Starting /dee2/code/volunteer_pipeline.sh SRR22215348 current disk space = 3054900375552 free memory = 1408669200 SRR22215348 SRAfilesize 540e0465352e5f6e086af004b6a03378 SRR22215348.sra SRR22215348.sra file validated SRR22215348 is paired end SRR22215348 is conventional basespace SRR22215348 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215348_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.93775 37.0 37.0 37.0 37.0 37.0 2 36.048 37.0 37.0 37.0 37.0 37.0 3 36.313 37.0 37.0 37.0 37.0 37.0 4 36.301 37.0 37.0 37.0 37.0 37.0 5 36.3645 37.0 37.0 37.0 37.0 37.0 6 36.338 37.0 37.0 37.0 37.0 37.0 7 36.341 37.0 37.0 37.0 37.0 37.0 8 36.165 37.0 37.0 37.0 37.0 37.0 9 36.2455 37.0 37.0 37.0 37.0 37.0 10-14 36.310199999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.3185 37.0 37.0 37.0 37.0 37.0 20-24 36.194 37.0 37.0 37.0 37.0 37.0 25-29 36.2218 37.0 37.0 37.0 37.0 37.0 30-34 36.1088 37.0 37.0 37.0 37.0 37.0 35-39 36.049699999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.019999999999996 37.0 37.0 37.0 37.0 37.0 45-49 35.8782 37.0 37.0 37.0 37.0 37.0 50-54 35.9089 37.0 37.0 37.0 37.0 37.0 55-59 35.7872 37.0 37.0 37.0 37.0 37.0 60-64 35.723 37.0 37.0 37.0 37.0 37.0 65-69 35.71510000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.781 37.0 37.0 37.0 37.0 37.0 75-79 35.7916 37.0 37.0 37.0 37.0 37.0 80-84 35.75790000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.7463 37.0 37.0 37.0 37.0 37.0 90-94 35.6335 37.0 37.0 37.0 37.0 37.0 95-99 35.654700000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.6266 37.0 37.0 37.0 37.0 37.0 105-109 35.581900000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.5415 37.0 37.0 37.0 37.0 37.0 115-119 35.5609 37.0 37.0 37.0 37.0 37.0 120-124 35.422000000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.4581 37.0 37.0 37.0 37.0 37.0 130-134 35.4205 37.0 37.0 37.0 37.0 37.0 135-139 35.3571 37.0 37.0 37.0 34.6 37.0 140-144 35.2439 37.0 37.0 37.0 29.8 37.0 145-149 35.2197 37.0 37.0 37.0 32.2 37.0 150-151 35.001000000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 2.0 23 1.0 24 3.0 25 8.0 26 12.0 27 18.0 28 24.0 29 37.0 30 58.0 31 74.0 32 105.0 33 135.0 34 204.0 35 481.0 36 2643.0 37 193.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.57225433526011 12.013068610203568 17.8939432018095 32.52073385272681 2 30.852130325814535 12.957393483709273 30.175438596491226 26.015037593984964 3 27.375 20.599999999999998 23.5 28.525 4 29.325000000000003 24.975 21.15 24.55 5 26.35 31.8 21.95 19.900000000000002 6 19.75 32.675 24.15 23.425 7 13.575000000000001 29.525000000000002 38.800000000000004 18.099999999999998 8 16.425 27.250000000000004 32.45 23.875 9 18.35 23.974999999999998 33.175 24.5 10-14 19.03 32.34 26.200000000000003 22.43 15-19 19.555 29.79 27.255000000000003 23.400000000000002 20-24 19.75 29.4 27.725 23.125 25-29 19.564999999999998 29.835 27.47 23.13 30-34 19.185 29.625 27.55 23.64 35-39 19.685 29.505 26.86 23.95 40-44 19.91 29.549999999999997 27.36 23.18 45-49 20.055 28.675 27.925 23.345 50-54 19.17 29.715000000000003 27.439999999999998 23.674999999999997 55-59 19.165 29.79 27.36 23.685000000000002 60-64 19.705000000000002 29.04 27.755000000000003 