Starting /dee2/code/volunteer_pipeline.sh SRR22215345 current disk space = 3054926880768 free memory = 1466552116 SRR22215345 SRAfilesize 9cc93f65d40dbcf5722ec146f015dfa9 SRR22215345.sra SRR22215345.sra file validated SRR22215345 is paired end SRR22215345 is conventional basespace SRR22215345 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215345_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.982 37.0 37.0 37.0 37.0 37.0 2 35.94775 37.0 37.0 37.0 37.0 37.0 3 36.159 37.0 37.0 37.0 37.0 37.0 4 36.235 37.0 37.0 37.0 37.0 37.0 5 36.3515 37.0 37.0 37.0 37.0 37.0 6 36.298 37.0 37.0 37.0 37.0 37.0 7 36.1425 37.0 37.0 37.0 37.0 37.0 8 36.1955 37.0 37.0 37.0 37.0 37.0 9 36.1985 37.0 37.0 37.0 37.0 37.0 10-14 36.2544 37.0 37.0 37.0 37.0 37.0 15-19 36.249700000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.1624 37.0 37.0 37.0 37.0 37.0 25-29 36.115700000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.007 37.0 37.0 37.0 37.0 37.0 35-39 36.0099 37.0 37.0 37.0 37.0 37.0 40-44 35.9736 37.0 37.0 37.0 37.0 37.0 45-49 35.9157 37.0 37.0 37.0 37.0 37.0 50-54 35.812599999999996 37.0 37.0 37.0 37.0 37.0 55-59 35.8171 37.0 37.0 37.0 37.0 37.0 60-64 35.7677 37.0 37.0 37.0 37.0 37.0 65-69 35.803 37.0 37.0 37.0 37.0 37.0 70-74 35.8032 37.0 37.0 37.0 37.0 37.0 75-79 35.759100000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.75169999999999 37.0 37.0 37.0 37.0 37.0 85-89 35.6927 37.0 37.0 37.0 37.0 37.0 90-94 35.630900000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.6403 37.0 37.0 37.0 37.0 37.0 100-104 35.6337 37.0 37.0 37.0 37.0 37.0 105-109 35.5731 37.0 37.0 37.0 37.0 37.0 110-114 35.551700000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.5312 37.0 37.0 37.0 37.0 37.0 120-124 35.436 37.0 37.0 37.0 37.0 37.0 125-129 35.387699999999995 37.0 37.0 37.0 34.6 37.0 130-134 35.349700000000006 37.0 37.0 37.0 34.6 37.0 135-139 35.32340000000001 37.0 37.0 37.0 32.2 37.0 140-144 35.2663 37.0 37.0 37.0 27.4 37.0 145-149 35.2453 37.0 37.0 37.0 32.2 37.0 150-151 34.95 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 1.0 22 2.0 23 2.0 24 2.0 25 7.0 26 11.0 27 17.0 28 29.0 29 44.0 30 50.0 31 71.0 32 106.0 33 147.0 34 200.0 35 485.0 36 2671.0 37 153.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.62814070351759 12.78894472361809 15.678391959798995 35.904522613065325 2 32.42295164119268 12.077173640691557 33.47531946880481 22.02455524931095 3 28.475 19.425 23.799999999999997 28.299999999999997 4 28.775000000000002 24.224999999999998 20.775 26.224999999999998 5 27.35 29.45 23.150000000000002 20.05 6 19.925 33.375 25.3 21.4 7 15.5 30.925000000000004 36.15 17.424999999999997 8 17.65 26.625 33.074999999999996 22.650000000000002 9 17.925 22.525000000000002 35.375 24.175 10-14 19.265 30.84 27.05 22.845 15-19 19.74 29.395 28.110000000000003 22.755 20-24 19.869999999999997 29.785 27.450000000000003 22.895 25-29 20.095 29.599999999999998 27.439999999999998 22.865 30-34 19.415 29.825000000000003 28.04 22.720000000000002 35-39 20.47 30.104999999999997 26.88 22.545 40-44 19.78 29.439999999999998 27.3 23.48 45-49 20.66 29.075 27.42 22.845 50-54 20.349999999999998 29.575000000000003 27.13 22.945 55-59 20.51 29.659999999999997 26.77 23.06 60-64 20.385 29.265 27.084999999999997 23.265 65-69 20.560000000000002 29.365000000000002 27.355 22.720000000000002 70-74 20.535 