Starting /dee2/code/volunteer_pipeline.sh SRR22215343 current disk space = 3055542185984 free memory = 1177110396 SRR22215343 SRAfilesize adfcb588849ce70d733a24436a1d5a72 SRR22215343.sra SRR22215343.sra file validated SRR22215343 is paired end SRR22215343 is conventional basespace SRR22215343 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215343_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.85225 37.0 37.0 37.0 37.0 37.0 2 35.7825 37.0 37.0 37.0 37.0 37.0 3 36.2445 37.0 37.0 37.0 37.0 37.0 4 36.2595 37.0 37.0 37.0 37.0 37.0 5 36.2915 37.0 37.0 37.0 37.0 37.0 6 36.313 37.0 37.0 37.0 37.0 37.0 7 36.18 37.0 37.0 37.0 37.0 37.0 8 36.203 37.0 37.0 37.0 37.0 37.0 9 36.0965 37.0 37.0 37.0 37.0 37.0 10-14 36.203700000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.164699999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.1271 37.0 37.0 37.0 37.0 37.0 25-29 36.075199999999995 37.0 37.0 37.0 37.0 37.0 30-34 35.9588 37.0 37.0 37.0 37.0 37.0 35-39 35.8849 37.0 37.0 37.0 37.0 37.0 40-44 35.9271 37.0 37.0 37.0 37.0 37.0 45-49 35.8999 37.0 37.0 37.0 37.0 37.0 50-54 35.898300000000006 37.0 37.0 37.0 37.0 37.0 55-59 35.816500000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.7471 37.0 37.0 37.0 37.0 37.0 65-69 35.768800000000006 37.0 37.0 37.0 37.0 37.0 70-74 35.707899999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.6448 37.0 37.0 37.0 37.0 37.0 80-84 35.635000000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.5461 37.0 37.0 37.0 37.0 37.0 90-94 35.5984 37.0 37.0 37.0 37.0 37.0 95-99 35.498900000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.4696 37.0 37.0 37.0 37.0 37.0 105-109 35.374900000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.40050000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.3667 37.0 37.0 37.0 34.6 37.0 120-124 35.239700000000006 37.0 37.0 37.0 32.2 37.0 125-129 35.2992 37.0 37.0 37.0 32.2 37.0 130-134 35.2601 37.0 37.0 37.0 29.8 37.0 135-139 35.1184 37.0 37.0 37.0 25.0 37.0 140-144 35.075399999999995 37.0 37.0 37.0 25.0 37.0 145-149 35.0059 37.0 37.0 37.0 27.4 37.0 150-151 34.7195 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 3.0 23 2.0 24 8.0 25 10.0 26 13.0 27 26.0 28 34.0 29 41.0 30 61.0 31 81.0 32 109.0 33 115.0 34 232.0 35 514.0 36 2583.0 37 168.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.31657027910485 11.968820719135026 16.444556198139303 38.27005280362082 2 28.82205513784461 14.786967418546364 33.18295739348371 23.208020050125313 3 25.224999999999998 21.7 24.224999999999998 28.849999999999998 4 27.1 28.125 21.2 23.575 5 24.6 32.550000000000004 23.425 19.425 6 18.55 33.725 25.324999999999996 22.400000000000002 7 13.900000000000002 30.075000000000003 38.375 17.65 8 16.85 26.174999999999997 33.300000000000004 23.674999999999997 9 17.8 23.150000000000002 34.75 24.3 10-14 19.09 30.98 27.42 22.509999999999998 15-19 19.54 29.9 27.794999999999998 22.765 20-24 19.08 30.835 27.71 22.375 25-29 19.02 30.085 27.775 23.119999999999997 30-34 18.435000000000002 29.765000000000004 28.58 23.22 35-39 19.744999999999997 29.549999999999997 27.55 23.155 40-44 19.634999999999998 30.375000000000004 