Starting /dee2/code/volunteer_pipeline.sh SRR22215350 current disk space = 3054913744896 free memory = 1309841712 SRR22215350 SRAfilesize cfe777473153d2573de8d8e421d71335 SRR22215350.sra SRR22215350.sra file validated SRR22215350 is paired end SRR22215350 is conventional basespace SRR22215350 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215350_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.025 37.0 37.0 37.0 37.0 37.0 2 36.00125 37.0 37.0 37.0 37.0 37.0 3 36.317 37.0 37.0 37.0 37.0 37.0 4 36.27 37.0 37.0 37.0 37.0 37.0 5 36.375 37.0 37.0 37.0 37.0 37.0 6 36.292 37.0 37.0 37.0 37.0 37.0 7 36.2075 37.0 37.0 37.0 37.0 37.0 8 36.2025 37.0 37.0 37.0 37.0 37.0 9 36.2715 37.0 37.0 37.0 37.0 37.0 10-14 36.3103 37.0 37.0 37.0 37.0 37.0 15-19 36.2222 37.0 37.0 37.0 37.0 37.0 20-24 36.1816 37.0 37.0 37.0 37.0 37.0 25-29 36.1503 37.0 37.0 37.0 37.0 37.0 30-34 36.053200000000004 37.0 37.0 37.0 37.0 37.0 35-39 35.9834 37.0 37.0 37.0 37.0 37.0 40-44 35.948899999999995 37.0 37.0 37.0 37.0 37.0 45-49 35.95909999999999 37.0 37.0 37.0 37.0 37.0 50-54 35.9659 37.0 37.0 37.0 37.0 37.0 55-59 35.9308 37.0 37.0 37.0 37.0 37.0 60-64 35.825900000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.7765 37.0 37.0 37.0 37.0 37.0 70-74 35.8303 37.0 37.0 37.0 37.0 37.0 75-79 35.7957 37.0 37.0 37.0 37.0 37.0 80-84 35.70569999999999 37.0 37.0 37.0 37.0 37.0 85-89 35.674699999999994 37.0 37.0 37.0 37.0 37.0 90-94 35.6589 37.0 37.0 37.0 37.0 37.0 95-99 35.6888 37.0 37.0 37.0 37.0 37.0 100-104 35.6304 37.0 37.0 37.0 37.0 37.0 105-109 35.601800000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.56420000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.551 37.0 37.0 37.0 37.0 37.0 120-124 35.4454 37.0 37.0 37.0 37.0 37.0 125-129 35.460899999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.4338 37.0 37.0 37.0 37.0 37.0 135-139 35.4084 37.0 37.0 37.0 37.0 37.0 140-144 35.3011 37.0 37.0 37.0 32.2 37.0 145-149 35.2838 37.0 37.0 37.0 32.2 37.0 150-151 35.004999999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 2.0 21 0.0 22 2.0 23 2.0 24 7.0 25 8.0 26 10.0 27 24.0 28 25.0 29 38.0 30 66.0 31 63.0 32 76.0 33 109.0 34 203.0 35 482.0 36 2703.0 37 178.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.17404426559356 12.323943661971832 15.417505030181086 39.08450704225352 2 28.653797944346955 13.988468287791425 35.52268739032339 21.83504637753823 3 25.025 22.7 23.150000000000002 29.125 4 27.55 28.975 20.95 22.525000000000002 5 25.224999999999998 32.574999999999996 23.200000000000003 19.0 6 19.275000000000002 34.0 25.3 21.425 7 13.125 27.900000000000002 40.625 18.35 8 16.7 25.224999999999998 33.300000000000004 24.775 9 18.95 22.3 33.900000000000006 24.85 10-14 19.29 30.895 27.279999999999998 22.535 15-19 20.005 29.189999999999998 28.4 22.405 20-24 19.33 29.830000000000002 27.779999999999998 23.06 25-29 19.855 29.43 28.51 22.205 30-34 19.365 29.945 27.685 23.005 35-39 19.805 29.04 28.000000000000004 23.155 40-44 20.22 29.505 27.58 22.695 45-49 19.965 29.970000000000002 26.884999999999998 23.18 50-54 19.695 29.18 27.855 23.27 55-59 20.005 28.93 27.935 23.13 60-64 19.935 29.18 27.61 23.275000000000002 65-69 19.955000000000002 29.825000000000003 26.735 23.485 