Starting /dee2/code/volunteer_pipeline.sh SRR22215344 current disk space = 3054664949760 free memory = 1478279036 SRR22215344 SRAfilesize 97b78d4d901cf2dd805476c70d4e18c5 SRR22215344.sra SRR22215344.sra file validated SRR22215344 is paired end SRR22215344 is conventional basespace SRR22215344 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215344_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.97825 37.0 37.0 37.0 37.0 37.0 2 36.084 37.0 37.0 37.0 37.0 37.0 3 36.1705 37.0 37.0 37.0 37.0 37.0 4 36.3135 37.0 37.0 37.0 37.0 37.0 5 36.3425 37.0 37.0 37.0 37.0 37.0 6 36.241 37.0 37.0 37.0 37.0 37.0 7 36.2425 37.0 37.0 37.0 37.0 37.0 8 36.278 37.0 37.0 37.0 37.0 37.0 9 36.316 37.0 37.0 37.0 37.0 37.0 10-14 36.300799999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.2663 37.0 37.0 37.0 37.0 37.0 20-24 36.2775 37.0 37.0 37.0 37.0 37.0 25-29 36.1642 37.0 37.0 37.0 37.0 37.0 30-34 36.1272 37.0 37.0 37.0 37.0 37.0 35-39 36.064 37.0 37.0 37.0 37.0 37.0 40-44 36.00150000000001 37.0 37.0 37.0 37.0 37.0 45-49 35.9728 37.0 37.0 37.0 37.0 37.0 50-54 35.9825 37.0 37.0 37.0 37.0 37.0 55-59 35.8738 37.0 37.0 37.0 37.0 37.0 60-64 35.8178 37.0 37.0 37.0 37.0 37.0 65-69 35.8443 37.0 37.0 37.0 37.0 37.0 70-74 35.8099 37.0 37.0 37.0 37.0 37.0 75-79 35.8162 37.0 37.0 37.0 37.0 37.0 80-84 35.8287 37.0 37.0 37.0 37.0 37.0 85-89 35.669 37.0 37.0 37.0 37.0 37.0 90-94 35.5912 37.0 37.0 37.0 37.0 37.0 95-99 35.6693 37.0 37.0 37.0 37.0 37.0 100-104 35.53580000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.5826 37.0 37.0 37.0 37.0 37.0 110-114 35.62769999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.5229 37.0 37.0 37.0 37.0 37.0 120-124 35.4596 37.0 37.0 37.0 37.0 37.0 125-129 35.3947 37.0 37.0 37.0 37.0 37.0 130-134 35.4247 37.0 37.0 37.0 37.0 37.0 135-139 35.3771 37.0 37.0 37.0 34.6 37.0 140-144 35.2661 37.0 37.0 37.0 34.6 37.0 145-149 35.214999999999996 37.0 37.0 37.0 32.2 37.0 150-151 35.09625 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 3.0 23 2.0 24 9.0 25 10.0 26 11.0 27 14.0 28 23.0 29 37.0 30 46.0 31 75.0 32 112.0 33 122.0 34 214.0 35 432.0 36 2658.0 37 230.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.07324439969796 12.383589227284169 16.86383085829348 37.679335514724386 2 29.33801404212638 12.61283851554664 35.581745235707125 22.46740220661986 3 26.424999999999997 21.475 24.625 27.474999999999998 4 28.675 26.825 22.05 22.45 5 25.074999999999996 31.724999999999998 23.35 19.85 6 18.85 33.25 25.85 22.05 7 13.25 30.099999999999998 38.7 17.95 8 16.625 26.275 33.1 24.0 9 18.35 23.599999999999998 33.2 24.85 10-14 19.49 31.264999999999997 27.355 21.89 15-19 19.88 30.3 27.355 22.465 20-24 19.185 29.665000000000003 28.26 22.89 25-29 19.29 29.404999999999998 28.055000000000003 23.25 30-34 19.21 29.575000000000003 28.005000000000003 23.21 35-39 19.134999999999998 29.755 27.950000000000003 23.16 40-44 19.935 29.785 27.735 22.545 45-49 19.455 29.59 27.55 23.405 50-54 19.794999999999998 29.29 27.765 23.150000000000002 55-59 19.835 29.875 27.205000000000002 23.085 60-64 19.355 28.955 27.939999999999998 23.75 65-69 19.775000000000002 29.03 28.27 22.925 70-74 19.689999999999998 