29.054999999999996 27.32 23.09 75-79 20.69 28.720000000000002 26.85 23.74 80-84 20.835 27.685 27.834999999999997 23.645 85-89 20.06 29.304999999999996 27.505000000000003 23.13 90-94 20.965 28.694999999999997 26.650000000000002 23.69 95-99 20.630000000000003 28.92 27.195000000000004 23.255 100-104 20.39 28.775000000000002 28.01 22.825 105-109 20.445 29.195 27.229999999999997 23.13 110-114 20.865000000000002 28.74 26.66 23.735 115-119 19.985 28.54 27.79 23.685000000000002 120-124 20.91 28.605000000000004 26.96 23.525 125-129 20.69 28.405 27.715 23.189999999999998 130-134 21.044999999999998 28.63 26.995 23.330000000000002 135-139 20.76 29.075 26.334999999999997 23.830000000000002 140-144 20.73 28.965000000000003 26.875 23.43 145-149 21.355 29.195 26.179999999999996 23.27 150-151 21.575 29.4125 25.2 23.8125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 2.0 20 2.5 21 2.0 22 3.0 23 3.5 24 3.5 25 3.5 26 7.5 27 12.0 28 16.5 29 23.0 30 35.0 31 45.0 32 48.0 33 53.5 34 66.5 35 91.5 36 114.5 37 118.0 38 126.0 39 153.5 40 178.5 41 211.5 42 219.0 43 225.0 44 234.0 45 231.5 46 261.5 47 259.0 48 223.0 49 191.5 50 154.5 51 132.0 52 111.0 53 88.5 54 72.5 55 53.0 56 40.5 57 28.0 58 23.5 59 28.0 60 18.5 61 11.5 62 14.0 63 12.0 64 9.0 65 4.5 66 3.5 67 5.0 68 5.0 69 4.0 70 3.5 71 3.5 72 3.0 73 1.5 74 0.5 75 0.5 76 0.5 77 0.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.22499999999999998 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.55 #Duplication Level Percentage of deduplicated Percentage of total 1 93.47942276857295 87.45 2 6.146445750935329 11.5 3 0.3741314804917157 1.05 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.1875 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.3625 0.0 0.0 0.0 0.0 114-115 0.425 0.0 0.0 0.0 0.0 116-117 0.45 0.0 0.0 0.0 0.0 118-119 0.55 0.0 0.0 0.0 0.0 120-121 0.7250000000000001 0.0 0.0 0.0 0.0 122-123 1.0125 0.0 0.0 0.0 0.0 124-125 1.225 0.0 0.0 0.0 0.0 126-127 1.5375 0.0 0.0 0.0 0.0 128-129 1.9249999999999998 0.0 0.0 0.0 0.0 130-131 2.2875 0.0 0.0 0.0 0.0 132-133 2.925 0.0 0.0 0.0 0.0 134-135 3.3875 0.0 0.0 0.0 0.0 136-137 3.9625000000000004 0.0 0.0 0.0 0.0 138-139 4.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATTTG 10 0.006830828 145.0 9 GGCCATT 10 0.006830828 145.0 2 GCCATTC 10 0.006830828 145.0 3 TACAACA 20 0.00593511 29.0 95-99 >>END_MODULE SRR22215345 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215345_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.7595 37.0 37.0 37.0 37.0 37.0 2 36.013 37.0 37.0 37.0 37.0 37.0 3 36.0675 37.0 37.0 37.0 37.0 37.0 4 36.0495 37.0 37.0 37.0 37.0 37.0 5 35.9805 37.0 37.0 37.0 37.0 37.0 6 36.114 37.0 37.0 37.0 37.0 37.0 7 36.0525 37.0 37.0 37.0 37.0 37.0 8 36.037 37.0 37.0 37.0 37.0 37.0 9 36.006 37.0 37.0 37.0 37.0 37.0 10-14 36.0659 37.0 37.0 37.0 37.0 37.0 15-19 36.0339 37.0 37.0 37.0 37.0 37.0 20-24 36.03660000000001 37.0 37.0 37.0 37.0 37.0 25-29 35.964200000000005 37.0 37.0 37.0 37.0 37.0 30-34 35.8945 37.0 37.0 37.0 37.0 37.0 35-39 35.8594 37.0 37.0 37.0 37.0 37.0 40-44 35.8229 37.0 37.0 37.0 37.0 37.0 45-49 35.818 37.0 37.0 37.0 37.0 37.0 50-54 35.8165 37.0 37.0 37.0 37.0 37.0 55-59 35.727 37.0 37.0 37.0 37.0 37.0 60-64 35.693400000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.675200000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.634100000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.6217 