Starting /dee2/code/volunteer_pipeline.sh SRR22215351 current disk space = 3054274592768 free memory = 1492207708 SRR22215351 SRAfilesize 9265555641f87606d1bd73004fe1c93c SRR22215351.sra SRR22215351.sra file validated SRR22215351 is paired end SRR22215351 is conventional basespace SRR22215351 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215351_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.05575 37.0 37.0 37.0 37.0 37.0 2 36.022 37.0 37.0 37.0 37.0 37.0 3 36.208 37.0 37.0 37.0 37.0 37.0 4 36.2625 37.0 37.0 37.0 37.0 37.0 5 36.311 37.0 37.0 37.0 37.0 37.0 6 36.343 37.0 37.0 37.0 37.0 37.0 7 36.1915 37.0 37.0 37.0 37.0 37.0 8 36.2895 37.0 37.0 37.0 37.0 37.0 9 36.218 37.0 37.0 37.0 37.0 37.0 10-14 36.268 37.0 37.0 37.0 37.0 37.0 15-19 36.2697 37.0 37.0 37.0 37.0 37.0 20-24 36.2031 37.0 37.0 37.0 37.0 37.0 25-29 36.1109 37.0 37.0 37.0 37.0 37.0 30-34 36.0604 37.0 37.0 37.0 37.0 37.0 35-39 36.040499999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.0535 37.0 37.0 37.0 37.0 37.0 45-49 35.9676 37.0 37.0 37.0 37.0 37.0 50-54 35.857600000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.8697 37.0 37.0 37.0 37.0 37.0 60-64 35.819900000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.7861 37.0 37.0 37.0 37.0 37.0 70-74 35.7155 37.0 37.0 37.0 37.0 37.0 75-79 35.7308 37.0 37.0 37.0 37.0 37.0 80-84 35.7105 37.0 37.0 37.0 37.0 37.0 85-89 35.684400000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.6246 37.0 37.0 37.0 37.0 37.0 95-99 35.562200000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.5938 37.0 37.0 37.0 37.0 37.0 105-109 35.5359 37.0 37.0 37.0 37.0 37.0 110-114 35.4752 37.0 37.0 37.0 37.0 37.0 115-119 35.4959 37.0 37.0 37.0 37.0 37.0 120-124 35.47539999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.3488 37.0 37.0 37.0 37.0 37.0 130-134 35.3952 37.0 37.0 37.0 37.0 37.0 135-139 35.34739999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.2785 37.0 37.0 37.0 32.2 37.0 145-149 35.201499999999996 37.0 37.0 37.0 34.6 37.0 150-151 35.0095 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 1.0 20 0.0 21 1.0 22 3.0 23 4.0 24 3.0 25 8.0 26 13.0 27 20.0 28 29.0 29 40.0 30 53.0 31 91.0 32 85.0 33 126.0 34 200.0 35 462.0 36 2670.0 37 190.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.87553432235354 11.465929092280614 15.690218757857682 37.96831782750817 2 30.085170340681362 14.554108216432866 33.416833667334664 21.9438877755511 3 26.900000000000002 20.150000000000002 24.2 28.749999999999996 4 29.65 25.4 20.474999999999998 24.474999999999998 5 28.075 30.525000000000002 22.275 19.125 6 19.025 33.4 25.474999999999998 22.1 7 14.05 31.275 37.125 17.549999999999997 8 16.675 26.5 33.4 23.425 9 19.175 22.075 35.25 23.5 10-14 19.134999999999998 30.91 27.665 22.29 15-19 19.869999999999997 29.075 28.305000000000003 22.75 20-24 19.965 29.580000000000002 27.965 22.49 25-29 19.86 29.94 27.55 22.650000000000002 30-34 19.89 29.525000000000002 27.389999999999997 23.195 35-39 19.794999999999998 29.455 27.500000000000004 23.25 40-44 19.985 29.555 27.389999999999997 23.07 45-49 20.294999999999998 29.17 26.71 23.825 50-54 20.32 28.59 27.310000000000002 23.78 55-59 19.415 30.009999999999998 27.24 23.335 60-64 20.26 29.270000000000003 27.139999999999997 23.330000000000002 65-69 19.935 29.25 27.49 23.325000000000003 70-74 19.63 28.615000000000002 27.99 23.765 75-79 19.765 28.389999999999997 28.065 