27.339999999999996 22.650000000000002 45-49 19.794999999999998 29.470000000000002 27.43 23.305 50-54 19.8 29.060000000000002 28.235 22.905 55-59 19.455 29.75 27.415 23.380000000000003 60-64 20.155 29.74 26.634999999999998 23.47 65-69 18.790000000000003 30.020000000000003 27.744999999999997 23.445 70-74 19.45 29.275000000000002 27.83 23.445 75-79 19.55 28.42 27.925 24.104999999999997 80-84 19.85 28.444999999999997 28.215 23.49 85-89 19.580000000000002 29.580000000000002 27.455000000000002 23.385 90-94 19.365 29.82 27.665 23.150000000000002 95-99 19.939999999999998 29.86 26.834999999999997 23.365 100-104 19.650000000000002 29.43 27.51 23.41 105-109 19.535 28.849999999999998 27.98 23.635 110-114 19.71 28.939999999999998 27.925 23.425 115-119 20.01 28.599999999999998 27.52 23.87 120-124 19.77 28.794999999999998 28.105000000000004 23.330000000000002 125-129 19.72 28.405 28.005000000000003 23.87 130-134 20.044999999999998 29.32 26.674999999999997 23.96 135-139 20.115 28.92 27.255000000000003 23.71 140-144 20.599999999999998 28.95 27.01 23.44 145-149 20.385 29.020000000000003 26.700000000000003 23.895 150-151 21.2 28.9 27.0 22.900000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 1.0 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.5 16 1.5 17 1.0 18 1.0 19 1.0 20 2.0 21 4.5 22 7.5 23 9.0 24 8.0 25 8.0 26 13.0 27 18.0 28 23.0 29 34.5 30 42.0 31 48.5 32 62.5 33 70.5 34 74.0 35 86.5 36 112.5 37 129.0 38 145.5 39 177.5 40 208.5 41 222.5 42 219.0 43 220.0 44 235.0 45 232.5 46 221.0 47 211.0 48 196.5 49 179.0 50 142.5 51 119.5 52 100.5 53 80.5 54 72.0 55 56.5 56 38.5 57 33.0 58 26.0 59 15.0 60 11.5 61 13.5 62 13.5 63 7.5 64 6.5 65 5.5 66 3.0 67 5.0 68 5.0 69 3.0 70 3.0 71 2.0 72 1.0 73 0.5 74 1.0 75 2.0 76 1.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.575 2 0.25 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.875 #Duplication Level Percentage of deduplicated Percentage of total 1 92.89367429340511 86.275 2 6.5679676985195155 12.2 3 0.5114401076716016 1.425 4 0.026917900403768503 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.0875 0.0 0.0 0.0 0.0 106-107 0.1375 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.3625 0.0 0.0 0.0 0.0 116-117 0.3875 0.0 0.0 0.0 0.0 118-119 0.5625 0.0 0.0 0.0 0.0 120-121 0.65 0.0 0.0 0.0 0.0 122-123 0.8125 0.0 0.0 0.0 0.0 124-125 0.95 0.0 0.0 0.0 0.0 126-127 1.3125 0.0 0.0 0.0 0.0 128-129 1.65 0.0 0.0 0.0 0.0 130-131 2.0125 0.0 0.0 0.0 0.0 132-133 2.4875 0.0 0.0 0.0 0.0 134-135 3.1125 0.0 0.0 0.0 0.0 136-137 3.4625 0.0 0.0 0.0 0.0 138-139 3.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCCATC 10 0.006830828 145.0 3 CCATCAC 10 0.006830828 145.0 5 GCCATCA 10 0.006830828 145.0 4 >>END_MODULE SRR22215343 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215343_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.8355 37.0 37.0 37.0 37.0 37.0 2 36.206 37.0 37.0 37.0 37.0 37.0 3 36.047 37.0 37.0 37.0 37.0 37.0 4 36.15 37.0 37.0 37.0 37.0 37.0 5 36.124 37.0 37.0 37.0 37.0 37.0 6 36.1025 37.0 37.0 37.0 37.0 37.0 7 36.137 37.0 37.0 37.0 37.0 37.0 8 36.0715 37.0 37.0 37.0 37.0 37.0 9 36.17 37.0 37.0 37.0 37.0 37.0 10-14 