29.470000000000002 27.279999999999998 23.56 75-79 19.915 29.145 27.66 23.28 80-84 20.150000000000002 28.22 27.339999999999996 24.29 85-89 19.564999999999998 30.195 27.215 23.025000000000002 90-94 20.05 28.825 27.195000000000004 23.93 95-99 20.36 28.485 27.034999999999997 24.12 100-104 20.28 28.515 27.584999999999997 23.62 105-109 20.0 28.275 27.900000000000002 23.825 110-114 19.79 29.45 27.145000000000003 23.615 115-119 20.03 28.955 27.794999999999998 23.22 120-124 19.725 28.444999999999997 28.134999999999998 23.695 125-129 20.349999999999998 28.305000000000003 27.845 23.5 130-134 20.515 28.62 27.605 23.26 135-139 21.16 29.09 26.55 23.200000000000003 140-144 21.154999999999998 28.410000000000004 26.46 23.974999999999998 145-149 21.634999999999998 29.26 25.485000000000003 23.62 150-151 21.099999999999998 29.575000000000003 26.174999999999997 23.150000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 1.0 17 1.5 18 1.0 19 1.0 20 1.5 21 1.5 22 3.5 23 5.5 24 5.0 25 5.5 26 11.0 27 19.5 28 24.0 29 25.0 30 39.5 31 51.5 32 56.5 33 65.0 34 82.5 35 103.5 36 111.0 37 125.5 38 135.0 39 159.0 40 199.0 41 202.5 42 217.0 43 221.5 44 223.5 45 245.0 46 248.5 47 243.5 48 216.0 49 184.0 50 148.0 51 115.0 52 95.5 53 83.0 54 68.0 55 43.0 56 33.5 57 35.5 58 26.0 59 18.5 60 19.5 61 17.0 62 11.0 63 10.5 64 9.0 65 4.5 66 3.5 67 2.0 68 3.0 69 3.0 70 1.5 71 1.5 72 1.0 73 2.0 74 2.0 75 2.5 76 2.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.675 2 0.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.475 #Duplication Level Percentage of deduplicated Percentage of total 1 92.72776426061098 85.75 2 6.461205731278724 11.95 3 0.7569613409029468 2.1 4 0.054068667207353344 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.3 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.475 0.0 0.0 0.0 0.0 118-119 0.7250000000000001 0.0 0.0 0.0 0.0 120-121 0.8500000000000001 0.0 0.0 0.0 0.0 122-123 1.1124999999999998 0.0 0.0 0.0 0.0 124-125 1.4875 0.0 0.0 0.0 0.0 126-127 1.8875 0.0 0.0 0.0 0.0 128-129 2.2 0.0 0.0 0.0 0.0 130-131 2.7 0.0 0.0 0.0 0.0 132-133 3.2625 0.0 0.0 0.0 0.0 134-135 3.925 0.0 0.0 0.0 0.0 136-137 4.3875 0.0 0.0 0.0 0.0 138-139 5.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGTCCC 10 0.006830828 145.0 2 >>END_MODULE SRR22215344 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215344_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.8855 37.0 37.0 37.0 37.0 37.0 2 36.24 37.0 37.0 37.0 37.0 37.0 3 36.324 37.0 37.0 37.0 37.0 37.0 4 36.1275 37.0 37.0 37.0 37.0 37.0 5 36.159 37.0 37.0 37.0 37.0 37.0 6 36.197 37.0 37.0 37.0 37.0 37.0 7 36.2425 37.0 37.0 37.0 37.0 37.0 8 36.1885 37.0 37.0 37.0 37.0 37.0 9 36.254 37.0 37.0 37.0 37.0 37.0 10-14 36.231 37.0 37.0 37.0 37.0 37.0 15-19 36.192299999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.1367 37.0 37.0 37.0 37.0 37.0 25-29 36.0779 37.0 37.0 37.0 37.0 37.0 30-34 36.0507 37.0 37.0 37.0 37.0 37.0 35-39 36.028200000000005 37.0 37.0 37.0 37.0 37.0 40-44 35.9354 37.0 37.0 37.0 37.0 37.0 45-49 35.9266 37.0 37.0 37.0 37.0 37.0 50-54 35.9458 37.0 37.0 37.0 37.0 37.0 55-59 35.838300000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.826499999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.8704 