Starting /dee2/code/volunteer_pipeline.sh SRR22215347 current disk space = 3054414282752 free memory = 1313496104 SRR22215347 SRAfilesize 8476bb6c16814da2c62e32ff1099e35c SRR22215347.sra SRR22215347.sra file validated SRR22215347 is paired end SRR22215347 is conventional basespace SRR22215347 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215347_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.948 37.0 37.0 37.0 37.0 37.0 2 35.9865 37.0 37.0 37.0 37.0 37.0 3 36.1745 37.0 37.0 37.0 37.0 37.0 4 36.2715 37.0 37.0 37.0 37.0 37.0 5 36.271 37.0 37.0 37.0 37.0 37.0 6 36.3485 37.0 37.0 37.0 37.0 37.0 7 36.311 37.0 37.0 37.0 37.0 37.0 8 36.2025 37.0 37.0 37.0 37.0 37.0 9 36.219 37.0 37.0 37.0 37.0 37.0 10-14 36.2637 37.0 37.0 37.0 37.0 37.0 15-19 36.25189999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.1896 37.0 37.0 37.0 37.0 37.0 25-29 36.1333 37.0 37.0 37.0 37.0 37.0 30-34 36.0309 37.0 37.0 37.0 37.0 37.0 35-39 35.9661 37.0 37.0 37.0 37.0 37.0 40-44 35.9411 37.0 37.0 37.0 37.0 37.0 45-49 35.9194 37.0 37.0 37.0 37.0 37.0 50-54 35.8871 37.0 37.0 37.0 37.0 37.0 55-59 35.8842 37.0 37.0 37.0 37.0 37.0 60-64 35.7916 37.0 37.0 37.0 37.0 37.0 65-69 35.8107 37.0 37.0 37.0 37.0 37.0 70-74 35.7923 37.0 37.0 37.0 37.0 37.0 75-79 35.777300000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.76809999999999 37.0 37.0 37.0 37.0 37.0 85-89 35.73180000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.6762 37.0 37.0 37.0 37.0 37.0 95-99 35.6723 37.0 37.0 37.0 37.0 37.0 100-104 35.6375 37.0 37.0 37.0 37.0 37.0 105-109 35.620400000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.5139 37.0 37.0 37.0 37.0 37.0 115-119 35.6048 37.0 37.0 37.0 37.0 37.0 120-124 35.525600000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.4518 37.0 37.0 37.0 37.0 37.0 130-134 35.4157 37.0 37.0 37.0 37.0 37.0 135-139 35.3789 37.0 37.0 37.0 32.2 37.0 140-144 35.259100000000004 37.0 37.0 37.0 32.2 37.0 145-149 35.318799999999996 37.0 37.0 37.0 32.2 37.0 150-151 35.18375 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 3.0 23 4.0 24 6.0 25 3.0 26 10.0 27 17.0 28 30.0 29 33.0 30 60.0 31 79.0 32 94.0 33 126.0 34 181.0 35 479.0 36 2676.0 37 197.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.50276243093923 11.099949773982923 14.716223003515822 34.68106479156203 2 32.121364092276835 13.56569709127382 30.792377131394183 23.520561685055167 3 27.35 20.325 23.400000000000002 28.925 4 30.15 26.474999999999998 19.35 24.025 5 29.2 29.875 21.325 19.6 6 19.325 33.1 25.35 22.225 7 13.55 28.775000000000002 38.550000000000004 19.125 8 16.875 25.424999999999997 33.4 24.3 9 18.15 23.025000000000002 34.4 24.425 10-14 20.05 29.985 27.205000000000002 22.759999999999998 15-19 20.01 29.025000000000002 28.215 22.75 20-24 20.52 29.195 27.615000000000002 22.67 25-29 20.150000000000002 29.085 27.700000000000003 23.064999999999998 30-34 19.695 28.485 28.389999999999997 23.43 35-39 20.61 28.945 27.055 23.39 40-44 20.345 29.195 27.465 22.994999999999997 45-49 20.375 28.155 27.675 23.794999999999998 50-54 19.939999999999998 29.054999999999996 27.560000000000002 23.445 55-59 20.32 28.815 27.665 23.200000000000003 60-64 20.165 28.26 28.075 23.5 65-69 20.375 28.725 27.095000000000002 23.805 70-74 20.06 28.88 27.54 23.52 75-79 20.77 27.855 27.98 23.395 80-84 20.424999999999997 28.444999999999997 27.105 24.025 