Starting /dee2/code/volunteer_pipeline.sh SRR22215346 current disk space = 3054948012032 free memory = 1159068172 SRR22215346 SRAfilesize 554bd129b784748fdbd36049ccca7eb0 SRR22215346.sra SRR22215346.sra file validated SRR22215346 is paired end SRR22215346 is conventional basespace SRR22215346 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215346_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9575 37.0 37.0 37.0 37.0 37.0 2 36.0185 37.0 37.0 37.0 37.0 37.0 3 36.34 37.0 37.0 37.0 37.0 37.0 4 36.294 37.0 37.0 37.0 37.0 37.0 5 36.3315 37.0 37.0 37.0 37.0 37.0 6 36.2635 37.0 37.0 37.0 37.0 37.0 7 36.293 37.0 37.0 37.0 37.0 37.0 8 36.26 37.0 37.0 37.0 37.0 37.0 9 36.284 37.0 37.0 37.0 37.0 37.0 10-14 36.303399999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.2211 37.0 37.0 37.0 37.0 37.0 20-24 36.2288 37.0 37.0 37.0 37.0 37.0 25-29 36.055099999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.0156 37.0 37.0 37.0 37.0 37.0 35-39 35.9364 37.0 37.0 37.0 37.0 37.0 40-44 35.87050000000001 37.0 37.0 37.0 37.0 37.0 45-49 35.6656 37.0 37.0 37.0 37.0 37.0 50-54 35.557900000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.549699999999994 37.0 37.0 37.0 37.0 37.0 60-64 35.513999999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.4243 37.0 37.0 37.0 37.0 37.0 70-74 35.5706 37.0 37.0 37.0 37.0 37.0 75-79 35.6383 37.0 37.0 37.0 37.0 37.0 80-84 35.5947 37.0 37.0 37.0 37.0 37.0 85-89 35.618700000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.5009 37.0 37.0 37.0 37.0 37.0 95-99 35.4938 37.0 37.0 37.0 37.0 37.0 100-104 35.511 37.0 37.0 37.0 37.0 37.0 105-109 35.432900000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.429500000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.4014 37.0 37.0 37.0 37.0 37.0 120-124 35.3507 37.0 37.0 37.0 37.0 37.0 125-129 35.252599999999994 37.0 37.0 37.0 32.2 37.0 130-134 35.204899999999995 37.0 37.0 37.0 29.8 37.0 135-139 35.215500000000006 37.0 37.0 37.0 32.2 37.0 140-144 35.0856 37.0 37.0 37.0 29.8 37.0 145-149 35.0841 37.0 37.0 37.0 27.4 37.0 150-151 34.76049999999999 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 3.0 23 5.0 24 9.0 25 15.0 26 18.0 27 14.0 28 36.0 29 53.0 30 59.0 31 86.0 32 115.0 33 146.0 34 175.0 35 491.0 36 2606.0 37 167.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.308926780341025 12.211634904714144 18.254764292878637 33.224674022066196 2 28.32080200501253 14.912280701754385 32.68170426065163 24.085213032581454 3 25.1 21.7 26.025 27.175 4 26.525 26.650000000000002 22.05 24.775 5 25.874999999999996 30.9 22.650000000000002 20.575 6 18.8 33.7 25.074999999999996 22.425 7 13.725000000000001 31.374999999999996 37.3 17.599999999999998 8 15.950000000000001 27.925 30.525000000000002 25.6 9 18.375 24.55 31.874999999999996 25.2 10-14 18.075 32.269999999999996 27.13 22.525000000000002 15-19 18.43 30.025000000000002 28.044999999999998 23.5 20-24 18.7 30.53 27.87 22.900000000000002 25-29 18.765 30.580000000000002 27.57 23.085 30-34 18.215 30.525000000000002 28.09 23.169999999999998 35-39 18.725 30.314999999999998 27.565 23.395 40-44 18.205 30.709999999999997 28.03 23.055 45-49 19.21 29.294999999999998 27.965 23.53 50-54 19.515 29.92 26.6 23.965 55-59 