70-74 20.044999999999998 28.88 27.32 23.755000000000003 75-79 20.715 28.865000000000002 26.96 23.46 80-84 20.23 28.77 27.655 23.345 85-89 20.26 28.799999999999997 27.47 23.47 90-94 20.349999999999998 28.595 27.694999999999997 23.36 95-99 20.34 28.720000000000002 27.22 23.72 100-104 20.555 29.37 27.365000000000002 22.71 105-109 21.0 28.605000000000004 27.37 23.025000000000002 110-114 20.599999999999998 28.360000000000003 27.015 24.025 115-119 19.939999999999998 28.67 27.750000000000004 23.64 120-124 20.73 28.735 26.924999999999997 23.61 125-129 20.77 28.310000000000002 27.445000000000004 23.474999999999998 130-134 20.18 28.365000000000002 27.99 23.465 135-139 20.9 28.92 26.805 23.375 140-144 20.865000000000002 28.79 26.790000000000003 23.555 145-149 21.265 28.904999999999998 26.68 23.150000000000002 150-151 21.525 29.1625 27.075 22.237499999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 1.5 18 1.0 19 0.0 20 2.5 21 2.5 22 2.0 23 3.5 24 5.5 25 8.0 26 8.5 27 12.5 28 17.5 29 18.5 30 26.5 31 38.0 32 52.5 33 65.5 34 74.0 35 80.0 36 97.0 37 127.0 38 154.0 39 178.0 40 203.0 41 223.0 42 232.0 43 236.0 44 239.0 45 237.0 46 233.0 47 232.5 48 209.5 49 186.5 50 156.5 51 127.0 52 115.5 53 91.0 54 65.0 55 50.5 56 36.5 57 24.5 58 26.5 59 21.0 60 14.0 61 12.0 62 8.0 63 7.5 64 9.0 65 7.5 66 4.5 67 3.5 68 1.0 69 1.5 70 1.5 71 0.5 72 0.5 73 1.0 74 1.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.6 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.45 #Duplication Level Percentage of deduplicated Percentage of total 1 92.53650621957816 85.55 2 6.841535965386695 12.65 3 0.5678745267712276 1.575 4 0.027041644131963225 0.1 5 0.027041644131963225 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCATTGTTTTCGAGGTATTCTGGATGGTTCAACAGATCAGTCTTCAGGGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0125 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.21250000000000002 0.0 0.0 0.0 0.0 112-113 0.225 0.0 0.0 0.0 0.0 114-115 0.3125 0.0 0.0 0.0 0.0 116-117 0.4125 0.0 0.0 0.0 0.0 118-119 0.4875 0.0 0.0 0.0 0.0 120-121 0.5125 0.0 0.0 0.0 0.0 122-123 0.6499999999999999 0.0 0.0 0.0 0.0 124-125 0.7875 0.0 0.0 0.0 0.0 126-127 1.025 0.0 0.0 0.0 0.0 128-129 1.3625 0.0 0.0 0.0 0.0 130-131 1.6125 0.0 0.0 0.0 0.0 132-133 2.0625 0.0 0.0 0.0 0.0 134-135 2.4625 0.0 0.0 0.0 0.0 136-137 3.0375 0.0 0.0 0.0 0.0 138-139 3.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 30 0.0014437955 24.166668 140-144 >>END_MODULE SRR22215350 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215350_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.6215 37.0 37.0 37.0 37.0 37.0 2 36.146 37.0 37.0 37.0 37.0 37.0 3 36.0295 37.0 37.0 37.0 37.0 37.0 4 36.0165 37.0 37.0 37.0 37.0 37.0 5 36.176 37.0 37.0 37.0 37.0 37.0 6 36.018 37.0 37.0 37.0 37.0 37.0 7 36.092 37.0 37.0 37.0 37.0 37.0 8 35.9715 37.0 37.0 37.0 37.0 37.0 9 36.131 37.0 37.0 37.0 37.0 37.0 10-14 36.1126 37.0 37.0 37.0 37.0 37.0 15-19 36.0261 37.0 37.0 37.0 37.0 37.0 20-24 36.051300000000005 37.0 37.0 37.0 37.0 37.0 25-29 35.9641 37.0 37.0 37.0 37.0 37.0 30-34 35.922900000000006 37.0 37.0 37.0 37.0 37.0 35-39 35.9779 37.0 37.0 37.0 37.0 37.0 40-44 35.819500000000005 37.0 37.0 37.0 37.0 37.0 45-49 