23.78 80-84 20.73 28.915000000000003 26.939999999999998 23.415 85-89 20.474999999999998 29.154999999999998 27.134999999999998 23.235 90-94 20.645 28.895 27.26 23.200000000000003 95-99 20.14 28.93 27.52 23.41 100-104 20.599999999999998 28.689999999999998 27.6 23.11 105-109 20.36 28.865000000000002 27.425 23.35 110-114 20.715 28.044999999999998 27.644999999999996 23.595 115-119 20.45 28.939999999999998 27.515 23.095 120-124 20.335 29.145 27.089999999999996 23.43 125-129 21.09 28.21 27.265 23.435 130-134 20.880000000000003 28.360000000000003 27.794999999999998 22.965 135-139 20.674999999999997 29.265 26.884999999999998 23.175 140-144 20.96 29.23 26.740000000000002 23.07 145-149 21.035 28.9 26.995 23.07 150-151 21.575 28.487499999999997 26.275 23.6625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 0.5 20 0.0 21 1.0 22 1.5 23 3.0 24 6.0 25 7.0 26 7.5 27 11.5 28 18.0 29 17.0 30 23.0 31 38.0 32 50.0 33 66.5 34 75.5 35 80.0 36 100.5 37 130.5 38 149.0 39 168.5 40 184.0 41 191.0 42 222.5 43 255.0 44 240.0 45 233.0 46 243.0 47 237.0 48 207.5 49 175.0 50 175.0 51 151.0 52 113.5 53 94.5 54 67.0 55 52.5 56 47.5 57 32.0 58 26.0 59 24.5 60 14.0 61 5.5 62 5.5 63 6.0 64 6.5 65 4.5 66 2.0 67 2.0 68 4.0 69 4.5 70 3.0 71 1.0 72 1.5 73 2.5 74 2.0 75 1.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.575 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.9 #Duplication Level Percentage of deduplicated Percentage of total 1 92.78794402583424 86.2 2 6.835306781485468 12.7 3 0.32292787944025836 0.8999999999999999 4 0.05382131324004305 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.3875 0.0 0.0 0.0 0.0 116-117 0.4375 0.0 0.0 0.0 0.0 118-119 0.5375 0.0 0.0 0.0 0.0 120-121 0.675 0.0 0.0 0.0 0.0 122-123 0.9 0.0 0.0 0.0 0.0 124-125 1.0625 0.0 0.0 0.0 0.0 126-127 1.275 0.0 0.0 0.0 0.0 128-129 1.65 0.0 0.0 0.0 0.0 130-131 1.9249999999999998 0.0 0.0 0.0 0.0 132-133 2.3375000000000004 0.0 0.0 0.0 0.0 134-135 2.8375 0.0 0.0 0.0 0.0 136-137 3.4875 0.0 0.0 0.0 0.0 138-139 4.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGATTGT 10 0.006830828 145.0 5 GCAGTGA 10 0.006830828 145.0 1 >>END_MODULE SRR22215351 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215351_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.506 37.0 37.0 37.0 37.0 37.0 2 36.031 37.0 37.0 37.0 37.0 37.0 3 35.9695 37.0 37.0 37.0 37.0 37.0 4 35.886 37.0 37.0 37.0 37.0 37.0 5 35.9425 37.0 37.0 37.0 37.0 37.0 6 35.832 37.0 37.0 37.0 37.0 37.0 7 35.947 37.0 37.0 37.0 37.0 37.0 8 35.852 37.0 37.0 37.0 37.0 37.0 9 36.034 37.0 37.0 37.0 37.0 37.0 10-14 35.9907 37.0 37.0 37.0 37.0 37.0 15-19 35.9058 37.0 37.0 37.0 37.0 37.0 20-24 35.8592 37.0 37.0 37.0 37.0 37.0 25-29 35.7565 37.0 37.0 37.0 37.0 37.0 30-34 35.7322 37.0 37.0 37.0 37.0 37.0 35-39 35.7427 37.0 37.0 37.0 37.0 37.0 40-44 35.6857 37.0 37.0 37.0 37.0 37.0 45-49 35.6124 37.0 37.0 37.0 37.0 37.0 50-54 35.5995 37.0 37.0 37.0 37.0 37.0 55-59 35.6173 37.0 37.0 37.0 37.0 37.0 60-64 35.5372 37.0 37.0 37.0 37.0 37.0 65-69 35.51819999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.4838 37.0 37.0 37.0 37.0 37.0 75-79 35.4199 37.0 37.0 37.0 37.0 37.0 80-84 35.39040000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.38719999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.3633 37.0 37.0 37.0 37.0 37.0 95-99 35.352700000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.2695 37.0 37.0 37.0 32.2 37.0 