37.0 37.0 37.0 37.0 37.0 70-74 35.8119 37.0 37.0 37.0 37.0 37.0 75-79 35.7096 37.0 37.0 37.0 37.0 37.0 80-84 35.6978 37.0 37.0 37.0 37.0 37.0 85-89 35.6848 37.0 37.0 37.0 37.0 37.0 90-94 35.678900000000006 37.0 37.0 37.0 37.0 37.0 95-99 35.668099999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.5971 37.0 37.0 37.0 37.0 37.0 105-109 35.5658 37.0 37.0 37.0 37.0 37.0 110-114 35.472500000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.457 37.0 37.0 37.0 37.0 37.0 120-124 35.338499999999996 37.0 37.0 37.0 34.6 37.0 125-129 35.2772 37.0 37.0 37.0 34.6 37.0 130-134 35.2276 37.0 37.0 37.0 29.8 37.0 135-139 35.2363 37.0 37.0 37.0 32.2 37.0 140-144 35.1105 37.0 37.0 37.0 27.4 37.0 145-149 35.0214 37.0 37.0 37.0 25.0 37.0 150-151 34.77625 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 0.0 19 1.0 20 1.0 21 1.0 22 3.0 23 10.0 24 6.0 25 11.0 26 13.0 27 13.0 28 22.0 29 21.0 30 41.0 31 62.0 32 79.0 33 134.0 34 225.0 35 694.0 36 2451.0 37 210.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.85 21.925 16.325 30.9 2 28.375 27.825 29.575000000000003 14.224999999999998 3 21.349999999999998 31.175000000000004 28.825 18.65 4 25.224999999999998 34.625 23.225 16.925 5 26.400000000000002 36.425000000000004 21.5 15.675 6 19.075 39.324999999999996 24.925 16.675 7 19.2 18.275 41.825 20.7 8 21.825 24.625 28.799999999999997 24.75 9 24.474999999999998 24.525 28.000000000000004 23.0 10-14 24.205 28.715000000000003 26.090000000000003 20.990000000000002 15-19 23.505000000000003 27.875 28.265 20.355 20-24 24.02 27.72 27.785 20.474999999999998 25-29 24.12 27.51 28.29 20.080000000000002 30-34 23.74 28.63 27.615000000000002 20.015 35-39 23.735 28.485 27.735 20.044999999999998 40-44 23.82 27.915 28.065 20.200000000000003 45-49 23.494999999999997 28.02 28.035 20.45 50-54 23.525 28.384999999999998 28.095 19.994999999999997 55-59 23.905 28.294999999999998 27.815 19.985 60-64 23.294999999999998 28.07 28.325 20.31 65-69 23.765 28.22 28.59 19.425 70-74 23.51 27.62 28.565 20.305 75-79 23.57 27.139999999999997 29.465000000000003 19.825 80-84 23.77 27.175 29.125 19.93 85-89 23.635 27.42 29.04 19.905 90-94 23.385 28.185 28.405 20.025000000000002 95-99 23.605 27.855 28.24 20.3 100-104 24.065 28.055000000000003 28.415000000000003 19.465 105-109 23.015 28.38 29.37 19.235 110-114 23.325000000000003 27.61 28.82 20.244999999999997 115-119 23.96 27.744999999999997 29.12 19.175 120-124 23.7 27.200000000000003 29.439999999999998 19.66 125-129 23.285 28.095 29.154999999999998 19.465 130-134 23.98 28.389999999999997 28.265 19.365 135-139 23.985 27.71 28.95 19.355 140-144 24.535 27.99 28.035 19.439999999999998 145-149 25.27 27.915 26.919999999999998 19.895 150-151 25.124999999999996 29.037499999999998 27.037499999999998 18.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 1.5 17 2.0 18 2.5 19 2.0 20 0.5 21 2.0 22 2.0 23 1.0 24 1.0 25 3.0 26 4.5 27 6.0 28 9.0 29 15.0 30 21.0 31 29.0 32 44.5 33 51.0 34 62.0 35 78.5 36 99.0 37 132.5 38 152.5 39 174.0 40 195.0 41 208.5 42 236.5 43 255.0 44 260.0 45 260.0 46 253.5 47 239.0 48 211.0 49 185.5 50 146.5 51 127.5 52 113.5 53 83.0 54 78.5 55 61.5 56 34.0 57 24.0 58 20.0 59 18.5 60 13.0 61 8.0 62 11.0 63 10.0 64 10.5 65 10.5 66 5.0 67 1.5 68 2.0 69 2.5 70 2.0 71 2.0 72 2.0 73 2.0 74 1.