35.835499999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.798300000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.6913 37.0 37.0 37.0 37.0 37.0 60-64 35.728 37.0 37.0 37.0 37.0 37.0 65-69 35.7495 37.0 37.0 37.0 37.0 37.0 70-74 35.6795 37.0 37.0 37.0 37.0 37.0 75-79 35.6705 37.0 37.0 37.0 37.0 37.0 80-84 35.5347 37.0 37.0 37.0 37.0 37.0 85-89 35.6581 37.0 37.0 37.0 37.0 37.0 90-94 35.5155 37.0 37.0 37.0 37.0 37.0 95-99 35.5209 37.0 37.0 37.0 37.0 37.0 100-104 35.4717 37.0 37.0 37.0 37.0 37.0 105-109 35.47670000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.4592 37.0 37.0 37.0 37.0 37.0 115-119 35.3856 37.0 37.0 37.0 37.0 37.0 120-124 35.2423 37.0 37.0 37.0 27.4 37.0 125-129 35.213 37.0 37.0 37.0 29.8 37.0 130-134 35.2048 37.0 37.0 37.0 25.0 37.0 135-139 35.2375 37.0 37.0 37.0 27.4 37.0 140-144 35.028 37.0 37.0 37.0 25.0 37.0 145-149 35.0577 37.0 37.0 37.0 25.0 37.0 150-151 34.92275 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 0.0 17 0.0 18 3.0 19 0.0 20 2.0 21 6.0 22 2.0 23 12.0 24 7.0 25 18.0 26 10.0 27 18.0 28 22.0 29 38.0 30 48.0 31 57.0 32 82.0 33 104.0 34 230.0 35 742.0 36 2387.0 37 211.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.15 21.15 17.224999999999998 32.475 2 28.375 26.85 31.35 13.425 3 21.625 31.25 27.975 19.15 4 25.85 36.275 21.375 16.5 5 25.900000000000002 37.574999999999996 21.325 15.2 6 19.625 40.65 22.95 16.775000000000002 7 19.0 18.825 41.125 21.05 8 20.275000000000002 23.674999999999997 29.849999999999998 26.200000000000003 9 23.35 23.75 29.325000000000003 23.575 10-14 23.925 27.775 26.895000000000003 21.404999999999998 15-19 23.330000000000002 27.985 28.134999999999998 20.549999999999997 20-24 23.165 28.685 27.51 20.64 25-29 24.060000000000002 28.205000000000002 27.665 20.07 30-34 23.794999999999998 28.044999999999998 27.839999999999996 20.32 35-39 23.96 28.265 27.474999999999998 20.3 40-44 24.02 28.01 27.665 20.305 45-49 23.665 28.065 28.27 20.0 50-54 23.815 28.58 27.694999999999997 19.91 55-59 24.104999999999997 28.27 27.93 19.695 60-64 23.39 27.534999999999997 28.58 20.495 65-69 23.630000000000003 28.34 28.27 19.759999999999998 70-74 23.669999999999998 28.015 28.065 20.25 75-79 24.169999999999998 27.839999999999996 28.17 19.82 80-84 24.015 27.87 28.01 20.105 85-89 23.565 27.625 28.205000000000002 20.605 90-94 23.54 27.87 28.12 20.47 95-99 23.31 28.12 28.62 19.950000000000003 100-104 23.125 27.87 28.57 20.435 105-109 23.265 28.08 28.42 20.235 110-114 23.26 28.384999999999998 28.575 19.78 115-119 23.205000000000002 27.665 28.884999999999998 20.244999999999997 120-124 23.96 27.839999999999996 28.42 19.78 125-129 23.95 28.139999999999997 28.215 19.695 130-134 24.05 28.18 28.23 19.54 135-139 23.915 28.050000000000004 28.18 19.855 140-144 23.799999999999997 28.144999999999996 27.92 20.135 145-149 24.779999999999998 28.215 27.275 19.73 150-151 25.2375 28.037499999999998 26.3125 20.4125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.5 11 1.0 12 1.5 13 2.5 14 1.