23.5 65-69 20.18 29.15 27.26 23.41 70-74 20.28 28.415000000000003 27.474999999999998 23.830000000000002 75-79 20.345 28.785 26.995 23.875 80-84 20.075000000000003 28.21 27.634999999999998 24.08 85-89 20.125 28.765 27.095000000000002 24.015 90-94 20.25 28.77 26.915 24.065 95-99 20.255000000000003 27.445000000000004 27.82 24.48 100-104 20.244999999999997 28.865000000000002 26.974999999999998 23.915 105-109 19.735 27.935 27.860000000000003 24.47 110-114 20.195 28.21 27.284999999999997 24.310000000000002 115-119 20.955 27.62 27.284999999999997 24.14 120-124 20.41 28.084999999999997 27.250000000000004 24.255 125-129 20.4 28.005000000000003 27.305 24.29 130-134 20.705000000000002 28.02 27.125 24.15 135-139 21.035 28.465 26.355 24.145 140-144 21.575 28.449999999999996 26.095000000000002 23.880000000000003 145-149 21.555 28.685 25.735000000000003 24.025 150-151 22.25 27.900000000000002 25.6 24.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 0.5 22 1.0 23 2.5 24 5.0 25 5.5 26 9.5 27 15.5 28 20.0 29 26.0 30 32.5 31 36.5 32 44.0 33 60.0 34 73.0 35 88.0 36 111.5 37 133.5 38 133.0 39 137.0 40 170.0 41 196.0 42 218.5 43 234.0 44 233.5 45 258.0 46 255.0 47 229.5 48 208.5 49 179.0 50 160.5 51 135.5 52 117.0 53 92.5 54 76.0 55 66.5 56 39.5 57 33.5 58 30.5 59 23.5 60 20.0 61 12.0 62 10.0 63 7.5 64 5.0 65 7.0 66 11.5 67 9.5 68 8.0 69 5.5 70 1.5 71 1.5 72 1.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.525 2 0.25 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.4 #Duplication Level Percentage of deduplicated Percentage of total 1 91.82166301969366 83.92500000000001 2 7.357768052516411 13.450000000000001 3 0.738512035010941 2.025 4 0.02735229759299781 0.1 5 0.0 0.0 6 0.0 0.0 7 0.02735229759299781 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.02735229759299781 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTAT 13 0.325 TruSeq Adapter, Index 14 (97% over 44bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCGCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 14 (97% over 45bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.3 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.6375 0.0 0.0 0.0 0.0 116-117 0.7125 0.0 0.0 0.0 0.0 118-119 0.875 0.0 0.0 0.0 0.0 120-121 1.025 0.0 0.0 0.0 0.0 122-123 1.325 0.0 0.0 0.0 0.0 124-125 1.75 0.0 0.0 0.0 0.0 126-127 2.25 0.0 0.0 0.0 0.0 128-129 2.8 0.0 0.0 0.0 0.0 130-131 3.375 0.0 0.0 0.0 0.0 132-133 3.9124999999999996 0.0 0.0 0.0 0.0 134-135 4.675000000000001 0.0 0.0 0.0 0.0 136-137 5.65 0.0 0.0 0.0 0.0 138-139 6.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR22215348 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215348_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.77 37.0 37.0 37.0 37.0 37.0 2 36.2275 37.0 37.0 37.0 37.0 37.0 3 36.1795 37.0 37.0 37.0 37.0 37.0 4 36.106 37.0 37.0 37.0 37.0 37.0 5 36.1375 37.0 37.0 37.0 37.0 37.0 6 36.082 37.0 37.0 37.0 37.0 37.0 7 36.171 37.0 37.0 37.0 37.0 37.0 8 36.174 37.0 37.0 37.0 37.0 37.0 9 36.163 37.0 37.0 37.0 37.0 37.0 10-14 36.1132 37.0 37.0 37.0 37.0 37.0 15-19 36.0781 37.0 37.0 37.0 37.0 37.0 20-24 36.0794 37.0 37.0 37.0 37.0 37.0 25-29 35.912 37.0 37.0 37.0 37.0 37.0 30-34 35.857 37.0 37.0 37.0 