85-89 20.89 28.305000000000003 27.700000000000003 23.105 90-94 20.5 28.04 27.589999999999996 23.87 95-99 20.39 28.005000000000003 27.87 23.735 100-104 20.79 28.705000000000002 27.095000000000002 23.41 105-109 20.365 28.23 27.52 23.885 110-114 20.294999999999998 28.415000000000003 27.54 23.75 115-119 20.69 29.185 27.084999999999997 23.04 120-124 21.2 28.345 27.36 23.095 125-129 20.595 28.265 28.08 23.06 130-134 21.0 28.825 27.125 23.05 135-139 20.599999999999998 28.49 27.450000000000003 23.46 140-144 21.39 28.405 27.18 23.025000000000002 145-149 21.085 29.07 26.615 23.23 150-151 20.549999999999997 28.5875 27.3 23.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.5 20 1.5 21 1.0 22 2.0 23 4.5 24 3.0 25 2.0 26 3.0 27 6.0 28 8.5 29 13.5 30 18.5 31 25.5 32 39.5 33 47.0 34 58.0 35 79.0 36 88.5 37 101.0 38 128.0 39 156.0 40 177.5 41 213.0 42 248.5 43 259.0 44 261.0 45 255.5 46 257.5 47 253.0 48 232.0 49 209.5 50 181.0 51 138.5 52 109.5 53 93.5 54 75.5 55 57.5 56 40.0 57 33.5 58 31.0 59 21.0 60 13.0 61 10.5 62 5.0 63 2.0 64 2.0 65 4.5 66 4.5 67 3.0 68 2.5 69 4.0 70 4.0 71 3.0 72 3.0 73 1.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.825 #Duplication Level Percentage of deduplicated Percentage of total 1 92.97064368435227 86.3 2 6.4368435227578775 11.95 3 0.4847831941826017 1.35 4 0.10772959870724481 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0125 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.0 0.025 0.0 0.0 0.0 72-73 0.0 0.025 0.0 0.0 0.0 74-75 0.0 0.025 0.0 0.0 0.0 76-77 0.025 0.025 0.0 0.0 0.0 78-79 0.025 0.025 0.0 0.0 0.0 80-81 0.025 0.025 0.0 0.0 0.0 82-83 0.025 0.025 0.0 0.0 0.0 84-85 0.025 0.025 0.0 0.0 0.0 86-87 0.025 0.025 0.0 0.0 0.0 88-89 0.025 0.025 0.0 0.0 0.0 90-91 0.025 0.025 0.0 0.0 0.0 92-93 0.037500000000000006 0.025 0.0 0.0 0.0 94-95 0.05 0.025 0.0 0.0 0.0 96-97 0.05 0.025 0.0 0.0 0.0 98-99 0.05 0.025 0.0 0.0 0.0 100-101 0.05 0.025 0.0 0.0 0.0 102-103 0.05 0.025 0.0 0.0 0.0 104-105 0.1125 0.025 0.0 0.0 0.0 106-107 0.125 0.025 0.0 0.0 0.0 108-109 0.1375 0.025 0.0 0.0 0.0 110-111 0.16249999999999998 0.025 0.0 0.0 0.0 112-113 0.225 0.025 0.0 0.0 0.0 114-115 0.25 0.025 0.0 0.0 0.0 116-117 0.4125 0.025 0.0 0.0 0.0 118-119 0.5 0.025 0.0 0.0 0.0 120-121 0.6625 0.025 0.0 0.0 0.0 122-123 0.85 0.025 0.0 0.0 0.0 124-125 1.0125 0.025 0.0 0.0 0.0 126-127 1.3125 0.025 0.0 0.0 0.0 128-129 1.6375000000000002 0.025 0.0 0.0 0.0 130-131 1.8875000000000002 0.025 0.0 0.0 0.0 132-133 2.325 0.025 0.0 0.0 0.0 134-135 2.6375 0.025 0.0 0.0 0.0 136-137 2.9375 0.025 0.0 0.0 0.0 138-139 3.5374999999999996 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTGAAA 30 0.0017973486 72.5 6 >>END_MODULE SRR22215347 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215347_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9195 37.0 37.0 37.0 37.0 37.0 2 36.2455 37.0 37.0 37.0 37.0 37.0 3 36.251 37.0 37.0 37.0 37.0 37.0 4 36.159 37.0 37.0 37.0 37.0 37.0 5 36.168 37.0 37.0 37.0 37.0 37.0 6 36.2485 37.0 37.0 37.0 37.0 37.0 7 36.2645 37.0 37.0 37.0 37.0 37.0 8 36.2485 37.0 37.0 37.0 37.0 37.0 9 36.2985 37.0 37.0 37.0 37.0 37.0 10-14 36.2398 37.0 37.0 37.0 37.0 37.0 15-19 36.21169999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.1399 37.0 37.0 37.0 37.0 37.0 25-29 36.08990000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.040099999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.0149 