105-109 35.237100000000005 37.0 37.0 37.0 32.2 37.0 110-114 35.2284 37.0 37.0 37.0 27.4 37.0 115-119 35.104200000000006 37.0 37.0 37.0 27.4 37.0 120-124 35.0517 37.0 37.0 37.0 25.0 37.0 125-129 35.0318 37.0 37.0 37.0 25.0 37.0 130-134 34.905300000000004 37.0 37.0 37.0 25.0 37.0 135-139 34.932 37.0 37.0 37.0 25.0 37.0 140-144 34.8584 37.0 37.0 37.0 25.0 37.0 145-149 34.73 37.0 37.0 37.0 25.0 37.0 150-151 34.5895 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 3.0 15 2.0 16 1.0 17 2.0 18 0.0 19 2.0 20 1.0 21 1.0 22 4.0 23 10.0 24 10.0 25 15.0 26 19.0 27 32.0 28 38.0 29 43.0 30 55.0 31 68.0 32 76.0 33 131.0 34 287.0 35 745.0 36 2304.0 37 150.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.275000000000002 22.525000000000002 16.175 31.025000000000002 2 28.425 27.85 29.475 14.249999999999998 3 22.125 31.275 28.175 18.425 4 24.8 35.175 21.925 18.099999999999998 5 25.874999999999996 37.0 21.025 16.1 6 19.650000000000002 40.1 23.925 16.325 7 20.225 19.1 40.925 19.75 8 22.375 24.025 29.325000000000003 24.275 9 22.975 23.974999999999998 29.125 23.925 10-14 23.395 28.99 26.229999999999997 21.385 15-19 23.28 28.634999999999998 27.305 20.78 20-24 23.35 28.860000000000003 27.400000000000002 20.39 25-29 24.425 27.92 27.735 19.919999999999998 30-34 23.085 28.199999999999996 28.52 20.195 35-39 23.330000000000002 28.615000000000002 27.755000000000003 20.3 40-44 23.549999999999997 28.27 28.01 20.169999999999998 45-49 23.28 28.43 28.18 20.11 50-54 23.369999999999997 28.134999999999998 28.084999999999997 20.41 55-59 23.355 27.775 28.185 20.685000000000002 60-64 23.34 28.115000000000002 28.299999999999997 20.244999999999997 65-69 23.400000000000002 28.33 28.415000000000003 19.855 70-74 23.665 27.595 28.575 20.165 75-79 23.385 28.165000000000003 27.800000000000004 20.65 80-84 23.66 28.33 27.665 20.345 85-89 23.275000000000002 27.525 28.73 20.47 90-94 23.615 27.665 28.225 20.495 95-99 23.29 28.63 28.139999999999997 19.939999999999998 100-104 23.65 27.605 28.82 19.925 105-109 23.799999999999997 28.22 27.634999999999998 20.345 110-114 23.61 27.800000000000004 28.59 20.0 115-119 23.565 27.389999999999997 28.785 20.26 120-124 23.325000000000003 28.09 28.32 20.265 125-129 23.65 28.27 28.49 19.59 130-134 23.595 27.779999999999998 28.835 19.79 135-139 24.3 28.67 27.68 19.35 140-144 24.235 28.455000000000002 27.650000000000002 19.66 145-149 25.03 28.205000000000002 27.175 19.59 150-151 24.525 28.3625 28.012500000000003 19.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.0 18 0.5 19 1.5 20 2.0 21 1.5 22 1.5 23 2.5 24 3.5 25 3.0 26 5.5 27 9.0 28 10.0 29 15.0 30 19.5 31 24.5 32 30.0 33 38.5 34 67.0 35 97.5 36 107.0 37 120.5 38 141.0 39 172.0 40 199.5 41 208.0 42 226.5 43 256.5 44 288.5 45 279.0 46 254.5 47 237.5 48 217.0 49 202.0 50 157.0 51 110.0 52 91.0 53 85.0 54 71.5 55 55.5 56 41.5 57 26.0 58 18.5 59 14.5 60 14.0 61 13.5 62 11.5 63 9.5 64 6.5 65 3.5 66 3.0 67 3.0 68 2.0 69 1.0 70 1.5 71 1.5 72 1.0 73 1.0 74 0.5 75 0.0 76 0.5 77 1.0 78 0.5 79 1.0 80 1.0 81 0.0 82 1.5 83 1.