30.240000000000002 27.99 22.765 30-34 19.515 30.04 27.900000000000002 22.545 35-39 19.235 30.294999999999998 26.865 23.605 40-44 19.139999999999997 30.69 26.955000000000002 23.215 45-49 19.7 29.715000000000003 27.150000000000002 23.435 50-54 19.08 29.9 27.334999999999997 23.685000000000002 55-59 19.49 29.609999999999996 27.685 23.215 60-64 19.869999999999997 29.315 27.915 22.900000000000002 65-69 19.165 30.43 27.384999999999998 23.02 70-74 19.71 29.73 27.825 22.735 75-79 19.900000000000002 29.09 27.175 23.835 80-84 20.04 28.849999999999998 27.395000000000003 23.715 85-89 19.78 29.375 27.02 23.825 90-94 20.025000000000002 28.975 27.639999999999997 23.36 95-99 20.419999999999998 28.225 27.805000000000003 23.549999999999997 100-104 20.315 29.354999999999997 26.979999999999997 23.35 105-109 20.135 29.345 26.965 23.555 110-114 20.169999999999998 29.054999999999996 27.139999999999997 23.635 115-119 20.080000000000002 28.689999999999998 27.305 23.925 120-124 20.48 28.605000000000004 27.725 23.189999999999998 125-129 20.365 28.52 27.375 23.74 130-134 20.580000000000002 28.470000000000002 27.400000000000002 23.549999999999997 135-139 20.415 28.075 27.85 23.66 140-144 20.89 29.134999999999998 26.61 23.365 145-149 20.77 28.63 26.8 23.799999999999997 150-151 21.525 28.0875 26.5375 23.849999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 1.0 15 1.0 16 0.5 17 0.5 18 1.0 19 1.5 20 3.0 21 4.5 22 3.5 23 3.5 24 6.0 25 7.5 26 13.5 27 24.0 28 28.0 29 30.0 30 39.5 31 56.5 32 65.5 33 71.5 34 83.5 35 98.5 36 117.5 37 130.5 38 148.0 39 176.0 40 196.5 41 197.0 42 198.5 43 217.0 44 227.0 45 232.5 46 227.5 47 205.5 48 198.5 49 182.0 50 152.5 51 125.0 52 93.5 53 78.5 54 68.5 55 59.0 56 49.5 57 35.0 58 22.0 59 17.5 60 18.5 61 11.5 62 8.0 63 7.5 64 8.0 65 9.0 66 4.5 67 4.0 68 6.5 69 5.5 70 4.5 71 3.5 72 2.0 73 0.5 74 0.5 75 0.5 76 0.5 77 1.5 78 1.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7000000000000001 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.80000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 92.91487068965517 86.225 2 6.492456896551724 12.049999999999999 3 0.5118534482758621 1.425 4 0.08081896551724138 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.1125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.16249999999999998 0.0 0.0 0.0 0.0 110-111 0.3 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.475 0.0 0.0 0.0 0.0 116-117 0.575 0.0 0.0 0.0 0.0 118-119 0.75 0.0 0.0 0.0 0.0 120-121 0.9625 0.0 0.0 0.0 0.0 122-123 1.1124999999999998 0.0 0.0 0.0 0.0 124-125 1.4 0.0 0.0 0.0 0.0 126-127 1.625 0.0 0.0 0.0 0.0 128-129 1.925 0.0 0.0 0.0 0.0 130-131 2.2375 0.0 0.0 0.0 0.0 132-133 2.7875 0.0 0.0 0.0 0.0 134-135 3.475 0.0 0.0 0.0 0.0 136-137 3.9625 0.0 0.0 0.0 0.0 138-139 4.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR22215342 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215342_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.502 37.0 37.0 37.0 37.0 37.0 2 35.88 37.0 37.0 37.0 37.0 37.0 3 36.013 37.0 37.0 37.0 37.0 37.0 4 36.0605 37.0 37.0 37.0 37.0 37.0 5 36.0655 37.0 37.0 37.0 37.0 37.0 6 35.9245 37.0 37.0 37.0 37.0 37.0 7 35.9045 37.0 37.0 37.0 37.0 37.0 8 36.016 37.0 37.0 37.0 37.0 37.0 9 35.994 37.0 37.0 37.0 37.0 37.0 10-14 