37.0 37.0 37.0 37.0 37.0 80-84 35.5598 37.0 37.0 37.0 37.0 37.0 85-89 35.552800000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.5031 37.0 37.0 37.0 37.0 37.0 95-99 35.4423 37.0 37.0 37.0 37.0 37.0 100-104 35.4693 37.0 37.0 37.0 37.0 37.0 105-109 35.37330000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.3509 37.0 37.0 37.0 32.2 37.0 115-119 35.3524 37.0 37.0 37.0 32.2 37.0 120-124 35.2089 37.0 37.0 37.0 29.8 37.0 125-129 35.1275 37.0 37.0 37.0 25.0 37.0 130-134 35.21040000000001 37.0 37.0 37.0 29.8 37.0 135-139 35.1416 37.0 37.0 37.0 27.4 37.0 140-144 35.000800000000005 37.0 37.0 37.0 25.0 37.0 145-149 34.892999999999994 37.0 37.0 37.0 25.0 37.0 150-151 34.86 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 1.0 21 3.0 22 4.0 23 8.0 24 18.0 25 17.0 26 23.0 27 13.0 28 25.0 29 29.0 30 37.0 31 60.0 32 109.0 33 129.0 34 228.0 35 744.0 36 2344.0 37 206.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.25 23.7 16.950000000000003 30.099999999999998 2 27.750000000000004 29.525000000000002 28.599999999999998 14.124999999999998 3 23.0 29.4 30.375000000000004 17.224999999999998 4 24.224999999999998 36.175000000000004 23.25 16.35 5 25.624999999999996 35.55 22.675 16.150000000000002 6 20.25 39.425 24.025 16.3 7 20.150000000000002 19.15 41.5 19.2 8 21.9 24.875 29.575000000000003 23.65 9 22.675 23.05 30.475 23.799999999999997 10-14 24.205 28.799999999999997 26.355 20.64 15-19 24.355 27.87 27.74 20.035 20-24 24.044999999999998 28.189999999999998 27.105 20.66 25-29 24.345 28.01 27.38 20.265 30-34 23.44 28.199999999999996 28.075 20.285 35-39 24.05 27.860000000000003 27.765 20.325 40-44 23.935000000000002 27.555000000000003 28.22 20.29 45-49 23.78 27.57 28.03 20.62 50-54 23.625 28.255000000000003 28.225 19.895 55-59 23.47 27.834999999999997 28.355000000000004 20.34 60-64 23.799999999999997 27.63 27.994999999999997 20.575 65-69 23.215 27.405 28.825 20.555 70-74 23.189999999999998 27.96 28.345 20.505000000000003 75-79 23.330000000000002 27.88 28.53 20.26 80-84 23.645 28.044999999999998 28.155 20.155 85-89 23.97 27.534999999999997 27.950000000000003 20.544999999999998 90-94 23.400000000000002 27.634999999999998 28.74 20.225 95-99 23.155 27.79 28.749999999999996 20.305 100-104 23.74 27.485 28.505000000000003 20.27 105-109 23.62 26.85 28.945 20.585 110-114 23.69 27.810000000000002 29.03 19.470000000000002 115-119 23.225 27.49 28.849999999999998 20.435 120-124 23.45 28.060000000000002 28.685 19.805 125-129 23.015 27.639999999999997 28.694999999999997 20.65 130-134 24.3 28.18 27.589999999999996 19.93 135-139 23.285 27.865000000000002 28.26 20.59 140-144 24.91 27.544999999999998 28.16 19.384999999999998 145-149 24.310000000000002 28.59 27.744999999999997 19.355 150-151 25.85 28.075 27.212500000000002 18.862499999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 1.0 5 1.