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.175 #Duplication Level Percentage of deduplicated Percentage of total 1 93.21169841695733 86.85000000000001 2 6.359001878186208 11.85 3 0.32197477864233964 0.8999999999999999 4 0.10732492621411323 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.0 0.0 0.0 0.025 0.0 84-85 0.0 0.0 0.0 0.025 0.0 86-87 0.0 0.0 0.0 0.025 0.0 88-89 0.0 0.0 0.0 0.025 0.0 90-91 0.025 0.0 0.0 0.025 0.0 92-93 0.025 0.0 0.0 0.025 0.0 94-95 0.05 0.0 0.0 0.025 0.0 96-97 0.05 0.0 0.0 0.025 0.0 98-99 0.0625 0.0 0.0 0.025 0.0 100-101 0.1 0.0 0.0 0.025 0.0 102-103 0.1 0.0 0.0 0.025 0.0 104-105 0.1 0.0 0.0 0.025 0.0 106-107 0.125 0.0 0.0 0.025 0.0 108-109 0.15 0.0 0.0 0.025 0.0 110-111 0.175 0.0 0.0 0.025 0.0 112-113 0.2875 0.0 0.0 0.025 0.0 114-115 0.3875 0.0 0.0 0.025 0.0 116-117 0.4375 0.0 0.0 0.025 0.0 118-119 0.5375 0.0 0.0 0.025 0.0 120-121 0.675 0.0 0.0 0.025 0.0 122-123 0.9 0.0 0.0 0.025 0.0 124-125 1.0625 0.0 0.0 0.025 0.0 126-127 1.2875 0.0 0.0 0.025 0.0 128-129 1.6 0.0 0.0 0.025 0.0 130-131 1.9 0.0 0.0 0.025 0.0 132-133 2.3375000000000004 0.0 0.0 0.025 0.0 134-135 2.825 0.0 0.0 0.025 0.0 136-137 3.475 0.0 0.0 0.025 0.0 138-139 4.0 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTAAAT 10 0.006830828 145.0 1 GGGTCCC 10 0.006830828 145.0 8 GGTCCCA 10 0.006830828 145.0 9 AAAATGG 10 0.006830828 145.0 3 ACCTCAT 20 0.00593511 29.0 55-59 CCCCCCC 20 0.00593511 29.0 35-39 >>END_MODULE Read 1659723 spots for SRR22215351.sra Written 1659723 spots for SRR22215351.sra Read 1659723 spots for SRR22215351.sra Written 1659723 spots for SRR22215351.sra Read 1659723 spots for SRR22215351.sra Written 1659723 spots for SRR22215351.sra Read 1659723 spots for SRR22215351.sra Written 1659723 spots for SRR22215351.sra Read 1659723 spots for SRR22215351.sra Written 1659723 spots for SRR22215351.sra Read 1659723 spots for SRR22215351.sra Written 1659723 spots for SRR22215351.sra Read 1659723 spots for SRR22215351.sra Written 1659723 spots for SRR22215351.sra Read 1659723 spots for SRR22215351.sra Written 1659723 spots for SRR22215351.sra Read 1659723 spots for SRR22215351.sra Written 1659723 spots for SRR22215351.sra Read 1659723 spots for SRR22215351.sra Written 1659723 spots for SRR22215351.sra Read 1659723 spots for SRR22215351.sra Written 1659723 spots for SRR22215351.sra Read 1659723 spots for SRR22215351.sra Written 1659723 spots for SRR22215351.sra Read 1659723 spots for SRR22215351.sra Written 1659723 spots for SRR22215351.sra Read 1659723 spots for SRR22215351.sra Written 1659723 spots for SRR22215351.sra Read 1659723 spots for SRR22215351.sra Written 1659723 spots for SRR22215351.sra Read 1659723 spots for SRR22215351.sra Written 1659723 spots for SRR22215351.sra Read 1659723 spots for SRR22215351.sra Written 1659723 spots for SRR22215351.sra Read 1659732 spots for SRR22215351.sra Written 1659732 spots for SRR22215351.sra Read 1659723 spots for SRR22215351.sra Written 1659723 spots for SRR22215351.sra Read 1659723 spots for SRR22215351.sra Written 1659723 spots for SRR22215351.sra SRR ids: ['SRR22215351.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3ta9xoe_ SRR22215351.sra spots: 33194469 blocks: [[1, 1659723], [1659724, 3319446], [3319447, 4979169], [4979170, 6638892], [6638893, 8298615], [8298616, 9958338], [9958339, 11618061], [11618062, 13277784], [13277785, 14937507], [14937508, 16597230], [16597231, 18256953], [18256954, 19916676], [19916677, 21576399], [21576400, 23236122], [23236123, 24895845], [24895846, 26555568], [26555569, 28215291], [28215292, 29875014], [29875015, 31534737], [31534738, 33194469]] SRR22215351 file size 11259232 SRR22215351 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22215351 SRR22215351_1.fastq SRR22215351_2.fastq