35.927499999999995 37.0 37.0 37.0 37.0 37.0 15-19 35.939099999999996 37.0 37.0 37.0 37.0 37.0 20-24 35.915800000000004 37.0 37.0 37.0 37.0 37.0 25-29 35.8641 37.0 37.0 37.0 37.0 37.0 30-34 35.7441 37.0 37.0 37.0 37.0 37.0 35-39 35.712300000000006 37.0 37.0 37.0 37.0 37.0 40-44 35.6823 37.0 37.0 37.0 37.0 37.0 45-49 35.69840000000001 37.0 37.0 37.0 37.0 37.0 50-54 35.623599999999996 37.0 37.0 37.0 37.0 37.0 55-59 35.595600000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.6042 37.0 37.0 37.0 37.0 37.0 65-69 35.5648 37.0 37.0 37.0 37.0 37.0 70-74 35.486599999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.4396 37.0 37.0 37.0 37.0 37.0 80-84 35.3708 37.0 37.0 37.0 32.2 37.0 85-89 35.3938 37.0 37.0 37.0 37.0 37.0 90-94 35.3042 37.0 37.0 37.0 34.6 37.0 95-99 35.4151 37.0 37.0 37.0 34.6 37.0 100-104 35.346000000000004 37.0 37.0 37.0 34.6 37.0 105-109 35.258300000000006 37.0 37.0 37.0 32.2 37.0 110-114 35.223 37.0 37.0 37.0 29.8 37.0 115-119 35.2379 37.0 37.0 37.0 32.2 37.0 120-124 35.1271 37.0 37.0 37.0 25.0 37.0 125-129 35.027100000000004 37.0 37.0 37.0 25.0 37.0 130-134 35.0149 37.0 37.0 37.0 25.0 37.0 135-139 34.940799999999996 37.0 37.0 37.0 25.0 37.0 140-144 34.8479 37.0 37.0 37.0 25.0 37.0 145-149 34.7667 37.0 37.0 37.0 25.0 37.0 150-151 34.71875 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 3.0 17 0.0 18 1.0 19 3.0 20 3.0 21 2.0 22 1.0 23 11.0 24 17.0 25 19.0 26 19.0 27 27.0 28 30.0 29 33.0 30 51.0 31 64.0 32 97.0 33 133.0 34 256.0 35 820.0 36 2232.0 37 178.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.875 21.175 16.25 27.700000000000003 2 28.599999999999998 28.799999999999997 29.15 13.450000000000001 3 23.974999999999998 32.025 26.924999999999997 17.075000000000003 4 25.874999999999996 36.05 21.5 16.575 5 27.55 35.8 21.275 15.375 6 19.925 39.225 23.625 17.224999999999998 7 21.475 18.875 40.875 18.775 8 23.75 22.3 29.575000000000003 24.375 9 26.674999999999997 22.675 27.474999999999998 23.175 10-14 25.705 28.634999999999998 25.945 19.715 15-19 25.314999999999998 27.765 27.32 19.6 20-24 23.885 28.74 27.505000000000003 19.869999999999997 25-29 24.615000000000002 28.535 27.515 19.335 30-34 24.43 27.860000000000003 28.02 19.689999999999998 35-39 24.235 27.950000000000003 27.51 20.305 40-44 24.169999999999998 28.389999999999997 28.27 19.17 45-49 24.104999999999997 28.435 27.875 19.585 50-54 24.91 27.339999999999996 28.044999999999998 19.705000000000002 55-59 24.09 28.42 27.839999999999996 19.650000000000002 60-64 23.674999999999997 28.199999999999996 28.410000000000004 19.715 65-69 24.23 27.565 28.175 20.03 70-74 24.125 28.225 28.18 19.470000000000002 75-79 23.77 27.615000000000002 28.599999999999998 20.015 80-84 24.135 27.224999999999998 28.79 19.85 85-89 23.79 27.965 29.065 19.18 90-94 24.515 28.32 27.894999999999996 19.27 95-99 23.799999999999997 28.105000000000004 28.615000000000002 19.48 100-104 23.990000000000002 28.395 28.38 19.235 105-109 23.445 28.22 29.185 19.15 110-114 23.48 28.28 28.410000000000004 19.830000000000002 115-119 24.07 27.825 29.035 19.07 120-124 23.835 27.800000000000004 29.054999999999996 19.31 125-129 23.72 28.37 28.134999999999998 19.775000000000002 130-134 24.2 28.749999999999996 28.32 18.73 135-139 24.709999999999997 27.915 28.76 18.615000000000002 140-144 25.15 28.244999999999997 28.134999999999998 18.47 145-149 25.685000000000002 27.54 28.395 18.38 150-151 25.912499999999998 27.950000000000003 27.8375 18.3 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.5 16 1.