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 1.0 83 1.5 84 0.5 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.425 #Duplication Level Percentage of deduplicated Percentage of total 1 92.66973221530971 85.65 2 6.545847984852584 12.1 3 0.7032729239924264 1.95 4 0.08114687584527995 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.3 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.475 0.0 0.0 0.0 0.0 118-119 0.7 0.0 0.0 0.0 0.0 120-121 0.825 0.0 0.0 0.0 0.0 122-123 1.0875 0.0 0.0 0.0 0.0 124-125 1.4375 0.0 0.0 0.0 0.0 126-127 1.8250000000000002 0.0 0.0 0.0 0.0 128-129 2.0999999999999996 0.0 0.0 0.0 0.0 130-131 2.5999999999999996 0.0 0.0 0.0 0.0 132-133 3.1625 0.0 0.0 0.0 0.0 134-135 3.825 0.0 0.0 0.0 0.0 136-137 4.325 0.0 0.0 0.0 0.0 138-139 5.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATGATG 10 0.006830828 145.0 9 CTGGATT 10 0.006830828 145.0 2 >>END_MODULE Read 2089581 spots for SRR22215344.sra Written 2089581 spots for SRR22215344.sra Read 2089581 spots for SRR22215344.sra Written 2089581 spots for SRR22215344.sra Read 2089581 spots for SRR22215344.sra Written 2089581 spots for SRR22215344.sra Read 2089581 spots for SRR22215344.sra Written 2089581 spots for SRR22215344.sra Read 2089581 spots for SRR22215344.sra Written 2089581 spots for SRR22215344.sra Read 2089581 spots for SRR22215344.sra Written 2089581 spots for SRR22215344.sra Read 2089581 spots for SRR22215344.sra Written 2089581 spots for SRR22215344.sra Read 2089581 spots for SRR22215344.sra Written 2089581 spots for SRR22215344.sra Read 2089595 spots for SRR22215344.sra Written 2089595 spots for SRR22215344.sra Read 2089581 spots for SRR22215344.sra Written 2089581 spots for SRR22215344.sra Read 2089581 spots for SRR22215344.sra Written 2089581 spots for SRR22215344.sra Read 2089581 spots for SRR22215344.sra Written 2089581 spots for SRR22215344.sra Read 2089581 spots for SRR22215344.sra Written 2089581 spots for SRR22215344.sra Read 2089581 spots for SRR22215344.sra Written 2089581 spots for SRR22215344.sra Read 2089581 spots for SRR22215344.sra Written 2089581 spots for SRR22215344.sra Read 2089581 spots for SRR22215344.sra Written 2089581 spots for SRR22215344.sra Read 2089581 spots for SRR22215344.sra Written 2089581 spots for SRR22215344.sra Read 2089581 spots for SRR22215344.sra Written 2089581 spots for SRR22215344.sra Read 2089581 spots for SRR22215344.sra Written 2089581 spots for SRR22215344.sra Read 2089581 spots for SRR22215344.sra Written 2089581 spots for SRR22215344.sra SRR ids: ['SRR22215344.