Starting /dee2/code/volunteer_pipeline.sh SRR22215349 current disk space = 3053149351936 free memory = 1579739180 SRR22215349 SRAfilesize 71ef4241521316c21c3d6ade702f61f9 SRR22215349.sra SRR22215349.sra file validated SRR22215349 is paired end SRR22215349 is conventional basespace SRR22215349 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215349_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.897 37.0 37.0 37.0 37.0 37.0 2 35.89925 37.0 37.0 37.0 37.0 37.0 3 36.265 37.0 37.0 37.0 37.0 37.0 4 36.208 37.0 37.0 37.0 37.0 37.0 5 36.2525 37.0 37.0 37.0 37.0 37.0 6 36.2855 37.0 37.0 37.0 37.0 37.0 7 36.1165 37.0 37.0 37.0 37.0 37.0 8 36.2255 37.0 37.0 37.0 37.0 37.0 9 36.232 37.0 37.0 37.0 37.0 37.0 10-14 36.232299999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.2178 37.0 37.0 37.0 37.0 37.0 20-24 36.1869 37.0 37.0 37.0 37.0 37.0 25-29 36.1322 37.0 37.0 37.0 37.0 37.0 30-34 36.004599999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.0304 37.0 37.0 37.0 37.0 37.0 40-44 35.956599999999995 37.0 37.0 37.0 37.0 37.0 45-49 35.9293 37.0 37.0 37.0 37.0 37.0 50-54 35.8975 37.0 37.0 37.0 37.0 37.0 55-59 35.8903 37.0 37.0 37.0 37.0 37.0 60-64 35.8097 37.0 37.0 37.0 37.0 37.0 65-69 35.8178 37.0 37.0 37.0 37.0 37.0 70-74 35.7047 37.0 37.0 37.0 37.0 37.0 75-79 35.7397 37.0 37.0 37.0 37.0 37.0 80-84 35.680699999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.656400000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.5855 37.0 37.0 37.0 37.0 37.0 95-99 35.6272 37.0 37.0 37.0 37.0 37.0 100-104 35.526700000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.501400000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.4779 37.0 37.0 37.0 37.0 37.0 115-119 35.4865 37.0 37.0 37.0 37.0 37.0 120-124 35.432500000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.32769999999999 37.0 37.0 37.0 34.6 37.0 130-134 35.2868 37.0 37.0 37.0 32.2 37.0 135-139 35.3674 37.0 37.0 37.0 37.0 37.0 140-144 35.1751 37.0 37.0 37.0 29.8 37.0 145-149 35.1348 37.0 37.0 37.0 27.4 37.0 150-151 34.92225 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 1.0 23 4.0 24 4.0 25 6.0 26 13.0 27 26.0 28 39.0 29 39.0 30 61.0 31 70.0 32 96.0 33 127.0 34 214.0 35 479.0 36 2627.0 37 192.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.30819507290095 11.89039718451483 15.912518853695323 38.88888888888889 2 28.174305033809166 14.199849737039818 33.35837716003005 24.267468069120962 3 24.325 22.075 24.075 29.525000000000002 4 26.575 27.400000000000002 20.75 25.275 5 24.925 31.175000000000004 23.95 19.950000000000003 6 18.95 34.875 24.85 21.325 7 13.125 27.250000000000004 41.175 18.45 8 15.875 24.375 33.95 25.8 9 17.875 22.225 34.925 24.975 10-14 19.650000000000002 30.425 27.71 22.215 15-19 19.509999999999998 29.62 27.825 23.044999999999998 20-24 19.855 29.725 27.785 22.634999999999998 25-29 19.97 29.494999999999997 27.529999999999998 23.005 30-34 20.16 29.244999999999997 27.805000000000003 22.79 35-39 19.965 29.59 27.48 22.965 40-44 19.744999999999997 29.575000000000003 27.405 23.275000000000002 45-49 19.91 29.865000000000002 27.67 22.555 