37.0 37.0 37.0 37.0 37.0 40-44 35.9695 37.0 37.0 37.0 37.0 37.0 45-49 35.977 37.0 37.0 37.0 37.0 37.0 50-54 35.9077 37.0 37.0 37.0 37.0 37.0 55-59 35.8885 37.0 37.0 37.0 37.0 37.0 60-64 35.874199999999995 37.0 37.0 37.0 37.0 37.0 65-69 35.8052 37.0 37.0 37.0 37.0 37.0 70-74 35.7963 37.0 37.0 37.0 37.0 37.0 75-79 35.7687 37.0 37.0 37.0 37.0 37.0 80-84 35.7383 37.0 37.0 37.0 37.0 37.0 85-89 35.743900000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.69840000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.6755 37.0 37.0 37.0 37.0 37.0 100-104 35.6149 37.0 37.0 37.0 37.0 37.0 105-109 35.65690000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.60510000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.56230000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.4606 37.0 37.0 37.0 37.0 37.0 125-129 35.422000000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.396 37.0 37.0 37.0 37.0 37.0 135-139 35.401599999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.2931 37.0 37.0 37.0 32.2 37.0 145-149 35.214 37.0 37.0 37.0 29.8 37.0 150-151 35.197 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 0.0 21 1.0 22 3.0 23 8.0 24 7.0 25 12.0 26 14.0 27 26.0 28 23.0 29 32.0 30 35.0 31 48.0 32 55.0 33 110.0 34 210.0 35 625.0 36 2538.0 37 250.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.275000000000002 21.725 17.974999999999998 30.025000000000002 2 28.000000000000004 27.925 29.849999999999998 14.224999999999998 3 22.6 31.874999999999996 28.925 16.6 4 24.45 35.5 22.85 17.2 5 26.575 34.875 22.650000000000002 15.9 6 19.45 40.65 24.45 15.45 7 21.0 18.15 41.975 18.875 8 22.225 24.5 28.225 25.05 9 25.825 22.275 28.549999999999997 23.35 10-14 23.995 28.425 26.314999999999998 21.265 15-19 24.065 27.439999999999998 27.905 20.59 20-24 23.745 28.910000000000004 27.48 19.865 25-29 24.01 28.225 27.615000000000002 20.150000000000002 30-34 23.400000000000002 28.494999999999997 27.77 20.335 35-39 23.61 28.444999999999997 28.000000000000004 19.945 40-44 24.285 28.000000000000004 27.544999999999998 20.169999999999998 45-49 23.485 27.67 28.189999999999998 20.655 50-54 23.54 28.110000000000003 27.98 20.369999999999997 55-59 23.65 27.705000000000002 28.205000000000002 20.44 60-64 23.89 27.775 28.23 20.105 65-69 23.95 27.900000000000002 28.000000000000004 20.150000000000002 70-74 23.7 27.96 28.449999999999996 19.89 75-79 24.275 27.785 28.384999999999998 19.555 80-84 24.235 27.455000000000002 28.255000000000003 20.055 85-89 24.365000000000002 27.57 28.095 19.97 90-94 24.490000000000002 27.245 28.22 20.044999999999998 95-99 23.61 28.465 27.82 20.105 100-104 24.185000000000002 27.715 28.035 20.064999999999998 105-109 23.355 27.650000000000002 28.82 20.175 110-114 24.23 27.71 28.050000000000004 20.01 115-119 23.95 27.944999999999997 28.23 19.875 120-124 23.41 27.544999999999998 28.475 20.57 125-129 23.56 28.515 27.97 19.955000000000002 130-134 24.635 27.994999999999997 27.334999999999997 20.035 135-139 24.265 27.49 28.095 20.150000000000002 140-144 24.355 28.02 27.755000000000003 19.869999999999997 145-149 24.959999999999997 27.779999999999998 27.435 19.825 150-151 25.374999999999996 27.875 26.674999999999997 20.075000000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 1.0 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 2.0 23 