37.0 37.0 35-39 35.8813 37.0 37.0 37.0 37.0 37.0 40-44 35.802099999999996 37.0 37.0 37.0 37.0 37.0 45-49 35.81699999999999 37.0 37.0 37.0 37.0 37.0 50-54 35.775999999999996 37.0 37.0 37.0 37.0 37.0 55-59 35.7409 37.0 37.0 37.0 37.0 37.0 60-64 35.6711 37.0 37.0 37.0 37.0 37.0 65-69 35.673199999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.589600000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.5443 37.0 37.0 37.0 37.0 37.0 80-84 35.4861 37.0 37.0 37.0 37.0 37.0 85-89 35.56230000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.481899999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.5167 37.0 37.0 37.0 37.0 37.0 100-104 35.4979 37.0 37.0 37.0 37.0 37.0 105-109 35.46 37.0 37.0 37.0 37.0 37.0 110-114 35.468199999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.382799999999996 37.0 37.0 37.0 34.6 37.0 120-124 35.3101 37.0 37.0 37.0 34.6 37.0 125-129 35.2333 37.0 37.0 37.0 29.8 37.0 130-134 35.2229 37.0 37.0 37.0 29.8 37.0 135-139 35.2436 37.0 37.0 37.0 29.8 37.0 140-144 35.1245 37.0 37.0 37.0 25.0 37.0 145-149 34.9962 37.0 37.0 37.0 25.0 37.0 150-151 34.98125 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 0.0 16 1.0 17 2.0 18 0.0 19 3.0 20 3.0 21 3.0 22 8.0 23 9.0 24 12.0 25 11.0 26 23.0 27 19.0 28 19.0 29 38.0 30 39.0 31 53.0 32 71.0 33 116.0 34 242.0 35 649.0 36 2489.0 37 187.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.575 20.225 18.075 27.125 2 29.15 27.700000000000003 28.625 14.524999999999999 3 25.124999999999996 30.425 27.150000000000002 17.299999999999997 4 26.625 35.875 21.65 15.85 5 26.424999999999997 36.0 21.5 16.075 6 20.625 38.375 24.65 16.35 7 21.3 18.425 42.175000000000004 18.099999999999998 8 23.95 24.075 28.599999999999998 23.375 9 25.974999999999998 23.150000000000002 27.750000000000004 23.125 10-14 24.805 28.77 26.064999999999998 20.36 15-19 25.05 27.68 27.650000000000002 19.62 20-24 25.595000000000002 28.470000000000002 26.82 19.115 25-29 24.8 28.46 27.38 19.36 30-34 25.019999999999996 28.285 27.534999999999997 19.16 35-39 25.005 28.535 27.13 19.33 40-44 24.86 27.855 27.435 19.85 45-49 25.15 27.865000000000002 27.21 19.775000000000002 50-54 24.905 28.02 26.905 20.169999999999998 55-59 25.285000000000004 27.395000000000003 27.500000000000004 19.82 60-64 24.560000000000002 28.134999999999998 27.694999999999997 19.61 65-69 24.08 27.650000000000002 28.48 19.79 70-74 25.145 27.32 28.225 19.31 75-79 24.89 27.93 27.83 19.35 80-84 24.995 27.3 28.255000000000003 19.45 85-89 24.23 27.6 28.285 19.885 90-94 25.130000000000003 27.62 27.54 19.71 95-99 24.54 28.225 27.779999999999998 19.455 100-104 24.87 27.474999999999998 28.32 19.335 105-109 24.245 27.815 28.299999999999997 19.64 110-114 23.915 27.675 28.71 19.7 115-119 24.645 27.785 28.04 19.53 120-124 24.235 27.615000000000002 28.815 19.335 125-129 24.955 27.725 27.685 19.634999999999998 130-134 25.105 28.294999999999998 27.73 18.87 135-139 24.84 28.050000000000004 27.68 19.43 140-144 25.495 27.96 27.47 19.075 145-149 25.915 28.185 27.13 18.77 150-151 26.325 29.612500000000004 25.587500000000002 18.475 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.5 15 1.5 16 1.5 17 2.0 18 1.5 19 1.0 20 1.0 21 1.0 22 0.5 23 0.5 24 