36.18050000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.1286 37.0 37.0 37.0 37.0 37.0 20-24 36.0472 37.0 37.0 37.0 37.0 37.0 25-29 36.001099999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.025200000000005 37.0 37.0 37.0 37.0 37.0 35-39 35.956399999999995 37.0 37.0 37.0 37.0 37.0 40-44 35.8996 37.0 37.0 37.0 37.0 37.0 45-49 35.9135 37.0 37.0 37.0 37.0 37.0 50-54 35.8969 37.0 37.0 37.0 37.0 37.0 55-59 35.7975 37.0 37.0 37.0 37.0 37.0 60-64 35.8267 37.0 37.0 37.0 37.0 37.0 65-69 35.779 37.0 37.0 37.0 37.0 37.0 70-74 35.836 37.0 37.0 37.0 37.0 37.0 75-79 35.6691 37.0 37.0 37.0 37.0 37.0 80-84 35.6508 37.0 37.0 37.0 37.0 37.0 85-89 35.543800000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.617200000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.496 37.0 37.0 37.0 37.0 37.0 100-104 35.5004 37.0 37.0 37.0 37.0 37.0 105-109 35.4808 37.0 37.0 37.0 37.0 37.0 110-114 35.4601 37.0 37.0 37.0 37.0 37.0 115-119 35.45719999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.3307 37.0 37.0 37.0 34.6 37.0 125-129 35.3225 37.0 37.0 37.0 32.2 37.0 130-134 35.217600000000004 37.0 37.0 37.0 29.8 37.0 135-139 35.25019999999999 37.0 37.0 37.0 32.2 37.0 140-144 35.079899999999995 37.0 37.0 37.0 25.0 37.0 145-149 35.0756 37.0 37.0 37.0 25.0 37.0 150-151 34.9225 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 1.0 16 2.0 17 0.0 18 1.0 19 0.0 20 1.0 21 2.0 22 7.0 23 8.0 24 12.0 25 8.0 26 14.0 27 14.0 28 25.0 29 24.0 30 39.0 31 52.0 32 68.0 33 138.0 34 239.0 35 706.0 36 2439.0 37 199.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.324999999999996 21.45 16.625 29.599999999999998 2 28.575 29.025000000000002 28.299999999999997 14.099999999999998 3 22.975 32.475 26.75 17.8 4 26.424999999999997 37.125 20.724999999999998 15.725 5 27.650000000000002 36.85 20.925 14.575 6 18.6 42.0 23.5 15.9 7 19.725 19.6 41.199999999999996 19.475 8 23.150000000000002 23.025000000000002 29.25 24.575 9 24.725 23.575 29.25 22.45 10-14 24.255 29.585 26.150000000000002 20.01 15-19 24.965 27.93 27.584999999999997 19.52 20-24 24.525 28.685 27.525 19.265 25-29 24.345 27.860000000000003 28.37 19.425 30-34 23.5 28.95 28.04 19.509999999999998 35-39 23.985 28.475 27.744999999999997 19.794999999999998 40-44 23.805 28.105000000000004 27.860000000000003 20.23 45-49 23.724999999999998 28.71 27.935 19.63 50-54 23.995 27.55 28.265 20.19 55-59 23.990000000000002 28.050000000000004 28.32 19.64 60-64 24.13 27.825 28.389999999999997 19.655 65-69 23.75 28.105000000000004 28.244999999999997 19.900000000000002 70-74 24.015 28.449999999999996 28.244999999999997 19.29 75-79 23.635 27.939999999999998 28.660000000000004 19.765 80-84 24.43 27.76 28.09 19.72 85-89 23.575 27.99 28.54 19.895 90-94 24.15 27.71 28.78 19.36 95-99 23.330000000000002 28.04 29.015 19.615 100-104 23.805 27.63 28.68 19.885 105-109 24.01 28.1 28.46 19.43 110-114 23.465 28.244999999999997 28.799999999999997 19.49 115-119 23.77 28.544999999999998 27.725 19.96 120-124 24.145 27.700000000000003 29.17 18.985 125-129 24.05 28.775000000000002 28.12 19.055 130-134 24.125 28.125 28.32 19.43 135-139 23.665 27.93 29.48 18.925 140-144 23.89 28.355000000000004 