2.5 24 2.0 25 2.5 26 4.5 27 6.0 28 8.0 29 14.0 30 16.0 31 19.0 32 35.5 33 44.5 34 51.5 35 74.0 36 95.5 37 106.5 38 124.5 39 155.0 40 205.0 41 251.5 42 243.5 43 258.5 44 276.0 45 263.5 46 254.5 47 249.5 48 262.5 49 214.5 50 156.0 51 136.5 52 109.0 53 91.5 54 72.0 55 46.0 56 33.0 57 22.0 58 12.5 59 13.5 60 13.0 61 8.0 62 5.5 63 4.5 64 3.0 65 2.5 66 2.0 67 2.0 68 2.0 69 0.5 70 0.0 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.5 85 1.0 86 1.0 87 1.0 88 1.0 89 0.5 90 0.5 91 0.5 92 0.0 93 0.0 94 0.5 95 2.0 96 1.5 97 1.0 98 1.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.95 #Duplication Level Percentage of deduplicated Percentage of total 1 93.14147391070468 86.575 2 6.239913932221625 11.600000000000001 3 0.5110274341043571 1.425 4 0.10758472296933834 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.1125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.1375 0.0 0.0 0.0 0.0 110-111 0.16249999999999998 0.0 0.0 0.0 0.0 112-113 0.225 0.0 0.0 0.0 0.0 114-115 0.2625 0.0 0.0 0.0 0.0 116-117 0.4375 0.0 0.0 0.0 0.0 118-119 0.525 0.0 0.0 0.0 0.0 120-121 0.6875 0.0 0.0 0.0 0.0 122-123 0.9 0.0 0.0 0.0 0.0 124-125 1.0625 0.0 0.0 0.0 0.0 126-127 1.3625 0.0 0.0 0.0 0.0 128-129 1.6875 0.0 0.0 0.0 0.0 130-131 1.9625 0.0 0.0 0.0 0.0 132-133 2.3875 0.0 0.0 0.0 0.0 134-135 2.7249999999999996 0.0 0.0 0.0 0.0 136-137 3.025 0.0 0.0 0.0 0.0 138-139 3.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCACAT 10 0.006830828 145.0 1 GCTGTGT 10 0.006830828 145.0 8 >>END_MODULE Read 1621148 spots for SRR22215347.sra Written 1621148 spots for SRR22215347.sra Read 1621148 spots for SRR22215347.sra Written 1621148 spots for SRR22215347.sra Read 1621148 spots for SRR22215347.sra Written 1621148 spots for SRR22215347.sra Read 1621148 spots for SRR22215347.sra Written 1621148 spots for SRR22215347.sra Read 1621148 spots for SRR22215347.sra Written 1621148 spots for SRR22215347.sra Read 1621148 spots for SRR22215347.sra Written 1621148 spots for SRR22215347.sra Read 1621148 spots for SRR22215347.sra Written 1621148 spots for SRR22215347.sra Read 1621148 spots for SRR22215347.sra Written 1621148 spots for SRR22215347.sra Read 1621148 spots for SRR22215347.sra Written 1621148 spots for SRR22215347.sra Read 1621148 spots for SRR22215347.sra Written 1621148 spots for SRR22215347.sra Read 1621148 spots for SRR22215347.sra Written 1621148 spots for SRR22215347.sra Read 1621148 spots for SRR22215347.sra Written 1621148 spots for SRR22215347.sra Read 1621148 spots for SRR22215347.sra Written 1621148 spots for SRR22215347.sra Read 1621148 spots for SRR22215347.sra Written 1621148 spots for SRR22215347.sra Read 1621148 spots for SRR22215347.sra Written 1621148 spots for SRR22215347.sra Read 1621163 spots for SRR22215347.sra Written 1621163 spots for SRR22215347.sra Read 1621148 spots for SRR22215347.sra Written 1621148 spots for SRR22215347.sra Read 1621148 spots for SRR22215347.sra Written 1621148 spots for SRR22215347.sra Read 1621148 spots for SRR22215347.sra Written 1621148 spots for SRR22215347.sra Read 1621148 spots for SRR22215347.sra Written 1621148 spots for SRR22215347.sra SRR ids: ['SRR22215347.