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 2.0 18 2.0 19 0.5 20 1.0 21 1.5 22 1.5 23 1.0 24 2.0 25 3.0 26 4.5 27 8.5 28 14.5 29 20.5 30 18.0 31 24.5 32 35.5 33 45.5 34 59.0 35 68.5 36 100.5 37 133.5 38 146.0 39 158.0 40 188.5 41 214.5 42 244.0 43 272.0 44 255.5 45 255.5 46 266.0 47 236.0 48 201.0 49 183.5 50 164.5 51 134.5 52 112.5 53 99.0 54 76.0 55 53.5 56 35.0 57 23.0 58 27.0 59 22.0 60 11.5 61 11.0 62 8.0 63 6.0 64 5.5 65 5.0 66 3.5 67 1.0 68 1.5 69 2.0 70 2.0 71 2.0 72 2.5 73 2.0 74 0.5 75 0.5 76 0.5 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 1.0 83 1.0 84 0.0 85 0.5 86 1.5 87 1.5 88 1.0 89 0.5 90 0.5 91 1.0 92 0.5 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 93.62836576912824 87.8 2 6.105038656358305 11.450000000000001 3 0.2665955745134631 0.75 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.2125 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.2625 0.0 0.0 0.0 0.0 112-113 0.3875 0.0 0.0 0.0 0.0 114-115 0.45 0.0 0.0 0.0 0.0 116-117 0.475 0.0 0.0 0.0 0.0 118-119 0.575 0.0 0.0 0.0 0.0 120-121 0.75 0.0 0.0 0.0 0.0 122-123 1.0375 0.0 0.0 0.0 0.0 124-125 1.2375 0.0 0.0 0.0 0.0 126-127 1.5375 0.0 0.0 0.0 0.0 128-129 1.9249999999999998 0.0 0.0 0.0 0.0 130-131 2.2875 0.0 0.0 0.0 0.0 132-133 2.95 0.0 0.0 0.0 0.0 134-135 3.4375 0.0 0.0 0.0 0.0 136-137 4.0125 0.0 0.0 0.0 0.0 138-139 4.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACTGGT 10 0.006830828 145.0 5 CTGGTCT 10 0.006830828 145.0 7 ATGTTTG 10 0.006830828 145.0 2 TTAACTG 10 0.006830828 145.0 3 TTTAACT 10 0.006830828 145.0 2 ATTTAAC 10 0.006830828 145.0 1 >>END_MODULE Read 1959554 spots for SRR22215345.sra Written 1959554 spots for SRR22215345.sra Read 1959554 spots for SRR22215345.sra Written 1959554 spots for SRR22215345.sra Read 1959554 spots for SRR22215345.sra Written 1959554 spots for SRR22215345.sra Read 1959554 spots for SRR22215345.sra Written 1959554 spots for SRR22215345.sra Read 1959554 spots for SRR22215345.sra Written 1959554 spots for SRR22215345.sra Read 1959554 spots for SRR22215345.sra Written 1959554 spots for SRR22215345.sra Read 1959554 spots for SRR22215345.sra Written 1959554 spots for SRR22215345.sra Read 1959554 spots for SRR22215345.sra Written 1959554 spots for SRR22215345.sra Read 1959554 spots for SRR22215345.sra Written 1959554 spots for SRR22215345.sra Read 1959554 spots for SRR22215345.sra Written 1959554 spots for SRR22215345.sra Read 1959554 spots for SRR22215345.sra Written 1959554 spots for SRR22215345.sra Read 1959562 spots for SRR22215345.sra Written 1959562 spots for SRR22215345.sra Read 1959554 spots for SRR22215345.sra Written 1959554 spots for SRR22215345.sra Read 1959554 spots for SRR22215345.sra Written 1959554 spots for SRR22215345.sra Read 1959554 spots for SRR22215345.sra Written 1959554 spots for SRR22215345.sra Read 1959554 spots for SRR22215345.sra Written 1959554 spots for SRR22215345.sra Read 1959554 spots for SRR22215345.sra Written 1959554 spots for SRR22215345.sra Read 1959554 spots for SRR22215345.sra Written 1959554 spots for SRR22215345.sra Read 1959554 spots for SRR22215345.sra Written 1959554 spots for SRR22215345.sra Read 1959554 spots for SRR22215345.sra Written 1959554 spots for SRR22215345.sra SRR ids: ['SRR22215345.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c7vm9x9a SRR22215345.sra spots: 39191088 blocks: [[1, 1959554], [1959555, 3919108], [3919109, 5878662], [5878663, 7838216], [7838217, 9797770], [9797771, 11757324], [11757325, 13716878], [13716879, 15676432], [15676433, 17635986], [17635987, 19595540], [19595541, 21555094], [21555095, 23514648], [23514649, 25474202], [25474203, 27433756], [27433757, 29393310], [29393311, 31352864], [31352865, 33312418], [33312419, 35271972], [35271973, 37231526], [37231527, 39191088]] SRR22215345 