50-54 19.74 29.299999999999997 27.639999999999997 23.32 55-59 19.99 29.099999999999998 27.725 23.185 60-64 20.005 29.044999999999998 27.51 23.44 65-69 20.495 29.154999999999998 27.04 23.31 70-74 20.235 29.505 27.794999999999998 22.465 75-79 20.19 28.92 27.55 23.34 80-84 19.93 28.48 28.255000000000003 23.335 85-89 20.195 28.77 27.46 23.575 90-94 20.355 29.349999999999998 27.425 22.869999999999997 95-99 20.025000000000002 28.74 27.735 23.5 100-104 20.13 29.34 27.26 23.27 105-109 19.509999999999998 28.685 28.125 23.68 110-114 19.8 28.93 27.575 23.695 115-119 20.185 28.84 27.42 23.555 120-124 19.945 29.635 26.889999999999997 23.53 125-129 20.595 28.634999999999998 27.650000000000002 23.119999999999997 130-134 21.025 28.945 27.055 22.975 135-139 20.575 28.804999999999996 27.33 23.29 140-144 20.665 29.09 27.465 22.78 145-149 21.265 28.970000000000002 26.590000000000003 23.175 150-151 21.337500000000002 30.225 25.25 23.1875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.5 19 2.0 20 1.0 21 0.0 22 1.5 23 3.0 24 4.5 25 7.0 26 6.5 27 8.5 28 18.0 29 23.5 30 27.5 31 37.5 32 44.0 33 60.0 34 77.0 35 78.5 36 101.5 37 122.0 38 141.5 39 171.5 40 188.0 41 211.0 42 238.0 43 252.0 44 265.0 45 274.0 46 250.0 47 225.0 48 213.0 49 187.5 50 156.0 51 122.5 52 99.0 53 84.5 54 61.0 55 51.0 56 40.0 57 31.0 58 28.5 59 19.0 60 14.0 61 11.5 62 9.5 63 5.0 64 4.0 65 4.0 66 2.5 67 2.5 68 2.0 69 2.0 70 1.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5499999999999999 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.64999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.38025095471905 83.75 2 8.156028368794328 14.95 3 0.436442989634479 1.2 4 0.027277686852154936 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.07500000000000001 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.325 0.0 0.0 0.0 0.0 114-115 0.3875 0.0 0.0 0.0 0.0 116-117 0.4125 0.0 0.0 0.0 0.0 118-119 0.6 0.0 0.0 0.0 0.0 120-121 0.8 0.0 0.0 0.0 0.0 122-123 1.025 0.0 0.0 0.0 0.0 124-125 1.175 0.0 0.0 0.0 0.0 126-127 1.475 0.0 0.0 0.0 0.0 128-129 1.725 0.0 0.0 0.0 0.0 130-131 1.925 0.0 0.0 0.0 0.0 132-133 2.3375000000000004 0.0 0.0 0.0 0.0 134-135 2.7874999999999996 0.0 0.0 0.0 0.0 136-137 3.3375 0.0 0.0 0.0 0.0 138-139 4.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR22215349 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215349_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.7975 37.0 37.0 37.0 37.0 37.0 2 36.0195 37.0 37.0 37.0 37.0 37.0 3 36.147 37.0 37.0 37.0 37.0 37.0 4 35.97 37.0 37.0 37.0 37.0 37.0 5 35.999 37.0 37.0 37.0 37.0 37.0 6 36.0065 37.0 37.0 37.0 37.0 37.0 7 36.072 37.0 37.0 37.0 37.0 37.0 8 36.14 37.0 37.0 37.0 37.0 37.0 9 36.135 37.0 37.0 37.0 37.0 37.0 10-14 36.0578 37.0 37.0 37.0 37.0 37.0 15-19 36.0543 37.0 37.0 37.0 37.0 37.0 20-24 36.020500000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.0191 37.0 37.0 37.0 37.0 37.0 30-34 35.9724 37.0 37.0 37.0 37.0 37.0 35-39 35.9236 37.0 37.0 37.0 37.0 37.0 40-44 35.9175 37.0 37.0 37.0 37.0 37.0 45-49 35.8686 37.0 37.0 37.0 37.0 37.0 50-54 35.8645 37.0 37.0 37.0 37.0 37.0 55-59 