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 2.0 25 3.0 26 3.5 27 3.5 28 8.0 29 18.0 30 18.0 31 23.0 32 34.0 33 35.5 34 48.5 35 67.5 36 93.0 37 112.0 38 132.5 39 165.0 40 189.5 41 228.0 42 260.5 43 283.0 44 286.0 45 293.0 46 286.5 47 245.0 48 209.0 49 179.0 50 161.5 51 129.5 52 99.0 53 80.0 54 62.0 55 52.0 56 41.5 57 30.5 58 23.5 59 16.5 60 12.0 61 13.0 62 9.5 63 3.5 64 3.5 65 3.0 66 2.0 67 2.5 68 2.0 69 1.0 70 0.0 71 2.0 72 2.5 73 1.0 74 0.5 75 0.5 76 0.5 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 1.0 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.225 #Duplication Level Percentage of deduplicated Percentage of total 1 92.24722146923285 85.075 2 7.1021957169964764 13.100000000000001 3 0.623475196530225 1.725 4 0.02710761724044456 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0125 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.21250000000000002 0.0 0.0 0.0 0.0 112-113 0.225 0.0 0.0 0.0 0.0 114-115 0.3125 0.0 0.0 0.0 0.0 116-117 0.4 0.0 0.0 0.0 0.0 118-119 0.4625 0.0 0.0 0.0 0.0 120-121 0.4875 0.0 0.0 0.0 0.0 122-123 0.625 0.0 0.0 0.0 0.0 124-125 0.7625 0.0 0.0 0.0 0.0 126-127 0.9875 0.0 0.0 0.0 0.0 128-129 1.3625 0.0 0.0 0.0 0.0 130-131 1.6 0.0 0.0 0.0 0.0 132-133 2.0375 0.0 0.0 0.0 0.0 134-135 2.4375 0.0 0.0 0.0 0.0 136-137 3.075 0.0 0.0 0.0 0.0 138-139 3.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2177149 spots for SRR22215350.sra Written 2177149 spots for SRR22215350.sra Read 2177149 spots for SRR22215350.sra Written 2177149 spots for SRR22215350.sra Read 2177149 spots for SRR22215350.sra Written 2177149 spots for SRR22215350.sra Read 2177149 spots for SRR22215350.sra Written 2177149 spots for SRR22215350.sra Read 2177149 spots for SRR22215350.sra Written 2177149 spots for SRR22215350.sra Read 2177149 spots for SRR22215350.sra Written 2177149 spots for SRR22215350.sra Read 2177149 spots for SRR22215350.sra Written 2177149 spots for SRR22215350.sra Read 2177149 spots for SRR22215350.sra Written 2177149 spots for SRR22215350.sra Read 2177167 spots for SRR22215350.sra Written 2177167 spots for SRR22215350.sra Read 2177149 spots for SRR22215350.sra Written 2177149 spots for SRR22215350.sra Read 2177149 spots for SRR22215350.sra Written 2177149 spots for SRR22215350.sra Read 2177149 spots for SRR22215350.sra Written 2177149 spots for SRR22215350.sra Read 2177149 spots for SRR22215350.sra Written 2177149 spots for SRR22215350.sra Read 2177149 spots for SRR22215350.sra Written 2177149 spots for SRR22215350.sra Read 2177149 spots for SRR22215350.sra Written 2177149 spots for SRR22215350.sra Read 2177149 spots for SRR22215350.sra Written 2177149 spots for SRR22215350.sra Read 2177149 spots for SRR22215350.sra Written 2177149 spots for SRR22215350.sra Read 2177149 spots for SRR22215350.sra Written 2177149 spots for SRR22215350.sra Read 2177149 spots for SRR22215350.sra Written 2177149 spots for SRR22215350.sra Read 2177149 spots for SRR22215350.sra Written 2177149 spots for SRR22215350.sra SRR ids: ['SRR22215350.