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vm93arax SRR22215344.sra spots: 41791634 blocks: [[1, 2089581], [2089582, 4179162], [4179163, 6268743], [6268744, 8358324], [8358325, 10447905], [10447906, 12537486], [12537487, 14627067], [14627068, 16716648], [16716649, 18806229], [18806230, 20895810], [20895811, 22985391], [22985392, 25074972], [25074973, 27164553], [27164554, 29254134], [29254135, 31343715], [31343716, 33433296], [33433297, 35522877], [35522878, 37612458], [37612459, 39702039], [39702040, 41791634]] SRR22215344 file size 14180925 SRR22215344 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22215344 SRR22215344_1.fastq SRR22215344_2.fastq Input file: SRR22215344_1.fastq Paired file: SRR22215344_2.fastq trimmed: SRR22215344-trimmed-pair1.fastq, SRR22215344-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:42:21 2025 >> started Tue Feb 11 09:43:06 2025 >> done (45.582s) 41791634 read pairs processed; of these: 88 ( 0.00%) short read pairs filtered out after trimming by size control 46572 ( 0.11%) empty read pairs filtered out after trimming by size control 41744974 (99.89%) read pairs available; of these: 5278487 (12.64%) trimmed read pairs available after processing 36466487 (87.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 6 0.00% 21 5 0.00% 22 6 0.00% 23 4 0.00% 24 7 0.00% 25 1 0.00% 26 3 0.00% 27 7 0.00% 28 4 0.00% 29 5 0.00% 30 7 0.00% 31 8 0.00% 32 3 0.00% 33 4 0.00% 34 9 0.00% 35 5 0.00% 36 11 0.00% 37 15 0.00% 38 7 0.00% 39 11 0.00% 40 13 0.00% 41 10 0.00% 42 11 0.00% 43 11 0.00% 44 18 0.00% 45 16 0.00% 46 12 0.00% 47 26 0.00% 48 22 0.00% 49 28 0.00% 50 25 0.00% 51 31 0.00% 52 30 0.00% 53 26 0.00% 54 35 0.00% 55 39 0.00% 56 47 0.00% 57 59 0.00% 58 78 0.00% 59 60 0.00% 60 67 0.00% 61 85 0.00% 62 108 0.00% 63 116 0.00% 64 115 0.00% 65 132 0.00% 66 126 0.00% 67 165 0.00% 68 205 0.00% 69 232 0.00% 70 251 0.00% 71 286 0.00% 72 302 0.00% 73 354 0.00% 74 398 0.00% 75 445 0.00% 76 542 0.00% 77 587 0.00% 78 624 0.00% 79 754 0.00% 80 883 0.00% 81 841 0.00% 82 1040 0.00% 83 1121 0.00% 84 1240 0.00% 85 1351 0.00% 86 1502 0.00% 87 1681 0.00% 88 1855 0.00% 89 1888 0.00% 90 2059 0.00% 91 2293 0.01% 92 2668 0.01% 93 2837 0.01% 94 3048 0.01% 95 3361 0.01% 96 3601 0.01% 97 4001 0.01% 98 4267 0.01% 99 4393 0.01% 100 4918 0.01% 101 5275 0.01% 102 5828 0.01% 103 6119 0.01% 104 6692 0.02% 105 7471 0.02% 106 8335 0.02% 107 9207 0.02% 108 10265 0.02% 109 11299 0.03% 110 12046 0.03% 111 13691 0.03% 112 15089 0.04% 113 16718 0.04% 114 18669 0.04% 115 21209 0.05% 116 23661 0.06% 117 26822 0.06% 118 31088 0.07% 119 34275 0.08% 120 37722 0.09% 121 42755 0.10% 122 46725 0.11% 123 51575 0.12% 124 57707 0.14% 125 63918 0.15% 126 71362 0.17% 127 79140 0.19% 128 86997 0.21% 129 94894 0.23% 130 104490 0.25% 131 112951 0.27% 132 121141 0.29% 133 129467 0.31% 134 138964 0.33% 135 149495 0.36% 136 160626 0.38% 137 171760 0.41% 138 183812 0.44% 139 197095 0.47% 140 207311 0.50% 141 216481 0.52% 142 227811 0.55% 143 238843 0.57% 144 246431 0.59% 145 255162 0.61% 146 265484 0.64% 147 275915 0.66% 148 288456 0.69% 149 299909 0.72% 150 312854 0.75% 151 36466487 87.36% 41744974 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=3.55 fanout-score-rank=19 prefix-density=0.43 prefix-fanout=3.1 sequence=GGTGCTGGAGCTGGAGC criterion=fanout-score sequence-density=0.12 sequence-density-rank=16 fanout-score=28.07 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=8.6 sequence=CCTTCCTTGTCCTGGATCTTAGCCTTGACATTGTCAATGGTGTCTGAGCTCTCCAC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=3.07 fanout-score-rank=18 