35.8278 37.0 37.0 37.0 37.0 37.0 60-64 35.791399999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.7022 37.0 37.0 37.0 37.0 37.0 70-74 35.685700000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.660900000000005 37.0 37.0 37.0 37.0 37.0 80-84 35.5425 37.0 37.0 37.0 37.0 37.0 85-89 35.606 37.0 37.0 37.0 37.0 37.0 90-94 35.5038 37.0 37.0 37.0 37.0 37.0 95-99 35.5017 37.0 37.0 37.0 37.0 37.0 100-104 35.4572 37.0 37.0 37.0 37.0 37.0 105-109 35.424899999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.4278 37.0 37.0 37.0 37.0 37.0 115-119 35.3385 37.0 37.0 37.0 34.6 37.0 120-124 35.20709999999999 37.0 37.0 37.0 27.4 37.0 125-129 35.2087 37.0 37.0 37.0 29.8 37.0 130-134 35.163599999999995 37.0 37.0 37.0 27.4 37.0 135-139 35.1438 37.0 37.0 37.0 27.4 37.0 140-144 35.0406 37.0 37.0 37.0 25.0 37.0 145-149 35.003 37.0 37.0 37.0 25.0 37.0 150-151 34.86225 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 2.0 16 0.0 17 1.0 18 0.0 19 0.0 20 3.0 21 4.0 22 8.0 23 9.0 24 10.0 25 11.0 26 18.0 27 21.0 28 25.0 29 26.0 30 47.0 31 64.0 32 72.0 33 124.0 34 225.0 35 667.0 36 2459.0 37 202.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.525000000000002 19.775000000000002 17.724999999999998 31.974999999999998 2 25.424999999999997 27.375 32.775 14.424999999999999 3 22.675 29.275000000000002 28.999999999999996 19.05 4 25.35 35.4 22.45 16.8 5 24.65 37.7 22.400000000000002 15.25 6 19.55 39.475 23.150000000000002 17.825 7 18.5 19.85 42.35 19.3 8 21.224999999999998 23.425 28.975 26.375 9 22.975 23.275000000000002 29.425 24.325 10-14 23.51 28.27 27.63 20.59 15-19 23.755000000000003 27.11 28.945 20.19 20-24 23.23 27.765 28.71 20.294999999999998 25-29 23.305 28.615000000000002 28.1 19.98 30-34 23.25 28.26 28.705000000000002 19.785 35-39 23.494999999999997 27.650000000000002 27.97 20.885 40-44 23.555 28.265 28.18 20.0 45-49 23.36 28.294999999999998 28.225 20.119999999999997 50-54 23.380000000000003 27.76 28.389999999999997 20.47 55-59 23.79 28.525 27.950000000000003 19.735 60-64 23.294999999999998 27.944999999999997 28.585 20.175 65-69 24.005000000000003 28.18 28.27 19.545 70-74 24.12 26.91 28.49 20.48 75-79 23.669999999999998 27.96 28.28 20.09 80-84 23.31 28.095 28.865000000000002 19.73 85-89 22.73 28.22 28.634999999999998 20.415 90-94 23.65 27.834999999999997 28.4 20.115 95-99 23.119999999999997 28.62 28.299999999999997 19.96 100-104 23.16 27.97 28.93 19.939999999999998 105-109 23.23 27.99 29.26 19.52 110-114 23.380000000000003 27.48 29.175 19.965 115-119 23.27 28.535 28.465 19.73 120-124 23.57 28.28 28.605000000000004 19.545 125-129 23.525 28.675 28.115000000000002 19.685 130-134 23.625 27.83 28.360000000000003 20.185 135-139 23.73 27.994999999999997 28.365000000000002 19.91 140-144 24.295 28.744999999999997 27.66 19.3 145-149 24.45 28.68 27.485 19.384999999999998 150-151 25.087500000000002 29.375 27.224999999999998 18.3125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 1.0 15 0.5 16 1.0 17 1.0 18 2.0 19 2.5 20 1.0 21 2.0 22 2.0 23 2.0 24 3.5 25 6.0 26 6.0 27 4.5 28 8.0 29 18.0 30 27.5 31 30.5 32 34.0 33 42.5 34 62.0 35 80.5 36 96.0 37 114.0 38 138.5 39 177.5 40 212.0 41 241.5 42 263.0 43 258.5 44 260.5 45 270.5 46 267.0 47 236.5 48 208.5 49 185.0 50 149.5 51 126.5 52 103.0 53 75.5 54 51.5 55 49.5 56 45.0 57 31.5 58 26.0 59 15.0 60 9.0 61 9.5 62 7.0 63 6.0 64 4.5 65 3.5 66 3.0 67 2.0 68 1.0 69 1.0 70 2.0 71 2.0 72 1.