28.67 19.085 145-149 24.505 28.73 27.944999999999997 18.82 150-151 25.3 27.8375 28.012500000000003 18.85 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.5 22 2.0 23 3.5 24 4.5 25 5.0 26 7.5 27 8.5 28 13.0 29 18.0 30 24.0 31 34.0 32 37.5 33 54.5 34 77.0 35 81.0 36 92.0 37 112.0 38 139.0 39 178.0 40 202.0 41 221.5 42 251.0 43 267.0 44 253.0 45 254.0 46 254.0 47 225.0 48 207.0 49 187.0 50 159.0 51 129.5 52 102.5 53 85.5 54 74.0 55 54.0 56 34.5 57 28.5 58 24.5 59 18.5 60 12.5 61 9.0 62 8.0 63 6.0 64 2.5 65 2.0 66 4.5 67 5.0 68 3.0 69 2.5 70 2.5 71 1.5 72 1.0 73 2.0 74 1.5 75 1.0 76 2.5 77 1.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.9 #Duplication Level Percentage of deduplicated Percentage of total 1 92.86867599569429 86.275 2 6.646932185145317 12.35 3 0.457481162540366 1.275 4 0.026910656620021525 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.0875 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.2625 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.3375 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.5625 0.0 0.0 0.0 0.0 120-121 0.6375 0.0 0.0 0.0 0.0 122-123 0.8125 0.0 0.0 0.0 0.0 124-125 0.9624999999999999 0.0 0.0 0.0 0.0 126-127 1.3125 0.0 0.0 0.0 0.0 128-129 1.6125 0.0 0.0 0.0 0.0 130-131 2.0 0.0 0.0 0.0 0.0 132-133 2.4875 0.0 0.0 0.0 0.0 134-135 3.1375 0.0 0.0 0.0 0.0 136-137 3.4875 0.0 0.0 0.0 0.0 138-139 4.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAAAGG 10 0.006830828 145.0 8 >>END_MODULE Read 1624136 spots for SRR22215343.sra Written 1624136 spots for SRR22215343.sra Read 1624136 spots for SRR22215343.sra Written 1624136 spots for SRR22215343.sra Read 1624136 spots for SRR22215343.sra Written 1624136 spots for SRR22215343.sra Read 1624136 spots for SRR22215343.sra Written 1624136 spots for SRR22215343.sra Read 1624136 spots for SRR22215343.sra Written 1624136 spots for SRR22215343.sra Read 1624136 spots for SRR22215343.sra Written 1624136 spots for SRR22215343.sra Read 1624136 spots for SRR22215343.sra Written 1624136 spots for SRR22215343.sra Read 1624136 spots for SRR22215343.sra Written 1624136 spots for SRR22215343.sra Read 1624136 spots for SRR22215343.sra Written 1624136 spots for SRR22215343.sra Read 1624136 spots for SRR22215343.sra Written 1624136 spots for SRR22215343.sra Read 1624136 spots for SRR22215343.sra Written 1624136 spots for SRR22215343.sra Read 1624136 spots for SRR22215343.sra Written 1624136 spots for SRR22215343.sra Read 1624136 spots for SRR22215343.sra Written 1624136 spots for SRR22215343.sra Read 1624136 spots for SRR22215343.sra Written 1624136 spots for SRR22215343.sra Read 1624136 spots for SRR22215343.sra Written 1624136 spots for SRR22215343.sra Read 1624136 spots for SRR22215343.sra Written 1624136 spots for SRR22215343.sra Read 1624136 spots for SRR22215343.sra Written 1624136 spots for SRR22215343.sra Read 1624148 spots for SRR22215343.sra Written 1624148 spots for SRR22215343.sra Read 1624136 spots for SRR22215343.sra Written 1624136 spots for SRR22215343.sra Read 1624136 spots for SRR22215343.sra Written 1624136 spots for SRR22215343.sra SRR ids: ['SRR22215343.