file size 13297145 SRR22215345 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22215345 SRR22215345_1.fastq SRR22215345_2.fastq Input file: SRR22215345_1.fastq Paired file: SRR22215345_2.fastq trimmed: SRR22215345-trimmed-pair1.fastq, SRR22215345-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:36:32 2025 >> started Tue Feb 11 09:37:21 2025 >> done (49.598s) 39191088 read pairs processed; of these: 120 ( 0.00%) short read pairs filtered out after trimming by size control 56673 ( 0.14%) empty read pairs filtered out after trimming by size control 39134295 (99.86%) read pairs available; of these: 5064352 (12.94%) trimmed read pairs available after processing 34069943 (87.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 4 0.00% 21 2 0.00% 22 2 0.00% 23 5 0.00% 24 1 0.00% 25 3 0.00% 26 5 0.00% 27 7 0.00% 28 4 0.00% 29 7 0.00% 30 5 0.00% 31 6 0.00% 32 10 0.00% 33 6 0.00% 34 7 0.00% 35 8 0.00% 36 5 0.00% 37 6 0.00% 38 10 0.00% 39 9 0.00% 40 9 0.00% 41 10 0.00% 42 9 0.00% 43 13 0.00% 44 13 0.00% 45 16 0.00% 46 18 0.00% 47 17 0.00% 48 22 0.00% 49 28 0.00% 50 21 0.00% 51 23 0.00% 52 18 0.00% 53 22 0.00% 54 26 0.00% 55 27 0.00% 56 41 0.00% 57 42 0.00% 58 55 0.00% 59 40 0.00% 60 47 0.00% 61 46 0.00% 62 51 0.00% 63 79 0.00% 64 60 0.00% 65 76 0.00% 66 93 0.00% 67 83 0.00% 68 114 0.00% 69 117 0.00% 70 125 0.00% 71 160 0.00% 72 161 0.00% 73 197 0.00% 74 223 0.00% 75 210 0.00% 76 301 0.00% 77 301 0.00% 78 336 0.00% 79 386 0.00% 80 413 0.00% 81 478 0.00% 82 551 0.00% 83 620 0.00% 84 656 0.00% 85 745 0.00% 86 885 0.00% 87 923 0.00% 88 1027 0.00% 89 1170 0.00% 90 1312 0.00% 91 1448 0.00% 92 1566 0.00% 93 1778 0.00% 94 1884 0.00% 95 2253 0.01% 96 2421 0.01% 97 2716 0.01% 98 3151 0.01% 99 3351 0.01% 100 3819 0.01% 101 3892 0.01% 102 4414 0.01% 103 4893 0.01% 104 5441 0.01% 105 6005 0.02% 106 6857 0.02% 107 7617 0.02% 108 8360 0.02% 109 9305 0.02% 110 10311 0.03% 111 11779 0.03% 112 13038 0.03% 113 14387 0.04% 114 16312 0.04% 115 18723 0.05% 116 20931 0.05% 117 23920 0.06% 118 27273 0.07% 119 30577 0.08% 120 34155 0.09% 121 38394 0.10% 122 43241 0.11% 123 47496 0.12% 124 53317 0.14% 125 59052 0.15% 126 65271 0.17% 127 73461 0.19% 128 81851 0.21% 129 90309 0.23% 130 99630 0.25% 131 108469 0.28% 132 116029 0.30% 133 125254 0.32% 134 134185 0.34% 135 142884 0.37% 136 155750 0.40% 137 166734 0.43% 138 177779 0.45% 139 190680 0.49% 140 202716 0.52% 141 214377 0.55% 142 224417 0.57% 143 233798 0.60% 144 241799 0.62% 145 251708 0.64% 146 258412 0.66% 147 269351 0.69% 148 282643 0.72% 149 292106 0.75% 150 308126 0.79% 151 34069943 87.06% 39134295 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.67 fanout-score-rank=42 prefix-density=0.24 prefix-fanout=2.5 sequence=CTCCACACTTGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=320.03 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=16.2 sequence=TCCAGCAATAGATACAAACCATGGCAATTAACTAGAGCAGAACATCATTTCACAAGGTTTATAAGGAAAGAGACCTCCTTGACTTGGACAAACACTCGTCTATAAGAAACACCCAAATTTCCAACTATTCGGCTGTTTATTTCATTAATAACTGGAGAGCAGGAGATGCCAGTGCCTCAGACAAACTGATCAAGGTACTCTTCCACGGTGGTATATTTGACATCTGGATATAGCTCAGAGGCCTCAAGCCCCCATGATGGGTCAATCTCAAAGTTGGTCATGTCACCATTAACGAGGGCTGAGTGGTTGATTGACAGAACAATATTAATCGGAATCGGAGACTCTTGGATGTCCTTCAGAAGTTTCTCTTCAGGAACAAAGGTTTTTTCGAGGGTTTTGCCAATCTTTTTCTCCCATAGATCAATAAGCTCATTGAATGAGTAGGTGTTTTTAGGAGGCTTGATTAGGACAGTCTTGTTCAAGGTTCTTGCATCATCCACAGCTTTGATGG criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=4.13 fanout-score-rank=25 prefix-density=0.18 prefix-fanout=3.2 sequence=TGGCTCCTTGTGCATCAGCAGCACAGGATGAGAATTCTTCAGTTTCGAGCCAGTGCTGCGCTCGGGTGAAGAAAATTGGACAGAACCCAGCGTGCCTTTGTGCTGTTATGCTTTCCAACACTGCTAAGAGCTCTGGAATCAAGCCAGAAATTGCAATGACCATTCCCAAACGATGCAACATTGCTGATCGTCCTGTGGGCTACAAGTGTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=74.28 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=6.0 sequence=TCTTCTCTCTGTCTTCTTGATTCCTTGTTTTTCGTTCTGTTTATTACAGCAGCAATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGAAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCCGCAAAGCCTGCAGAAACCGTGGCTGCTGCATAATGTTTATAATACCAATATTTACTATGTGAAACTGTGTTCTACTGGGTTATAGTTAGTTGGGCTTTCTATGATCATGATGTGGATTCTGGATATCCAGCATGCTTTTACTGGGATGTAAGCTATAATAATTTCTCTGGTACATTCATATGGTTATCTGTATTATCATTATT SRR22215345 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:38:24 Started mapping on | Feb 11 09:38:24 Finished on | Feb 11 09:42:50 Mapping speed, Million of reads per hour | 529.64 Number of input reads | 39134295 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 37151287 Uniquely mapped reads % | 94.93% Average mapped length | 297.47 Number of splices: Total | 29119507 Number of splices: Annotated (sjdb) | 28505966 Number of splices: GT/AG | 28676783 Number of splices: GC/AG | 347470 Number of splices: AT/AC | 35455 Number of splices: Non-canonical | 59799 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.24 Insertion rate per base | 0.02% Insertion average length | 1.95 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 748588 % of reads mapped to multiple loci | 1.91% Number of reads mapped to too many loci | 339913 % of reads mapped to too many loci | 0.87% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.00% % of reads unmapped: other | 0.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1234420 1234420 1234420 N_multimapping 748588 748588 748588 N_noFeature 1389617 36638527 1575213 N_ambiguous 486287 2119 157929 UnstrandedReadsAssigned:35275383 PositiveStrandReadsAssigned:510641 NegativeStrandReadsAssigned:35418145 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR22215345 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22215345-trimmed-pair1.fastq SRR22215345-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 39,134,295 reads, 36,054,077 reads pseudoaligned [quant] estimated average fragment length: 188.893 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,177 rounds 52401 SRR22215345.ke.tsv 34699 SRR22215345.se.tsv 87100 total ==> SRR22215345.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1830.11 2787 42.3008 Potri.005G024800.1.v4.1 1035 847.107 525 17.2151 Potri.004G059700.1.v4.1 961 773.107 115 4.13187 Potri.007G009000.2.v4.1 1416 1228.11 0 0 Potri.003G141000.2.v4.1 2943 2755.11 745.77 7.51891 Potri.016G087400.1.v4.1 270 86.1589 1861 599.977 Potri.015G069301.1.v4.1 564 376.144 0 0 Potri.010G195200.1.v4.1 1773 1585.11 123 2.15543 Potri.012G127500.1.v4.1 977 789.107 6625 233.205 ==> SRR22215345.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2695 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 901 Potri.001G212900.v4.1 16 Potri.001G182400.v4.1 152 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR22215345 completed mapping pipeline successfully