19.64 30.17 27.025 23.165 60-64 19.955000000000002 29.74 26.935 23.369999999999997 65-69 19.695 30.014999999999997 27.189999999999998 23.1 70-74 20.57 28.355000000000004 27.58 23.494999999999997 75-79 20.145 29.349999999999998 27.189999999999998 23.315 80-84 20.805 28.970000000000002 26.845000000000002 23.380000000000003 85-89 20.52 29.439999999999998 26.705000000000002 23.335 90-94 20.355 29.37 26.825 23.45 95-99 20.415 28.854999999999997 27.245 23.485 100-104 20.45 28.694999999999997 27.18 23.674999999999997 105-109 20.53 28.810000000000002 27.255000000000003 23.405 110-114 20.28 28.895 27.355 23.47 115-119 20.51 28.98 27.245 23.265 120-124 20.59 28.07 27.38 23.96 125-129 20.555 28.46 27.455000000000002 23.53 130-134 21.895 27.810000000000002 27.060000000000002 23.235 135-139 21.825 29.365000000000002 26.115 22.695 140-144 21.305 28.7 26.185000000000002 23.810000000000002 145-149 21.46 29.04 26.135 23.365 150-151 21.6625 28.849999999999998 25.9625 23.525 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 3.0 1 2.5 2 1.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 1.0 18 1.5 19 1.5 20 2.0 21 2.0 22 3.5 23 6.0 24 8.0 25 9.5 26 10.5 27 22.0 28 29.0 29 33.0 30 43.0 31 54.5 32 64.5 33 81.0 34 108.5 35 113.0 36 125.5 37 147.0 38 150.5 39 165.5 40 188.0 41 195.0 42 207.5 43 219.5 44 221.5 45 220.5 46 203.5 47 199.0 48 182.5 49 149.0 50 131.5 51 119.5 52 106.0 53 79.5 54 57.5 55 49.0 56 39.5 57 34.5 58 33.0 59 25.0 60 21.5 61 17.0 62 10.0 63 8.5 64 7.5 65 5.5 66 6.0 67 5.0 68 4.5 69 5.5 70 5.0 71 8.0 72 10.0 73 13.0 74 10.5 75 3.5 76 2.0 77 2.0 78 1.0 79 0.5 80 0.0 81 0.5 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.25 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.55 #Duplication Level Percentage of deduplicated Percentage of total 1 91.64391043145822 83.89999999999999 2 7.755324959038777 14.2 3 0.4642271982523211 1.275 4 0.05461496450027307 0.2 5 0.027307482250136534 0.125 6 0.05461496450027307 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 6 0.15 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGGTTGG 6 0.15 TruSeq Adapter, Index 4 (97% over 45bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCGCGGTTGG 5 0.125 TruSeq Adapter, Index 4 (97% over 45bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1125 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.21250000000000002 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.4125 0.0 0.0 0.0 0.0 118-119 0.5375 0.0 0.0 0.0 0.0 120-121 0.725 0.0 0.0 0.0 0.0 122-123 0.8875 0.0 0.0 0.0 0.0 124-125 1.1375 0.0 0.0 0.0 0.0 126-127 1.5750000000000002 0.0 0.0 0.0 0.0 128-129 1.8875 0.0 0.0 0.0 0.0 130-131 2.25 0.0 0.0 0.0 0.0 132-133 2.6375 0.0 0.0 0.0 0.0 134-135 3.15 0.0 0.0 0.0 0.0 136-137 3.8499999999999996 0.0 0.0 0.0 0.0 138-139 4.