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4g3dpuje SRR22215347.sra spots: 32422975 blocks: [[1, 1621148], [1621149, 3242296], [3242297, 4863444], [4863445, 6484592], [6484593, 8105740], [8105741, 9726888], [9726889, 11348036], [11348037, 12969184], [12969185, 14590332], [14590333, 16211480], [16211481, 17832628], [17832629, 19453776], [19453777, 21074924], [21074925, 22696072], [22696073, 24317220], [24317221, 25938368], [25938369, 27559516], [27559517, 29180664], [29180665, 30801812], [30801813, 32422975]] SRR22215347 file size 10997045 SRR22215347 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22215347 SRR22215347_1.fastq SRR22215347_2.fastq Input file: SRR22215347_1.fastq Paired file: SRR22215347_2.fastq trimmed: SRR22215347-trimmed-pair1.fastq, SRR22215347-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:46:20 2025 >> started Tue Feb 11 09:47:00 2025 >> done (40.074s) 32422975 read pairs processed; of these: 375 ( 0.00%) short read pairs filtered out after trimming by size control 100512 ( 0.31%) empty read pairs filtered out after trimming by size control 32322088 (99.69%) read pairs available; of these: 2944558 ( 9.11%) trimmed read pairs available after processing 29377530 (90.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 5 0.00% 20 13 0.00% 21 7 0.00% 22 9 0.00% 23 5 0.00% 24 6 0.00% 25 8 0.00% 26 9 0.00% 27 8 0.00% 28 5 0.00% 29 32 0.00% 30 3 0.00% 31 12 0.00% 32 9 0.00% 33 8 0.00% 34 4 0.00% 35 5 0.00% 36 6 0.00% 37 8 0.00% 38 8 0.00% 39 9 0.00% 40 10 0.00% 41 7 0.00% 42 11 0.00% 43 8 0.00% 44 14 0.00% 45 9 0.00% 46 9 0.00% 47 11 0.00% 48 13 0.00% 49 23 0.00% 50 21 0.00% 51 20 0.00% 52 16 0.00% 53 20 0.00% 54 25 0.00% 55 35 0.00% 56 26 0.00% 57 39 0.00% 58 34 0.00% 59 22 0.00% 60 55 0.00% 61 32 0.00% 62 38 0.00% 63 42 0.00% 64 30 0.00% 65 45 0.00% 66 67 0.00% 67 69 0.00% 68 74 0.00% 69 63 0.00% 70 88 0.00% 71 92 0.00% 72 94 0.00% 73 101 0.00% 74 138 0.00% 75 156 0.00% 76 174 0.00% 77 198 0.00% 78 205 0.00% 79 253 0.00% 80 257 0.00% 81 295 0.00% 82 340 0.00% 83 399 0.00% 84 479 0.00% 85 511 0.00% 86 594 0.00% 87 619 0.00% 88 674 0.00% 89 782 0.00% 90 830 0.00% 91 969 0.00% 92 1026 0.00% 93 1186 0.00% 94 1369 0.00% 95 1488 0.00% 96 1573 0.00% 97 1832 0.01% 98 2066 0.01% 99 2169 0.01% 100 2362 0.01% 101 2606 0.01% 102 2835 0.01% 103 3156 0.01% 104 3489 0.01% 105 3782 0.01% 106 4164 0.01% 107 4670 0.01% 108 5071 0.02% 109 5693 0.02% 110 6131 0.02% 111 6872 0.02% 112 7819 0.02% 113 8547 0.03% 114 9568 0.03% 115 10637 0.03% 116 12135 0.04% 117 13493 0.04% 118 15216 0.05% 119 16780 0.05% 120 19051 0.06% 121 21312 0.07% 122 23590 0.07% 123 26186 0.08% 124 29298 0.09% 125 32656 0.10% 126 36114 0.11% 127 40519 0.13% 128 45605 0.14% 129 49631 0.15% 130 54685 0.17% 131 59546 0.18% 132 65000 0.20% 133 70779 0.22% 134 75493 0.23% 135 80985 0.25% 136 87842 0.27% 137 94638 0.29% 138 100450 0.31% 139 109433 0.34% 140 116119 0.36% 141 122717 0.38% 142 130920 0.41% 143 135742 0.42% 144 143462 0.44% 145 148294 0.46% 146 156199 0.48% 147 162900 0.50% 148 170343 0.53% 149 178950 0.55% 150 189039 0.58% 151 29377530 90.89% 32322088 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=3.56 fanout-score-rank=25 prefix-density=0.26 prefix-fanout=2.9 sequence=GAAGCAAAAATGTCCTTAGGAAGTAGCACCTTCTCAATCTTATAAATGGCTAGCTGGTTGTCCGTGTATACCGTGCCAGATAAACTTGTATTGGTAAGTCCTGTGGTTATGTTCACCGAGTTTGGATAACTTGTGACATTAAGTGGTAA criterion=fanout-score sequence-density=0.12 sequence-density-rank=16 fanout-score=79.58 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=15.3 