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 1.0 94 1.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.725 #Duplication Level Percentage of deduplicated Percentage of total 1 91.55083128917961 83.975 2 7.931316434995912 14.549999999999999 3 0.46334150994821477 1.275 4 0.05451076587626057 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.4375 0.0 0.0 0.0 0.0 116-117 0.4625 0.0 0.0 0.0 0.0 118-119 0.65 0.0 0.0 0.0 0.0 120-121 0.85 0.0 0.0 0.0 0.0 122-123 1.075 0.0 0.0 0.0 0.0 124-125 1.225 0.0 0.0 0.0 0.0 126-127 1.525 0.0 0.0 0.0 0.0 128-129 1.775 0.0 0.0 0.0 0.0 130-131 1.9875 0.0 0.0 0.0 0.0 132-133 2.4124999999999996 0.0 0.0 0.0 0.0 134-135 2.875 0.0 0.0 0.0 0.0 136-137 3.4375 0.0 0.0 0.0 0.0 138-139 4.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2161971 spots for SRR22215349.sra Written 2161971 spots for SRR22215349.sra Read 2161971 spots for SRR22215349.sra Written 2161971 spots for SRR22215349.sra Read 2161971 spots for SRR22215349.sra Written 2161971 spots for SRR22215349.sra Read 2161971 spots for SRR22215349.sra Written 2161971 spots for SRR22215349.sra Read 2161971 spots for SRR22215349.sra Written 2161971 spots for SRR22215349.sra Read 2161971 spots for SRR22215349.sra Written 2161971 spots for SRR22215349.sra Read 2161971 spots for SRR22215349.sra Written 2161971 spots for SRR22215349.sra Read 2161971 spots for SRR22215349.sra Written 2161971 spots for SRR22215349.sra Read 2161971 spots for SRR22215349.sra Written 2161971 spots for SRR22215349.sra Read 2161971 spots for SRR22215349.sra Written 2161971 spots for SRR22215349.sra Read 2161971 spots for SRR22215349.sra Written 2161971 spots for SRR22215349.sra Read 2161971 spots for SRR22215349.sra Written 2161971 spots for SRR22215349.sra Read 2161986 spots for SRR22215349.sra Written 2161986 spots for SRR22215349.sra Read 2161971 spots for SRR22215349.sra Written 2161971 spots for SRR22215349.sra Read 2161971 spots for SRR22215349.sra Written 2161971 spots for SRR22215349.sra Read 2161971 spots for SRR22215349.sra Written 2161971 spots for SRR22215349.sra Read 2161971 spots for SRR22215349.sra Written 2161971 spots for SRR22215349.sra Read 2161971 spots for SRR22215349.sra Written 2161971 spots for SRR22215349.sra Read 2161971 spots for SRR22215349.sra Written 2161971 spots for SRR22215349.sra Read 2161971 spots for SRR22215349.sra Written 2161971 spots for SRR22215349.sra SRR ids: ['SRR22215349.