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mnzylw2t SRR22215343.sra spots: 32482732 blocks: [[1, 1624136], [1624137, 3248272], [3248273, 4872408], [4872409, 6496544], [6496545, 8120680], [8120681, 9744816], [9744817, 11368952], [11368953, 12993088], [12993089, 14617224], [14617225, 16241360], [16241361, 17865496], [17865497, 19489632], [19489633, 21113768], [21113769, 22737904], [22737905, 24362040], [24362041, 25986176], [25986177, 27610312], [27610313, 29234448], [29234449, 30858584], [30858585, 32482732]] SRR22215343 file size 11017353 SRR22215343 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22215343 SRR22215343_1.fastq SRR22215343_2.fastq Input file: SRR22215343_1.fastq Paired file: SRR22215343_2.fastq trimmed: SRR22215343-trimmed-pair1.fastq, SRR22215343-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:08:02 2025 >> started Tue Feb 11 09:08:40 2025 >> done (37.059s) 32482732 read pairs processed; of these: 73 ( 0.00%) short read pairs filtered out after trimming by size control 28152 ( 0.09%) empty read pairs filtered out after trimming by size control 32454507 (99.91%) read pairs available; of these: 3507497 (10.81%) trimmed read pairs available after processing 28947010 (89.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 4 0.00% 21 4 0.00% 22 3 0.00% 23 7 0.00% 24 1 0.00% 25 2 0.00% 26 3 0.00% 27 6 0.00% 28 2 0.00% 29 5 0.00% 30 4 0.00% 31 8 0.00% 32 8 0.00% 33 6 0.00% 34 8 0.00% 35 7 0.00% 36 6 0.00% 37 9 0.00% 38 14 0.00% 39 8 0.00% 40 6 0.00% 41 12 0.00% 42 15 0.00% 43 11 0.00% 44 17 0.00% 45 10 0.00% 46 17 0.00% 47 21 0.00% 48 19 0.00% 49 23 0.00% 50 26 0.00% 51 25 0.00% 52 27 0.00% 53 36 0.00% 54 27 0.00% 55 47 0.00% 56 45 0.00% 57 49 0.00% 58 40 0.00% 59 46 0.00% 60 53 0.00% 61 49 0.00% 62 70 0.00% 63 78 0.00% 64 89 0.00% 65 105 0.00% 66 90 0.00% 67 100 0.00% 68 113 0.00% 69 137 0.00% 70 167 0.00% 71 187 0.00% 72 177 0.00% 73 194 0.00% 74 229 0.00% 75 273 0.00% 76 250 0.00% 77 338 0.00% 78 363 0.00% 79 421 0.00% 80 478 0.00% 81 538 0.00% 82 539 0.00% 83 678 0.00% 84 683 0.00% 85 775 0.00% 86 871 0.00% 87 942 0.00% 88 1075 0.00% 89 1174 0.00% 90 1251 0.00% 91 1315 0.00% 92 1486 0.00% 93 1688 0.01% 94 1886 0.01% 95 2053 0.01% 96 2241 0.01% 97 2431 0.01% 98 2757 0.01% 99 2916 0.01% 100 3081 0.01% 101 3471 0.01% 102 3852 0.01% 103 4092 0.01% 104 4492 0.01% 105 4965 0.02% 106 5709 0.02% 107 6100 0.02% 108 6777 0.02% 109 7715 0.02% 110 8437 0.03% 111 9362 0.03% 112 10108 0.03% 113 11710 0.04% 114 12883 0.04% 115 14834 0.05% 116 16474 0.05% 117 18764 0.06% 118 20969 0.06% 119 23471 0.07% 120 26216 0.08% 121 29026 0.09% 122 31874 0.10% 123 35360 0.11% 124 39471 0.12% 125 44034 0.14% 126 48524 0.15% 127 53576 0.17% 128 59585 0.18% 129 65181 0.20% 130 70491 0.22% 131 75761 0.23% 132 81311 0.25% 133 87335 0.27% 134 93223 0.29% 135 99660 0.31% 136 106470 0.33% 137 113766 0.35% 138 122097 0.38% 139 130467 0.40% 140 136188 0.42% 141 144122 0.44% 142 150726 0.46% 143 156798 0.48% 144 162715 0.50% 145 168624 0.52% 146 174775 0.54% 147 181007 0.56% 148 189490 0.58% 149 196589 0.61% 150 203870 0.63% 151 28947010 89.19% 32454507 