prefix-density=0.37 prefix-fanout=2.6 sequence=GTGAACATAACCACAGGACTTACCAATACAAGTTTATCTGGCACGGTATACACGGACAACCAGCTAGCCATTTATAAGATTGAGAAGGTGCTACTTCCTAAGGACATTTTTGCTTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=125.88 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=8.0 sequence=TCTTCTCTCTGTCTTCTTGATTCCTTGTTTTTCGTTCTGTTTATTACAGCAGCAATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGAAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCCGCAAAGCCTGCAGAAACCGTGGCTGCTGCATAATGTTTATAATACCAATATTTACTATGTGAAACTGTGTTCTACTGGGTTATAGTTAGTTGGGCTTTCTATGATCATGATGTGGATTCTGGATATCCAGCATGCTTTTACTGGGATGTAAGCTATAATAATTTCTCTGGTACATTCATATGGTTATCTGTATTATCATTATT SRR22215344 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:43:50 Started mapping on | Feb 11 09:43:50 Finished on | Feb 11 09:47:25 Mapping speed, Million of reads per hour | 698.99 Number of input reads | 41744974 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 39165364 Uniquely mapped reads % | 93.82% Average mapped length | 297.49 Number of splices: Total | 28289900 Number of splices: Annotated (sjdb) | 27650957 Number of splices: GT/AG | 27847107 Number of splices: GC/AG | 340955 Number of splices: AT/AC | 35477 Number of splices: Non-canonical | 66361 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.03% Deletion average length | 2.25 Insertion rate per base | 0.02% Insertion average length | 1.85 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 852962 % of reads mapped to multiple loci | 2.04% Number of reads mapped to too many loci | 716713 % of reads mapped to too many loci | 1.72% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.90% % of reads unmapped: other | 0.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1726648 1726648 1726648 N_multimapping 852962 852962 852962 N_noFeature 1584791 38522411 1796440 N_ambiguous 612179 2723 179452 UnstrandedReadsAssigned:36968394 PositiveStrandReadsAssigned:640230 NegativeStrandReadsAssigned:37189472 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR22215344 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22215344-trimmed-pair1.fastq SRR22215344-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 41,744,974 reads, 38,005,121 reads pseudoaligned [quant] estimated average fragment length: 189.617 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,148 rounds 52401 SRR22215344.ke.tsv 34699 SRR22215344.se.tsv 87100 total ==> SRR22215344.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1829.38 3830 55.0808 Potri.005G024800.1.v4.1 1035 846.383 583 18.1221 Potri.004G059700.1.v4.1 961 772.383 298 10.1505 Potri.007G009000.2.v4.1 1416 1227.38 0 0 Potri.003G141000.2.v4.1 2943 2754.38 721.278 6.88945 Potri.016G087400.1.v4.1 270 85.5338 1845 567.498 Potri.015G069301.1.v4.1 564 375.433 0 0 Potri.010G195200.1.v4.1 1773 1584.38 133 2.2085 Potri.012G127500.1.v4.1 977 788.383 12529 418.105 ==> SRR22215344.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2840 Potri.001G233950.v4.1 8 Potri.001G122700.v4.1 963 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 350 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR22215344 completed mapping pipeline successfully