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR22215346 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215346_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.5725 37.0 37.0 37.0 37.0 37.0 2 36.0955 37.0 37.0 37.0 37.0 37.0 3 36.086 37.0 37.0 37.0 37.0 37.0 4 35.9115 37.0 37.0 37.0 37.0 37.0 5 35.9325 37.0 37.0 37.0 37.0 37.0 6 35.974 37.0 37.0 37.0 37.0 37.0 7 36.0025 37.0 37.0 37.0 37.0 37.0 8 35.982 37.0 37.0 37.0 37.0 37.0 9 35.9685 37.0 37.0 37.0 37.0 37.0 10-14 35.91760000000001 37.0 37.0 37.0 37.0 37.0 15-19 35.892700000000005 37.0 37.0 37.0 37.0 37.0 20-24 35.8932 37.0 37.0 37.0 37.0 37.0 25-29 35.7199 37.0 37.0 37.0 37.0 37.0 30-34 35.6677 37.0 37.0 37.0 37.0 37.0 35-39 35.6458 37.0 37.0 37.0 37.0 37.0 40-44 35.6341 37.0 37.0 37.0 37.0 37.0 45-49 35.54430000000001 37.0 37.0 37.0 37.0 37.0 50-54 35.537600000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.4544 37.0 37.0 37.0 37.0 37.0 60-64 35.4478 37.0 37.0 37.0 37.0 37.0 65-69 35.39829999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.37650000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.381699999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.3553 37.0 37.0 37.0 34.6 37.0 85-89 35.472300000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.411699999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.407 37.0 37.0 37.0 37.0 37.0 100-104 35.334900000000005 37.0 37.0 37.0 34.6 37.0 105-109 35.3262 37.0 37.0 37.0 37.0 37.0 110-114 35.2316 37.0 37.0 37.0 29.8 37.0 115-119 35.2512 37.0 37.0 37.0 29.8 37.0 120-124 35.1892 37.0 37.0 37.0 27.4 37.0 125-129 35.1676 37.0 37.0 37.0 25.0 37.0 130-134 35.0726 37.0 37.0 37.0 25.0 37.0 135-139 35.0346 37.0 37.0 37.0 25.0 37.0 140-144 34.9162 37.0 37.0 37.0 25.0 37.0 145-149 34.8292 37.0 37.0 37.0 25.0 37.0 150-151 34.8135 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 2.0 17 2.0 18 2.0 19 6.0 20 3.0 21 2.0 22 12.0 23 10.0 24 26.0 25 20.0 26 23.0 27 23.0 28 19.0 29 41.0 30 52.0 31 55.0 32 83.0 33 133.0 34 227.0 35 746.0 36 2328.0 37 183.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.75 21.925 15.725 26.6 2 29.099999999999998 29.625 27.950000000000003 13.325000000000001 3 26.575 30.099999999999998 27.075 16.25 4 27.825 34.175 21.25 16.75 5 30.15 34.625 21.45 13.775 6 21.45 39.425 23.525 15.6 7 21.475 20.674999999999997 40.575 17.275 8 24.15 23.825 29.15 22.875 9 26.275 24.3 28.175 21.25 10-14 25.69 28.95 26.02 19.34 15-19 25.369999999999997 28.09 27.21 19.33 20-24 25.490000000000002 28.015 27.084999999999997 19.41 25-29 25.264999999999997 28.15 27.32 19.265 30-34 24.884999999999998 28.125 27.650000000000002 19.34 35-39 25.180000000000003 28.525 27.66 18.634999999999998 40-44 25.345000000000002 27.694999999999997 27.51 19.45 45-49 24.575 27.63 28.125 19.67 50-54 24.97 28.835 27.034999999999997 19.16 55-59 24.45 28.315 28.005000000000003 19.23 60-64 24.315 28.52 28.305000000000003 18.86 65-69 24.21 27.72 28.449999999999996 19.62 70-74 24.529999999999998 27.57 28.335 19.564999999999998 75-79 25.25 27.685 28.255000000000003 18.81 80-84 24.775 27.555000000000003 27.985 19.685 85-89 25.165 27.615000000000002 28.455000000000002 18.765 90-94 24.75 28.065 28.199999999999996 18.985 95-99 24.91 27.47 28.48 19.139999999999997 100-104 24.715 26.955000000000002 29.299999999999997 19.03 105-109 24.11 27.905 28.735 19.25 110-114 24.455 27.6 29.044999999999998 18.9 115-119 23.72 27.505000000000003 29.455 19.32 120-124 24.455 27.47 28.99 19.085 125-129 24.58 27.605 28.895 18.92 130-134 24.95 27.634999999999998 28.87 18.545 135-139 25.205 27.655 28.12 19.02 140-144 25.840000000000003 27.474999999999998 28.43 18.255 