1.0 25 3.0 26 4.5 27 6.5 28 10.0 29 17.5 30 19.5 31 21.5 32 32.0 33 33.5 34 44.5 35 65.0 36 85.0 37 106.0 38 126.5 39 165.0 40 193.5 41 215.5 42 231.0 43 234.5 44 260.5 45 269.0 46 277.5 47 267.5 48 236.5 49 200.5 50 153.5 51 130.5 52 115.5 53 109.0 54 84.5 55 54.5 56 43.0 57 31.0 58 20.5 59 19.0 60 14.0 61 11.5 62 12.5 63 7.5 64 6.0 65 4.0 66 2.0 67 4.5 68 5.5 69 2.0 70 2.0 71 2.0 72 0.0 73 0.0 74 0.5 75 2.5 76 2.0 77 1.0 78 1.0 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.5 86 1.0 87 0.5 88 1.0 89 2.5 90 2.5 91 1.0 92 0.5 93 0.5 94 1.0 95 1.5 96 0.5 97 0.5 98 0.5 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.825 #Duplication Level Percentage of deduplicated Percentage of total 1 91.8322896814593 84.325 2 7.432616389872039 13.65 3 0.7350939286686632 2.025 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.3 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.44999999999999996 0.0 0.0 0.0 0.0 114-115 0.6125 0.0 0.0 0.0 0.0 116-117 0.6875 0.0 0.0 0.0 0.0 118-119 0.8500000000000001 0.0 0.0 0.0 0.0 120-121 1.0125 0.0 0.0 0.0 0.0 122-123 1.325 0.0 0.0 0.0 0.0 124-125 1.7375 0.0 0.0 0.0 0.0 126-127 2.25 0.0 0.0 0.0 0.0 128-129 2.8 0.0 0.0 0.0 0.0 130-131 3.3875 0.0 0.0 0.0 0.0 132-133 3.925 0.0 0.0 0.0 0.0 134-135 4.65 0.0 0.0 0.0 0.0 136-137 5.6 0.0 0.0 0.0 0.0 138-139 6.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2163957 spots for SRR22215348.sra Written 2163957 spots for SRR22215348.sra Read 2163957 spots for SRR22215348.sra Written 2163957 spots for SRR22215348.sra Read 2163957 spots for SRR22215348.sra Written 2163957 spots for SRR22215348.sra Read 2163957 spots for SRR22215348.sra Written 2163957 spots for SRR22215348.sra Read 2163957 spots for SRR22215348.sra Written 2163957 spots for SRR22215348.sra Read 2163957 spots for SRR22215348.sra Written 2163957 spots for SRR22215348.sra Read 2163957 spots for SRR22215348.sra Written 2163957 spots for SRR22215348.sra Read 2163957 spots for SRR22215348.sra Written 2163957 spots for SRR22215348.sra Read 2163957 spots for SRR22215348.sra Written 2163957 spots for SRR22215348.sra Read 2163957 spots for SRR22215348.sra Written 2163957 spots for SRR22215348.sra Read 2163957 spots for SRR22215348.sra Written 2163957 spots for SRR22215348.sra Read 2163957 spots for SRR22215348.sra Written 2163957 spots for SRR22215348.sra Read 2163957 spots for SRR22215348.sra Written 2163957 spots for SRR22215348.sra Read 2163957 spots for SRR22215348.sra Written 2163957 spots for SRR22215348.sra Read 2163957 spots for SRR22215348.sra Written 2163957 spots for SRR22215348.sra Read 2163957 spots for SRR22215348.sra Written 2163957 spots for SRR22215348.sra Read 2163957 spots for SRR22215348.sra Written 2163957 spots for SRR22215348.sra Read 2163957 spots for SRR22215348.sra Written 2163957 spots for SRR22215348.sra Read 2163957 spots for SRR22215348.sra Written 2163957 spots for SRR22215348.sra Read 2163966 spots for SRR22215348.sra Written 2163966 spots for SRR22215348.sra SRR ids: ['SRR22215348.