sequence=CCACCACCATGGGCTCCCCAGCCACCATAGGTGTCAATAATGATCTTGCGTCCAGTGAGACCTGCATCACCATGAGGACCACCAATAACAAAACGGCCAGATGGGTTGAGGTGAAAGATAGTTTTCTCATCAAGGTACTTCTCCGGGATAACAGGCTTGATGACATACTCCTTTAGATCAGCGGCAATTTCATCATTTGTGACAGTCTCATCATGCTGAGTAGAGATGAGAACAGTGTGGACACGAACAGGGACCATTGCACCATTGTCATTGAAG criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.67 fanout-score-rank=30 prefix-density=0.19 prefix-fanout=2.6 sequence=GACAAGTCTGAGTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=156.68 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=9.3 sequence=TCTTCTCTCTGTCTTCTTGATTCCTTGTTTTTCGTTCTGTTTATTACAGCAGCAATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGAAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCCGCAAAGCCTGCAGAAACCGTGGCTGCTGCATAATGTTTATAATACCAATATTTACTATGTGAAACTGTGTTCTACTGGGTTATAGTTAGTTGGGCTTTCTATGATCATGATGTGGATTCTGGATATCCAGCATGCTTTTACTGGGATGTAAGCTATAATAATTTCTCTGGTA SRR22215347 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:47:46 Started mapping on | Feb 11 09:47:46 Finished on | Feb 11 09:50:42 Mapping speed, Million of reads per hour | 661.13 Number of input reads | 32322088 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 30927345 Uniquely mapped reads % | 95.68% Average mapped length | 298.62 Number of splices: Total | 26061731 Number of splices: Annotated (sjdb) | 25542368 Number of splices: GT/AG | 25680552 Number of splices: GC/AG | 305958 Number of splices: AT/AC | 28176 Number of splices: Non-canonical | 47045 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.02% Deletion average length | 2.18 Insertion rate per base | 0.02% Insertion average length | 1.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 571709 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 212681 % of reads mapped to too many loci | 0.66% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.63% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 823034 823034 823034 N_multimapping 571709 571709 571709 N_noFeature 1121683 30530472 1266489 N_ambiguous 388890 1533 135871 UnstrandedReadsAssigned:29416772 PositiveStrandReadsAssigned:395340 NegativeStrandReadsAssigned:29524985 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR22215347 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22215347-trimmed-pair1.fastq SRR22215347-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,322,088 reads, 29,972,898 reads pseudoaligned [quant] estimated average fragment length: 197.527 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,104 rounds 52401 SRR22215347.ke.tsv 34699 SRR22215347.se.tsv 87100 total ==> SRR22215347.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1821.47 2974 59.8747 Potri.005G024800.1.v4.1 1035 838.473 1210 52.9202 Potri.004G059700.1.v4.1 961 764.473 114 5.4685 Potri.007G009000.2.v4.1 1416 1219.47 0 0 Potri.003G141000.2.v4.1 2943 2746.47 757.206 10.1103 Potri.016G087400.1.v4.1 270 79.2947 1304.44 603.26 Potri.015G069301.1.v4.1 564 367.506 0 0 Potri.010G195200.1.v4.1 1773 1576.47 43 1.00025 Potri.012G127500.1.v4.1 977 780.473 2896 136.071 ==> SRR22215347.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1954 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 637 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 192 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 11 SRR22215347 completed mapping pipeline successfully