145-149 25.595000000000002 28.494999999999997 27.715 18.195 150-151 26.0125 27.925 28.512500000000003 17.549999999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.5 12 1.0 13 1.0 14 1.5 15 2.5 16 2.5 17 1.5 18 0.5 19 1.0 20 3.0 21 2.0 22 1.5 23 2.0 24 2.0 25 7.0 26 10.5 27 11.0 28 12.0 29 17.5 30 24.0 31 28.5 32 35.5 33 48.0 34 63.0 35 74.5 36 91.5 37 124.5 38 143.5 39 168.0 40 193.5 41 215.5 42 245.0 43 252.0 44 242.5 45 242.5 46 251.0 47 224.5 48 201.0 49 197.0 50 168.0 51 133.5 52 107.5 53 94.0 54 78.0 55 46.5 56 35.5 57 27.5 58 19.0 59 19.5 60 16.0 61 12.0 62 8.0 63 6.0 64 5.0 65 4.0 66 2.5 67 3.0 68 4.0 69 3.5 70 3.5 71 2.0 72 2.0 73 2.5 74 1.5 75 3.0 76 3.0 77 1.0 78 1.0 79 1.0 80 0.5 81 0.5 82 1.0 83 0.5 84 0.0 85 1.5 86 3.5 87 3.5 88 2.5 89 2.0 90 2.0 91 2.0 92 2.0 93 1.5 94 2.5 95 3.0 96 1.0 97 0.5 98 0.5 99 0.0 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 91.99239956568947 84.725 2 7.627578718783931 14.05 3 0.3528773072747014 0.975 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02714440825190011 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 10 0.25 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1125 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.21250000000000002 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.4375 0.0 0.0 0.0 0.0 118-119 0.55 0.0 0.0 0.0 0.0 120-121 0.7 0.0 0.0 0.0 0.0 122-123 0.875 0.0 0.0 0.0 0.0 124-125 1.1125 0.0 0.0 0.0 0.0 126-127 1.5375 0.0 0.0 0.0 0.0 128-129 1.8375 0.0 0.0 0.0 0.0 130-131 2.175 0.0 0.0 0.0 0.0 132-133 2.575 0.0 0.0 0.0 0.0 134-135 3.1 0.0 0.0 0.0 0.0 136-137 3.825 0.0 0.0 0.0 0.0 138-139 4.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACAAA 10 0.006830828 145.0 5 CAAACAA 10 0.006830828 145.0 4 >>END_MODULE Read 1657875 spots for SRR22215346.sra Written 1657875 spots for SRR22215346.sra Read 1657875 spots for SRR22215346.sra Written 1657875 spots for SRR22215346.sra Read 1657875 spots for SRR22215346.sra Written 1657875 spots for SRR22215346.sra Read 1657875 spots for SRR22215346.sra Written 1657875 spots for SRR22215346.sra Read 1657875 spots for SRR22215346.sra Written 1657875 spots for SRR22215346.sra Read 1657875 spots for SRR22215346.sra Written 1657875 spots for SRR22215346.sra Read 1657875 spots for SRR22215346.sra Written 1657875 spots for SRR22215346.sra Read 1657875 spots for SRR22215346.sra Written 1657875 spots for SRR22215346.sra Read 1657875 spots for SRR22215346.sra Written 1657875 spots for SRR22215346.sra Read 1657875 spots for SRR22215346.sra Written 1657875 spots for SRR22215346.sra Read 1657875 spots for SRR22215346.sra Written 1657875 spots for SRR22215346.sra Read 1657875 spots for SRR22215346.sra Written 1657875 spots for SRR22215346.sra Read 1657875 spots for SRR22215346.sra Written 1657875 spots for SRR22215346.sra Read 1657875 spots for SRR22215346.sra Written 1657875 spots for SRR22215346.sra Read 1657875 spots for SRR22215346.sra Written 1657875 spots for SRR22215346.sra Read 1657875 spots for SRR22215346.sra Written 1657875 spots for SRR22215346.sra Read 1657875 spots for SRR22215346.sra Written 1657875 spots for SRR22215346.sra Read 1657875 spots for SRR22215346.sra Written 1657875 spots for SRR22215346.sra Read 1657875 spots for SRR22215346.sra Written 1657875 spots for SRR22215346.sra Read 1657875 spots for SRR22215346.sra Written 1657875 spots for SRR22215346.sra SRR ids: ['SRR22215346.