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jnr9hqo0 SRR22215348.sra spots: 43279149 blocks: [[1, 2163957], [2163958, 4327914], [4327915, 6491871], [6491872, 8655828], [8655829, 10819785], [10819786, 12983742], [12983743, 15147699], [15147700, 17311656], [17311657, 19475613], [19475614, 21639570], [21639571, 23803527], [23803528, 25967484], [25967485, 28131441], [28131442, 30295398], [30295399, 32459355], [32459356, 34623312], [34623313, 36787269], [36787270, 38951226], [38951227, 41115183], [41115184, 43279149]] SRR22215348 file size 14686447 SRR22215348 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22215348 SRR22215348_1.fastq SRR22215348_2.fastq Input file: SRR22215348_1.fastq Paired file: SRR22215348_2.fastq trimmed: SRR22215348-trimmed-pair1.fastq, SRR22215348-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:38:18 2025 >> started Tue Feb 11 09:39:07 2025 >> done (49.718s) 43279149 read pairs processed; of these: 683 ( 0.00%) short read pairs filtered out after trimming by size control 277072 ( 0.64%) empty read pairs filtered out after trimming by size control 43001394 (99.36%) read pairs available; of these: 6691590 (15.56%) trimmed read pairs available after processing 36309804 (84.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 18 0.00% 19 34 0.00% 20 12 0.00% 21 26 0.00% 22 10 0.00% 23 10 0.00% 24 14 0.00% 25 9 0.00% 26 16 0.00% 27 42 0.00% 28 5 0.00% 29 89 0.00% 30 20 0.00% 31 37 0.00% 32 21 0.00% 33 15 0.00% 34 13 0.00% 35 22 0.00% 36 15 0.00% 37 19 0.00% 38 10 0.00% 39 19 0.00% 40 22 0.00% 41 23 0.00% 42 25 0.00% 43 28 0.00% 44 39 0.00% 45 32 0.00% 46 44 0.00% 47 44 0.00% 48 49 0.00% 49 56 0.00% 50 87 0.00% 51 68 0.00% 52 55 0.00% 53 72 0.00% 54 101 0.00% 55 93 0.00% 56 89 0.00% 57 80 0.00% 58 80 0.00% 59 90 0.00% 60 86 0.00% 61 91 0.00% 62 96 0.00% 63 137 0.00% 64 146 0.00% 65 137 0.00% 66 156 0.00% 67 141 0.00% 68 164 0.00% 69 172 0.00% 70 209 0.00% 71 256 0.00% 72 251 0.00% 73 323 0.00% 74 386 0.00% 75 385 0.00% 76 436 0.00% 77 500 0.00% 78 496 0.00% 79 639 0.00% 80 658 0.00% 81 759 0.00% 82 901 0.00% 83 1020 0.00% 84 1044 0.00% 85 1211 0.00% 86 1369 0.00% 87 1497 0.00% 88 1708 0.00% 89 1805 0.00% 90 1990 0.00% 91 2279 0.01% 92 2588 0.01% 93 2879 0.01% 94 3236 0.01% 95 3653 0.01% 96 4028 0.01% 97 4443 0.01% 98 4817 0.01% 99 5386 0.01% 100 5756 0.01% 101 6324 0.01% 102 7071 0.02% 103 7886 0.02% 104 8957 0.02% 105 9972 0.02% 106 10959 0.03% 107 12307 0.03% 108 13718 0.03% 109 15152 0.04% 110 16825 0.04% 111 18642 0.04% 112 21065 0.05% 113 23337 0.05% 114 26081 0.06% 115 29831 0.07% 116 33507 0.08% 117 37670 0.09% 118 43068 0.10% 119 48315 0.11% 120 53393 0.12% 121 59813 0.14% 122 65573 0.15% 123 72204 0.17% 124 80651 0.19% 125 88914 0.21% 126 98730 0.23% 127 108459 0.25% 128 119652 0.28% 129 130047 0.30% 130 142410 0.33% 131 152753 0.36% 132 162917 0.38% 133 173540 0.40% 134 183469 0.43% 135 195672 0.46% 136 208912 0.49% 137 221802 0.52% 138 236197 0.55% 139 250158 0.58% 140 261766 0.61% 141 271997 0.63% 142 284885 0.66% 143 292997 0.68% 144 302710 0.70% 145 310639 0.72% 146 319893 0.74% 147 329452 0.77% 148 342105 0.80% 149 352108 0.82% 150 367198 0.85% 151 36309804 84.44% 43001394 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=3.59 fanout-score-rank=31 prefix-density=0.19 prefix-fanout=3.3 sequence=GTGGACTCCTTCTGGAT criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=195.15 