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=3.28 fanout-score-rank=33 prefix-density=0.17 prefix-fanout=3.0 sequence=CTCCACACTTGTA criterion=fanout-score sequence-density=0.08 sequence-density-rank=11 fanout-score=310.16 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=28.5 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=38 prefix-density=0.16 prefix-fanout=2.1 sequence=TACAAGTGTGGAGGTTATACACTTCCATGATGGGATAACACATCAGAATTGAAGACCATAGCTAGCGACCATGAACTTAGAAGTACTTAAAAGCTGGTAGCTACTTCTGTAACTAGCAACTACGTAAGCTTTAC criterion=fanout-score sequence-density=0.07 sequence-density-rank=12 fanout-score=317.21 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=25.2 sequence=AAGAAGAAGAAA SRR22215343 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:09:31 Started mapping on | Feb 11 09:09:31 Finished on | Feb 11 09:12:38 Mapping speed, Million of reads per hour | 624.79 Number of input reads | 32454507 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 30373217 Uniquely mapped reads % | 93.59% Average mapped length | 297.84 Number of splices: Total | 22121208 Number of splices: Annotated (sjdb) | 21614469 Number of splices: GT/AG | 21765845 Number of splices: GC/AG | 272456 Number of splices: AT/AC | 26991 Number of splices: Non-canonical | 55916 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.23 Insertion rate per base | 0.02% Insertion average length | 1.87 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 703423 % of reads mapped to multiple loci | 2.17% Number of reads mapped to too many loci | 467697 % of reads mapped to too many loci | 1.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.25% % of reads unmapped: other | 0.55% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1377867 1377867 1377867 N_multimapping 703423 703423 703423 N_noFeature 1259132 29946266 1407412 N_ambiguous 428292 2038 148553 UnstrandedReadsAssigned:28685793 PositiveStrandReadsAssigned:424913 NegativeStrandReadsAssigned:28817252 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR22215343 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22215343-trimmed-pair1.fastq SRR22215343-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,454,507 reads, 29,559,568 reads pseudoaligned [quant] estimated average fragment length: 194.809 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,145 rounds 52401 SRR22215343.ke.tsv 34699 SRR22215343.se.tsv 87100 total ==> SRR22215343.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1824.19 3377 60.1806 Potri.005G024800.1.v4.1 1035 841.191 1017 39.3026 Potri.004G059700.1.v4.1 961 767.191 111 4.70343 Potri.007G009000.2.v4.1 1416 1222.19 0 0 Potri.003G141000.2.v4.1 2943 2749.19 798.818 9.44579 Potri.016G087400.1.v4.1 270 81.2139 1588 635.646 Potri.015G069301.1.v4.1 564 370.244 0 0 Potri.010G195200.1.v4.1 1773 1579.19 179 3.6848 Potri.012G127500.1.v4.1 977 783.191 15695 651.462 ==> SRR22215343.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2144 Potri.001G233950.v4.1 15 Potri.001G122700.v4.1 616 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 107 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR22215343 completed mapping pipeline successfully