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_igtjpcus SRR22215346.sra spots: 33157500 blocks: [[1, 1657875], [1657876, 3315750], [3315751, 4973625], [4973626, 6631500], [6631501, 8289375], [8289376, 9947250], [9947251, 11605125], [11605126, 13263000], [13263001, 14920875], [14920876, 16578750], [16578751, 18236625], [18236626, 19894500], [19894501, 21552375], [21552376, 23210250], [23210251, 24868125], [24868126, 26526000], [26526001, 28183875], [28183876, 29841750], [29841751, 31499625], [31499626, 33157500]] SRR22215346 file size 11246668 SRR22215346 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22215346 SRR22215346_1.fastq SRR22215346_2.fastq Input file: SRR22215346_1.fastq Paired file: SRR22215346_2.fastq trimmed: SRR22215346-trimmed-pair1.fastq, SRR22215346-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:29:45 2025 >> started Tue Feb 11 09:30:38 2025 >> done (53.565s) 33157500 read pairs processed; of these: 378 ( 0.00%) short read pairs filtered out after trimming by size control 222132 ( 0.67%) empty read pairs filtered out after trimming by size control 32934990 (99.33%) read pairs available; of these: 3633742 (11.03%) trimmed read pairs available after processing 29301248 (88.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 17 0.00% 20 15 0.00% 21 17 0.00% 22 7 0.00% 23 8 0.00% 24 8 0.00% 25 11 0.00% 26 12 0.00% 27 25 0.00% 28 18 0.00% 29 71 0.00% 30 12 0.00% 31 22 0.00% 32 8 0.00% 33 18 0.00% 34 18 0.00% 35 21 0.00% 36 15 0.00% 37 22 0.00% 38 17 0.00% 39 13 0.00% 40 18 0.00% 41 26 0.00% 42 23 0.00% 43 17 0.00% 44 21 0.00% 45 31 0.00% 46 22 0.00% 47 30 0.00% 48 40 0.00% 49 29 0.00% 50 41 0.00% 51 36 0.00% 52 47 0.00% 53 59 0.00% 54 55 0.00% 55 53 0.00% 56 60 0.00% 57 44 0.00% 58 50 0.00% 59 50 0.00% 60 59 0.00% 61 64 0.00% 62 73 0.00% 63 63 0.00% 64 83 0.00% 65 82 0.00% 66 78 0.00% 67 95 0.00% 68 100 0.00% 69 129 0.00% 70 151 0.00% 71 141 0.00% 72 174 0.00% 73 182 0.00% 74 234 0.00% 75 252 0.00% 76 262 0.00% 77 303 0.00% 78 317 0.00% 79 374 0.00% 80 375 0.00% 81 436 0.00% 82 463 0.00% 83 616 0.00% 84 683 0.00% 85 694 0.00% 86 775 0.00% 87 950 0.00% 88 1038 0.00% 89 1167 0.00% 90 1244 0.00% 91 1386 0.00% 92 1523 0.00% 93 1653 0.01% 94 1906 0.01% 95 2078 0.01% 96 2254 0.01% 97 2462 0.01% 98 2780 0.01% 99 2968 0.01% 100 3226 0.01% 101 3434 0.01% 102 3796 0.01% 103 4358 0.01% 104 4665 0.01% 105 5082 0.02% 106 5655 0.02% 107 6216 0.02% 108 6954 0.02% 109 7718 0.02% 110 8077 0.02% 111 8936 0.03% 112 10219 0.03% 113 11590 0.04% 114 12669 0.04% 115 14577 0.04% 116 16240 0.05% 117 18190 0.06% 118 20423 0.06% 119 22540 0.07% 120 24991 0.08% 121 27772 0.08% 122 30939 0.09% 123 33773 0.10% 124 38074 0.12% 125 42897 0.13% 126 47141 0.14% 127 53129 0.16% 128 59038 0.18% 129 63618 0.19% 130 69636 0.21% 131 76031 0.23% 132 80851 0.25% 133 87134 0.26% 134 93776 0.28% 135 101499 0.31% 136 110348 0.34% 137 119028 0.36% 138 128224 0.39% 139 135676 0.41% 140 143680 0.44% 141 150434 0.46% 142 156906 0.48% 143 164091 0.50% 144 171815 