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o4i3mxlu SRR22215349.sra spots: 43239435 blocks: [[1, 2161971], [2161972, 4323942], [4323943, 6485913], [6485914, 8647884], [8647885, 10809855], [10809856, 12971826], [12971827, 15133797], [15133798, 17295768], [17295769, 19457739], [19457740, 21619710], [21619711, 23781681], [23781682, 25943652], [25943653, 28105623], [28105624, 30267594], [30267595, 32429565], [32429566, 34591536], [34591537, 36753507], [36753508, 38915478], [38915479, 41077449], [41077450, 43239435]] SRR22215349 file size 14672951 SRR22215349 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22215349 SRR22215349_1.fastq SRR22215349_2.fastq Input file: SRR22215349_1.fastq Paired file: SRR22215349_2.fastq trimmed: SRR22215349-trimmed-pair1.fastq, SRR22215349-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:36:23 2025 >> started Tue Feb 11 10:37:12 2025 >> done (48.573s) 43239435 read pairs processed; of these: 118 ( 0.00%) short read pairs filtered out after trimming by size control 21232 ( 0.05%) empty read pairs filtered out after trimming by size control 43218085 (99.95%) read pairs available; of these: 4309556 ( 9.97%) trimmed read pairs available after processing 38908529 (90.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 3 0.00% 21 4 0.00% 22 1 0.00% 23 3 0.00% 24 1 0.00% 25 1 0.00% 26 4 0.00% 27 5 0.00% 28 5 0.00% 29 6 0.00% 30 7 0.00% 31 4 0.00% 32 10 0.00% 33 9 0.00% 34 5 0.00% 35 10 0.00% 36 9 0.00% 37 7 0.00% 38 10 0.00% 39 9 0.00% 40 7 0.00% 41 4 0.00% 42 14 0.00% 43 16 0.00% 44 15 0.00% 45 17 0.00% 46 15 0.00% 47 22 0.00% 48 18 0.00% 49 13 0.00% 50 30 0.00% 51 23 0.00% 52 24 0.00% 53 38 0.00% 54 19 0.00% 55 28 0.00% 56 34 0.00% 57 27 0.00% 58 41 0.00% 59 39 0.00% 60 51 0.00% 61 72 0.00% 62 68 0.00% 63 81 0.00% 64 62 0.00% 65 81 0.00% 66 86 0.00% 67 108 0.00% 68 126 0.00% 69 123 0.00% 70 138 0.00% 71 173 0.00% 72 181 0.00% 73 173 0.00% 74 189 0.00% 75 269 0.00% 76 252 0.00% 77 293 0.00% 78 322 0.00% 79 315 0.00% 80 385 0.00% 81 424 0.00% 82 451 0.00% 83 579 0.00% 84 631 0.00% 85 673 0.00% 86 832 0.00% 87 820 0.00% 88 935 0.00% 89 1025 0.00% 90 1180 0.00% 91 1386 0.00% 92 1396 0.00% 93 1540 0.00% 94 1707 0.00% 95 1912 0.00% 96 2096 0.00% 97 2318 0.01% 98 2556 0.01% 99 2774 0.01% 100 3008 0.01% 101 3416 0.01% 102 3630 0.01% 103 4184 0.01% 104 4653 0.01% 105 5142 0.01% 106 5670 0.01% 107 6300 0.01% 108 7256 0.02% 109 7871 0.02% 110 9025 0.02% 111 9970 0.02% 112 11211 0.03% 113 12470 0.03% 114 14395 0.03% 115 16395 0.04% 116 18619 0.04% 117 21261 0.05% 118 23750 0.05% 119 26809 0.06% 120 29900 0.07% 121 33519 0.08% 122 37845 0.09% 123 41794 0.10% 124 46912 0.11% 125 51542 0.12% 126 57535 0.13% 127 63722 0.15% 128 70723 0.16% 129 76742 0.18% 130 84822 0.20% 131 91591 0.21% 132 98169 0.23% 133 105764 0.24% 134 113187 0.26% 135 121163 0.28% 136 130418 0.30% 137 140960 0.33% 138 150350 0.35% 139 161233 0.37% 140 171007 0.40% 141 178955 0.41% 142 187920 0.43% 143 195838 0.45% 144 202939 0.47% 145 212199 0.49% 146 221620 0.51% 147 229801 0.53% 148 241418 0.56% 149 251704 0.58% 150 263887 0.61% 151 38908529 90.03% 43218085 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.60 fanout-score-rank=37 prefix-density=0.17 prefix-fanout=2.5 sequence=CTCCACACTTGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=125.68 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=10.8 