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y3bh466r SRR22215350.sra spots: 43542998 blocks: [[1, 2177149], [2177150, 4354298], [4354299, 6531447], [6531448, 8708596], [8708597, 10885745], [10885746, 13062894], [13062895, 15240043], [15240044, 17417192], [17417193, 19594341], [19594342, 21771490], [21771491, 23948639], [23948640, 26125788], [26125789, 28302937], [28302938, 30480086], [30480087, 32657235], [32657236, 34834384], [34834385, 37011533], [37011534, 39188682], [39188683, 41365831], [41365832, 43542998]] SRR22215350 file size 14776115 SRR22215350 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22215350 SRR22215350_1.fastq SRR22215350_2.fastq Input file: SRR22215350_1.fastq Paired file: SRR22215350_2.fastq trimmed: SRR22215350-trimmed-pair1.fastq, SRR22215350-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:36:33 2025 >> started Tue Feb 11 09:37:22 2025 >> done (49.957s) 43542998 read pairs processed; of these: 117 ( 0.00%) short read pairs filtered out after trimming by size control 20526 ( 0.05%) empty read pairs filtered out after trimming by size control 43522355 (99.95%) read pairs available; of these: 3959454 ( 9.10%) trimmed read pairs available after processing 39562901 (90.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 1 0.00% 20 1 0.00% 21 3 0.00% 22 6 0.00% 23 5 0.00% 24 4 0.00% 25 7 0.00% 26 6 0.00% 27 5 0.00% 28 4 0.00% 29 13 0.00% 30 6 0.00% 31 4 0.00% 32 5 0.00% 33 5 0.00% 34 7 0.00% 35 6 0.00% 36 15 0.00% 37 4 0.00% 38 14 0.00% 39 8 0.00% 40 9 0.00% 41 16 0.00% 42 15 0.00% 43 11 0.00% 44 9 0.00% 45 14 0.00% 46 22 0.00% 47 17 0.00% 48 14 0.00% 49 27 0.00% 50 29 0.00% 51 20 0.00% 52 23 0.00% 53 35 0.00% 54 36 0.00% 55 47 0.00% 56 42 0.00% 57 45 0.00% 58 43 0.00% 59 54 0.00% 60 53 0.00% 61 36 0.00% 62 68 0.00% 63 83 0.00% 64 104 0.00% 65 73 0.00% 66 127 0.00% 67 106 0.00% 68 128 0.00% 69 139 0.00% 70 156 0.00% 71 141 0.00% 72 162 0.00% 73 209 0.00% 74 230 0.00% 75 281 0.00% 76 264 0.00% 77 319 0.00% 78 315 0.00% 79 380 0.00% 80 374 0.00% 81 450 0.00% 82 527 0.00% 83 591 0.00% 84 599 0.00% 85 747 0.00% 86 778 0.00% 87 873 0.00% 88 999 0.00% 89 1155 0.00% 90 1181 0.00% 91 1314 0.00% 92 1431 0.00% 93 1615 0.00% 94 1772 0.00% 95 1878 0.00% 96 2097 0.00% 97 2378 0.01% 98 2508 0.01% 99 2689 0.01% 100 2932 0.01% 101 3289 0.01% 102 3481 0.01% 103 4059 0.01% 104 4340 0.01% 105 4812 0.01% 106 5309 0.01% 107 5918 0.01% 108 6605 0.02% 109 7500 0.02% 110 8033 0.02% 111 9028 0.02% 112 10244 0.02% 113 11419 0.03% 114 12884 0.03% 115 14566 0.03% 116 16410 0.04% 117 18820 0.04% 118 21249 0.05% 119 23700 0.05% 120 26409 0.06% 121 30183 0.07% 122 33218 0.08% 123 36659 0.08% 124 41678 0.10% 125 46220 0.11% 126 50534 0.12% 127 56520 0.13% 128 62910 0.14% 129 68500 0.16% 130 75567 0.17% 131 82160 0.19% 132 88612 0.20% 133 95262 0.22% 134 103080 0.24% 135 110037 0.25% 136 120149 0.28% 137 128643 0.30% 138 136986 0.31% 139 147084 0.34% 140 156897 0.36% 141 164288 0.38% 142 173199 0.40% 143 181364 0.42% 144 189088 0.43% 145 196760 0.45% 146 207146 0.48% 147 215329 0.49% 148 225643 0.52% 149 235722 0.54% 150 249016 0.57% 151 39562901 90.90% 43522355 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=3.20 fanout-score-rank=25 prefix-density=0.29 prefix-fanout=2.7 sequence=GAAGCAAAAATGTCCTTAGGAAGTAGCACCTTCTCAATCTTATAAATGGCTAGCTGGTTGTCCGTGTATACCGTGCCAGATAAACTTGTATTGGTAAGTCCTGTGGTTATGTTCACCGAGTTTGGATAACTTGT criterion=fanout-score sequence-density=0.10 sequence-density-rank=18 fanout-score=95.65 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=16.7 sequence=CCACCACCATGGGCTCCCCAGCCACCATAGGTGTCAATAATGATCTTGCGTCCAGTGAGACCTGCATCACCATGAGGACCACCAATAAC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.51 