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.5 22 1.0 23 1.0 24 2.0 25 2.5 26 6.5 27 9.0 28 8.0 29 16.0 30 21.5 31 29.0 32 42.5 33 47.0 34 60.0 35 87.5 36 99.0 37 106.0 38 142.5 39 168.0 40 201.0 41 238.5 42 242.0 43 241.5 44 255.0 45 268.5 46 267.0 47 236.5 48 199.0 49 186.0 50 170.0 51 138.5 52 98.5 53 78.5 54 65.0 55 51.5 56 39.0 57 27.5 58 24.5 59 16.5 60 13.0 61 10.5 62 6.5 63 10.0 64 9.5 65 5.5 66 4.5 67 3.5 68 3.5 69 2.0 70 3.0 71 2.5 72 0.5 73 1.0 74 1.0 75 0.0 76 0.5 77 0.5 78 0.5 79 0.5 80 0.5 81 0.5 82 1.0 83 1.5 84 0.5 85 0.0 86 0.0 87 0.5 88 0.5 89 1.0 90 2.5 91 1.5 92 1.5 93 2.0 94 0.5 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.15 #Duplication Level Percentage of deduplicated Percentage of total 1 93.20987654320987 86.825 2 6.280193236714976 11.700000000000001 3 0.45625335480407947 1.275 4 0.05367686527106817 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.1125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.1375 0.0 0.0 0.0 0.0 110-111 0.3 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.45 0.0 0.0 0.0 0.0 116-117 0.5249999999999999 0.0 0.0 0.0 0.0 118-119 0.7 0.0 0.0 0.0 0.0 120-121 0.9125 0.0 0.0 0.0 0.0 122-123 1.0875 0.0 0.0 0.0 0.0 124-125 1.3875 0.0 0.0 0.0 0.0 126-127 1.625 0.0 0.0 0.0 0.0 128-129 1.95 0.0 0.0 0.0 0.0 130-131 2.225 0.0 0.0 0.0 0.0 132-133 2.7625 0.0 0.0 0.0 0.0 134-135 3.525 0.0 0.0 0.0 0.0 136-137 3.9749999999999996 0.0 0.0 0.0 0.0 138-139 4.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAGATC 10 0.006830828 145.0 145 TTTTTTT 80 0.0020131238 12.6875 55-59 >>END_MODULE Read 1770913 spots for SRR22215342.sra Written 1770913 spots for SRR22215342.sra Read 1770913 spots for SRR22215342.sra Written 1770913 spots for SRR22215342.sra Read 1770913 spots for SRR22215342.sra Written 1770913 spots for SRR22215342.sra Read 1770913 spots for SRR22215342.sra Written 1770913 spots for SRR22215342.sra Read 1770913 spots for SRR22215342.sra Written 1770913 spots for SRR22215342.sra Read 1770913 spots for SRR22215342.sra Written 1770913 spots for SRR22215342.sra Read 1770913 spots for SRR22215342.sra Written 1770913 spots for SRR22215342.sra Read 1770913 spots for SRR22215342.sra Written 1770913 spots for SRR22215342.sra Read 1770913 spots for SRR22215342.sra Written 1770913 spots for SRR22215342.sra Read 1770920 spots for SRR22215342.sra Written 1770920 spots for SRR22215342.sra Read 1770913 spots for SRR22215342.sra Written 1770913 spots for SRR22215342.sra Read 1770913 spots for SRR22215342.sra Written 1770913 spots for SRR22215342.sra Read 1770913 spots for SRR22215342.sra Written 1770913 spots for SRR22215342.sra Read 1770913 spots for SRR22215342.sra Written 1770913 spots for SRR22215342.sra Read 1770913 spots for SRR22215342.sra Written 1770913 spots for SRR22215342.sra Read 1770913 spots for SRR22215342.sra Written 1770913 spots for SRR22215342.sra Read 1770913 spots for SRR22215342.sra Written 1770913 spots for SRR22215342.sra Read 1770913 spots for SRR22215342.sra Written 1770913 spots for SRR22215342.sra Read 1770913 spots for SRR22215342.sra Written 1770913 spots for SRR22215342.sra Read 1770913 spots for SRR22215342.sra Written 1770913 spots for SRR22215342.sra SRR ids: ['SRR22215342.