sequence=ATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGCAGCCACAGTTTCCTCCACAGCAAGACATTTTCTGTTGGAAAAGAAGGA criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=3.73 fanout-score-rank=28 prefix-density=0.15 prefix-fanout=3.0 sequence=TGGCTCCTTGTGCATCAGCAGCACAGGATGAGAATTCTTCAGTTTCGAGCCAGTGCTGCGCTCGGGTGAAGAAAATTGGACAGAACCCAGCGTGCCTTTGTGCTGTTATGCTTTCCAACACTGCTAAGAGCTCTGGAATCAAGCCAGAAATTGCAATGACCATTCCCAAACGATGCAACATTGCTGATCGTCCTGTGGGCTACAAGTGTGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=18 fanout-score=314.42 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=27.3 sequence=AAGAAGAAGAAA SRR22215349 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:37:57 Started mapping on | Feb 11 10:37:57 Finished on | Feb 11 10:41:33 Mapping speed, Million of reads per hour | 720.30 Number of input reads | 43218085 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 41136262 Uniquely mapped reads % | 95.18% Average mapped length | 298.27 Number of splices: Total | 32863781 Number of splices: Annotated (sjdb) | 32133614 Number of splices: GT/AG | 32350430 Number of splices: GC/AG | 401591 Number of splices: AT/AC | 41040 Number of splices: Non-canonical | 70720 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.02% Deletion average length | 2.21 Insertion rate per base | 0.02% Insertion average length | 1.88 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 842772 % of reads mapped to multiple loci | 1.95% Number of reads mapped to too many loci | 348608 % of reads mapped to too many loci | 0.81% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.72% % of reads unmapped: other | 0.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1239051 1239051 1239051 N_multimapping 842772 842772 842772 N_noFeature 1655022 40606353 1841844 N_ambiguous 536269 2448 191761 UnstrandedReadsAssigned:38944971 PositiveStrandReadsAssigned:527461 NegativeStrandReadsAssigned:39102657 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR22215349 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22215349-trimmed-pair1.fastq SRR22215349-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 43,218,085 reads, 39,798,408 reads pseudoaligned [quant] estimated average fragment length: 195.321 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,272 rounds 52401 SRR22215349.ke.tsv 34699 SRR22215349.se.tsv 87100 total ==> SRR22215349.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1823.68 4793 66.5582 Potri.005G024800.1.v4.1 1035 840.679 1418 42.7158 Potri.004G059700.1.v4.1 961 766.685 74 2.44432 Potri.007G009000.2.v4.1 1416 1221.68 3 0.0621881 Potri.003G141000.2.v4.1 2943 2748.68 926.661 8.53767 Potri.016G087400.1.v4.1 270 80.561 2099 659.828 Potri.015G069301.1.v4.1 564 369.738 0 0 Potri.010G195200.1.v4.1 1773 1578.68 132.698 2.12869 Potri.012G127500.1.v4.1 977 782.685 6690 216.462 ==> SRR22215349.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1977 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 833 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 129 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 14 SRR22215349 completed mapping pipeline successfully