fanout-score-rank=30 prefix-density=0.26 prefix-fanout=2.4 sequence=ACAAGTTATCCAAACTCGGTGAACATAACCACAGGACTTACCAATACAAGTTTATCTGGCACGGTATACACGGACAACCAGCTAGCCATTTATAAGATTGAGAAGGTGCTACTTCCTAAGGACATTTTTGCTTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=136.47 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=8.5 sequence=TCTTCTCTCTGTCTTCTTGATTCCTTGTTTTTCGTTCTGTTTATTACAGCAGCAATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGAAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCCGCAAAGCCTGCAGAAACCGTGGCTGCTGCATAATGTTTATAATACCAATATTTACTATGTGAAACTGTGTTCTACTGGGTTATAGTTAGTTGGGCTTTCTATGATCATGATGTGGATTCTGGATATCCAGCATGCTTTTACTGGGATGTAAGCTATAATAATTTCTCTGGTACATTCATATGGTTATCTGTATTAT SRR22215350 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:38:26 Started mapping on | Feb 11 09:38:26 Finished on | Feb 11 09:42:20 Mapping speed, Million of reads per hour | 669.57 Number of input reads | 43522355 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 41121643 Uniquely mapped reads % | 94.48% Average mapped length | 298.57 Number of splices: Total | 33110215 Number of splices: Annotated (sjdb) | 32381762 Number of splices: GT/AG | 32592984 Number of splices: GC/AG | 407507 Number of splices: AT/AC | 40234 Number of splices: Non-canonical | 69490 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.02% Deletion average length | 2.23 Insertion rate per base | 0.02% Insertion average length | 1.91 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 851033 % of reads mapped to multiple loci | 1.96% Number of reads mapped to too many loci | 684075 % of reads mapped to too many loci | 1.57% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.54% % of reads unmapped: other | 0.45% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1549679 1549679 1549679 N_multimapping 851033 851033 851033 N_noFeature 1673296 40521626 1877811 N_ambiguous 577657 2481 180720 UnstrandedReadsAssigned:38870690 PositiveStrandReadsAssigned:597536 NegativeStrandReadsAssigned:39063112 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR22215350 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22215350-trimmed-pair1.fastq SRR22215350-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 43,522,355 reads, 39,837,175 reads pseudoaligned [quant] estimated average fragment length: 197.306 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,179 rounds 52401 SRR22215350.ke.tsv 34699 SRR22215350.se.tsv 87100 total ==> SRR22215350.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1821.69 2782 38.0639 Potri.005G024800.1.v4.1 1035 838.694 1019 30.2833 Potri.004G059700.1.v4.1 961 764.694 195 6.35593 Potri.007G009000.2.v4.1 1416 1219.69 0 0 Potri.003G141000.2.v4.1 2943 2746.69 879.42 7.98028 Potri.016G087400.1.v4.1 270 78.8739 1958 618.745 Potri.015G069301.1.v4.1 564 367.752 0 0 Potri.010G195200.1.v4.1 1773 1576.69 128 2.02346 Potri.012G127500.1.v4.1 977 780.694 5641 180.097 ==> SRR22215350.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2965 Potri.001G233950.v4.1 5 Potri.001G122700.v4.1 1025 Potri.001G212900.v4.1 13 Potri.001G182400.v4.1 408 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR22215350 completed mapping pipeline successfully