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vxxen56k SRR22215342.sra spots: 35418267 blocks: [[1, 1770913], [1770914, 3541826], [3541827, 5312739], [5312740, 7083652], [7083653, 8854565], [8854566, 10625478], [10625479, 12396391], [12396392, 14167304], [14167305, 15938217], [15938218, 17709130], [17709131, 19480043], [19480044, 21250956], [21250957, 23021869], [23021870, 24792782], [24792783, 26563695], [26563696, 28334608], [28334609, 30105521], [30105522, 31876434], [31876435, 33647347], [33647348, 35418267]] SRR22215342 file size 12014976 SRR22215342 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22215342 SRR22215342_1.fastq SRR22215342_2.fastq Input file: SRR22215342_1.fastq Paired file: SRR22215342_2.fastq trimmed: SRR22215342-trimmed-pair1.fastq, SRR22215342-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:04:32 2025 >> started Tue Feb 11 09:05:14 2025 >> done (42.591s) 35418267 read pairs processed; of these: 351 ( 0.00%) short read pairs filtered out after trimming by size control 163096 ( 0.46%) empty read pairs filtered out after trimming by size control 35254820 (99.54%) read pairs available; of these: 4242084 (12.03%) trimmed read pairs available after processing 31012736 (87.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 7 0.00% 20 14 0.00% 21 11 0.00% 22 6 0.00% 23 11 0.00% 24 6 0.00% 25 3 0.00% 26 18 0.00% 27 17 0.00% 28 10 0.00% 29 65 0.00% 30 12 0.00% 31 25 0.00% 32 11 0.00% 33 8 0.00% 34 16 0.00% 35 9 0.00% 36 12 0.00% 37 12 0.00% 38 18 0.00% 39 9 0.00% 40 7 0.00% 41 14 0.00% 42 16 0.00% 43 15 0.00% 44 18 0.00% 45 23 0.00% 46 18 0.00% 47 24 0.00% 48 27 0.00% 49 25 0.00% 50 40 0.00% 51 38 0.00% 52 41 0.00% 53 37 0.00% 54 29 0.00% 55 43 0.00% 56 42 0.00% 57 39 0.00% 58 65 0.00% 59 43 0.00% 60 43 0.00% 61 50 0.00% 62 43 0.00% 63 65 0.00% 64 55 0.00% 65 65 0.00% 66 75 0.00% 67 76 0.00% 68 96 0.00% 69 88 0.00% 70 75 0.00% 71 137 0.00% 72 138 0.00% 73 191 0.00% 74 154 0.00% 75 224 0.00% 76 180 0.00% 77 224 0.00% 78 251 0.00% 79 292 0.00% 80 344 0.00% 81 364 0.00% 82 412 0.00% 83 471 0.00% 84 566 0.00% 85 554 0.00% 86 678 0.00% 87 773 0.00% 88 834 0.00% 89 954 0.00% 90 1032 0.00% 91 1215 0.00% 92 1306 0.00% 93 1460 0.00% 94 1632 0.00% 95 1873 0.01% 96 1928 0.01% 97 2226 0.01% 98 2393 0.01% 99 2639 0.01% 100 2952 0.01% 101 3271 0.01% 102 3587 0.01% 103 3969 0.01% 104 4463 0.01% 105 4981 0.01% 106 5563 0.02% 107 6155 0.02% 108 6817 0.02% 109 7763 0.02% 110 8640 0.02% 111 9736 0.03% 112 11036 0.03% 113 12254 0.03% 114 13852 0.04% 115 15659 0.04% 116 17892 0.05% 117 20311 0.06% 118 23184 0.07% 119 26396 0.07% 120 29282 0.08% 121 33290 0.09% 122 36523 0.10% 123 40333 0.11% 124 45274 0.13% 125 50685 0.14% 126 56345 0.16% 127 62321 0.18% 128 69335 0.20% 129 76250 0.22% 130 83739 0.24% 131 91040 0.26% 132 97995 0.28% 133 104599 0.30% 134 113061 0.32% 135 122171 0.35% 136 131253 0.37% 137 140478 0.40% 138 148966 0.42% 139 160246 0.45% 140 168763 0.48% 141 176739 0.50% 142 184812 0.52% 