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=17.5 sequence=AAACAAAAGATGCATGTCATATCAAACCAAACAAAGGGAAGATAGGTAACAGTTTCGATATTACTTAATTTCTTGACACATGCAGGAGGAGCACTATGCTGAGTTTTAATTTGCAGCAGTAGCTTAGAAACCATGAATTTTAATGCTTTCCTTCTTCACAATGCCAGCCTGAACAAGGAAGGTCGATACATTCTTGCGCTGGTCACCTTGAAGTTGAATAACCTGGCCTAATTCAGGGTCCTGCACCACTGTACCATTACAGCAGAACTCTTTCTTGAGG criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=6.32 fanout-score-rank=24 prefix-density=0.28 prefix-fanout=3.8 sequence=ATCCAGAAGGAGTCCAC criterion=fanout-score sequence-density=0.09 sequence-density-rank=14 fanout-score=89.47 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=16.5 sequence=GCTGCTGCTGCT SRR22215348 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:39:56 Started mapping on | Feb 11 09:39:56 Finished on | Feb 11 09:43:44 Mapping speed, Million of reads per hour | 678.97 Number of input reads | 43001394 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 40630890 Uniquely mapped reads % | 94.49% Average mapped length | 296.53 Number of splices: Total | 31324104 Number of splices: Annotated (sjdb) | 30604689 Number of splices: GT/AG | 30821247 Number of splices: GC/AG | 389705 Number of splices: AT/AC | 42656 Number of splices: Non-canonical | 70496 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.02% Deletion average length | 2.19 Insertion rate per base | 0.02% Insertion average length | 1.83 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 813983 % of reads mapped to multiple loci | 1.89% Number of reads mapped to too many loci | 452247 % of reads mapped to too many loci | 1.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.15% % of reads unmapped: other | 0.42% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1556521 1556521 1556521 N_multimapping 813983 813983 813983 N_noFeature 1521643 40041416 1719966 N_ambiguous 575098 2648 182568 UnstrandedReadsAssigned:38534149 PositiveStrandReadsAssigned:586826 NegativeStrandReadsAssigned:38728356 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR22215348 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22215348-trimmed-pair1.fastq SRR22215348-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 43,001,394 reads, 39,367,913 reads pseudoaligned [quant] estimated average fragment length: 186.253 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,291 rounds 52401 SRR22215348.ke.tsv 34699 SRR22215348.se.tsv 87100 total ==> SRR22215348.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1832.75 2971 39.1244 Potri.005G024800.1.v4.1 1035 849.747 897 25.4771 Potri.004G059700.1.v4.1 961 775.747 61 1.89783 Potri.007G009000.2.v4.1 1416 1230.75 0 0 Potri.003G141000.2.v4.1 2943 2757.75 820 7.17641 Potri.016G087400.1.v4.1 270 88.5449 2510 684.161 Potri.015G069301.1.v4.1 564 378.837 0 0 Potri.010G195200.1.v4.1 1773 1587.75 124 1.8849 Potri.012G127500.1.v4.1 977 791.747 6225 189.758 ==> SRR22215348.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1474 Potri.001G233950.v4.1 5 Potri.001G122700.v4.1 997 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 43 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR22215348 completed mapping pipeline successfully