0.52% 145 177742 0.54% 146 186266 0.57% 147 194110 0.59% 148 205068 0.62% 149 210541 0.64% 150 223143 0.68% 151 29301248 88.97% 32934990 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.55 fanout-score-rank=36 prefix-density=0.34 prefix-fanout=2.3 sequence=TAGCTGCTCCCGC criterion=fanout-score sequence-density=0.09 sequence-density-rank=20 fanout-score=126.75 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=18.2 sequence=TCATCTTCATCATCA criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=4.88 fanout-score-rank=21 prefix-density=0.29 prefix-fanout=3.4 sequence=ATCCAGAAGGAGTCCAC criterion=fanout-score sequence-density=0.07 sequence-density-rank=27 fanout-score=304.19 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=29.9 sequence=TGATGATGAAGATGA SRR22215346 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:31:25 Started mapping on | Feb 11 09:31:25 Finished on | Feb 11 09:35:07 Mapping speed, Million of reads per hour | 534.08 Number of input reads | 32934990 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 29975171 Uniquely mapped reads % | 91.01% Average mapped length | 297.69 Number of splices: Total | 19176115 Number of splices: Annotated (sjdb) | 18694847 Number of splices: GT/AG | 18852207 Number of splices: GC/AG | 240134 Number of splices: AT/AC | 30004 Number of splices: Non-canonical | 53770 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.25 Insertion rate per base | 0.02% Insertion average length | 1.75 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 752612 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 818713 % of reads mapped to too many loci | 2.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.21% % of reads unmapped: other | 1.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2207207 2207207 2207207 N_multimapping 752612 752612 752612 N_noFeature 1249191 29498053 1418710 N_ambiguous 464245 2323 155505 UnstrandedReadsAssigned:28261735 PositiveStrandReadsAssigned:474795 NegativeStrandReadsAssigned:28400956 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR22215346 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22215346-trimmed-pair1.fastq SRR22215346-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,934,990 reads, 29,409,793 reads pseudoaligned [quant] estimated average fragment length: 193.722 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,276 rounds 52401 SRR22215346.ke.tsv 34699 SRR22215346.se.tsv 87100 total ==> SRR22215346.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1825.28 5026 87.739 Potri.005G024800.1.v4.1 1035 842.278 2136 80.8063 Potri.004G059700.1.v4.1 961 768.278 199 8.25342 Potri.007G009000.2.v4.1 1416 1223.28 0 0 Potri.003G141000.2.v4.1 2943 2750.28 749.146 8.67939 Potri.016G087400.1.v4.1 270 82.373 1528 591.069 Potri.015G069301.1.v4.1 564 371.35 0 0 Potri.010G195200.1.v4.1 1773 1580.28 113 2.27848 Potri.012G127500.1.v4.1 977 784.278 7457 302.966 ==> SRR22215346.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1211 Potri.001G233950.v4.1 5 Potri.001G122700.v4.1 581 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 108 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR22215346 completed mapping pipeline successfully