143 193993 0.55% 144 200928 0.57% 145 209220 0.59% 146 216604 0.61% 147 226316 0.64% 148 235764 0.67% 149 244505 0.69% 150 255680 0.73% 151 31012736 87.97% 35254820 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.08 fanout-score-rank=32 prefix-density=0.18 prefix-fanout=2.9 sequence=GTGGACTCCTTCTGGAT criterion=fanout-score sequence-density=0.08 sequence-density-rank=21 fanout-score=323.25 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=28.8 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=6.29 fanout-score-rank=21 prefix-density=0.26 prefix-fanout=4.0 sequence=ATCCAGAAGGAGTCCAC criterion=fanout-score sequence-density=0.07 sequence-density-rank=24 fanout-score=334.69 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=30.9 sequence=TGATGATGAAGATGA SRR22215342 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:06:13 Started mapping on | Feb 11 09:06:16 Finished on | Feb 11 09:09:42 Mapping speed, Million of reads per hour | 616.10 Number of input reads | 35254820 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 33021322 Uniquely mapped reads % | 93.66% Average mapped length | 297.53 Number of splices: Total | 23387456 Number of splices: Annotated (sjdb) | 22858121 Number of splices: GT/AG | 23013691 Number of splices: GC/AG | 288316 Number of splices: AT/AC | 29403 Number of splices: Non-canonical | 56046 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.19 Insertion rate per base | 0.02% Insertion average length | 1.82 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 720450 % of reads mapped to multiple loci | 2.04% Number of reads mapped to too many loci | 445415 % of reads mapped to too many loci | 1.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.55% % of reads unmapped: other | 0.48% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1513048 1513048 1513048 N_multimapping 720450 720450 720450 N_noFeature 1244591 32527183 1399119 N_ambiguous 497528 2366 156850 UnstrandedReadsAssigned:31279203 PositiveStrandReadsAssigned:491773 NegativeStrandReadsAssigned:31465353 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR22215342 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22215342-trimmed-pair1.fastq SRR22215342-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,254,820 reads, 32,168,526 reads pseudoaligned [quant] estimated average fragment length: 191.139 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,176 rounds 52401 SRR22215342.ke.tsv 34699 SRR22215342.se.tsv 87100 total ==> SRR22215342.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1827.86 3313 50.9727 Potri.005G024800.1.v4.1 1035 844.861 908 30.2245 Potri.004G059700.1.v4.1 961 770.875 55 2.00649 Potri.007G009000.2.v4.1 1416 1225.86 0 0 Potri.003G141000.2.v4.1 2943 2752.86 655.093 6.69233 Potri.016G087400.1.v4.1 270 84.2166 2113.29 705.702 Potri.015G069301.1.v4.1 564 373.918 0 0 Potri.010G195200.1.v4.1 1773 1582.86 157 2.78943 Potri.012G127500.1.v4.1 977 786.875 14402 514.726 ==> SRR22215342.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1574 Potri.001G233950.v4.1 6 Potri.001G122700.v4.1 752 Potri.001G212900.v4.1 13 Potri.001G182400.v4.1 36 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR22215342 completed mapping pipeline successfully