Input file: SRR22215351_1.fastq Paired file: SRR22215351_2.fastq trimmed: SRR22215351-trimmed-pair1.fastq, SRR22215351-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:54:45 2025 >> started Tue Feb 11 09:55:33 2025 >> done (48.256s) 33194469 read pairs processed; of these: 89 ( 0.00%) short read pairs filtered out after trimming by size control 30871 ( 0.09%) empty read pairs filtered out after trimming by size control 33163509 (99.91%) read pairs available; of these: 3430949 (10.35%) trimmed read pairs available after processing 29732560 (89.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 6 0.00% 20 5 0.00% 21 5 0.00% 22 3 0.00% 23 4 0.00% 24 4 0.00% 25 4 0.00% 26 1 0.00% 27 6 0.00% 28 7 0.00% 29 3 0.00% 30 3 0.00% 31 7 0.00% 32 6 0.00% 33 7 0.00% 34 8 0.00% 35 9 0.00% 36 8 0.00% 37 6 0.00% 38 8 0.00% 39 11 0.00% 40 12 0.00% 41 7 0.00% 42 9 0.00% 43 7 0.00% 44 25 0.00% 45 15 0.00% 46 16 0.00% 47 9 0.00% 48 20 0.00% 49 15 0.00% 50 23 0.00% 51 30 0.00% 52 27 0.00% 53 32 0.00% 54 23 0.00% 55 43 0.00% 56 38 0.00% 57 40 0.00% 58 34 0.00% 59 39 0.00% 60 51 0.00% 61 52 0.00% 62 56 0.00% 63 55 0.00% 64 67 0.00% 65 68 0.00% 66 82 0.00% 67 74 0.00% 68 89 0.00% 69 115 0.00% 70 142 0.00% 71 130 0.00% 72 155 0.00% 73 179 0.00% 74 188 0.00% 75 198 0.00% 76 244 0.00% 77 311 0.00% 78 285 0.00% 79 379 0.00% 80 343 0.00% 81 425 0.00% 82 426 0.00% 83 511 0.00% 84 544 0.00% 85 630 0.00% 86 696 0.00% 87 803 0.00% 88 861 0.00% 89 995 0.00% 90 1093 0.00% 91 1142 0.00% 92 1284 0.00% 93 1380 0.00% 94 1492 0.00% 95 1796 0.01% 96 1857 0.01% 97 2066 0.01% 98 2305 0.01% 99 2524 0.01% 100 2741 0.01% 101 2843 0.01% 102 3223 0.01% 103 3522 0.01% 104 3884 0.01% 105 4376 0.01% 106 4838 0.01% 107 5321 0.02% 108 5950 0.02% 109 6636 0.02% 110 7272 0.02% 111 8106 0.02% 112 8825 0.03% 113 9808 0.03% 114 11088 0.03% 115 12542 0.04% 116 14305 0.04% 117 15999 0.05% 118 18148 0.05% 119 20304 0.06% 120 23027 0.07% 121 25394 0.08% 122 28217 0.09% 123 31326 0.09% 124 35056 0.11% 125 38736 0.12% 126 43329 0.13% 127 48647 0.15% 128 54088 0.16% 129 59386 0.18% 130 66201 0.20% 131 71171 0.21% 132 76471 0.23% 133 81618 0.25% 134 88283 0.27% 135 95446 0.29% 136 103289 0.31% 137 111511 0.34% 138 119652 0.36% 139 129095 0.39% 140 136191 0.41% 141 144470 0.44% 142 150652 0.45% 143 158283 0.48% 144 162837 0.49% 145 171620 0.52% 146 178538 0.54% 147 186448 0.56% 148 196452 0.59% 149 203580 0.61% 150 215523 0.65% 151 29732560 89.65% 33163509 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.64 fanout-score-rank=38 prefix-density=0.15 prefix-fanout=2.5 sequence=CTCCACACTTGTA criterion=fanout-score sequence-density=0.07 sequence-density-rank=14 fanout-score=313.83 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=30.3 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=5.73 fanout-score-rank=26 prefix-density=0.15 prefix-fanout=3.9 sequence=AAGATCCAGGACAAGGAAGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=19 fanout-score=358.55 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=30.4 sequence=AAGAAGAAGAAG SRR22215351 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:56:14 Started mapping on | Feb 11 09:56:14 Finished on | Feb 11 09:59:18 Mapping speed, Million of reads per hour | 648.85 Number of input reads | 33163509 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 31169690 Uniquely mapped reads % | 93.99% Average mapped length | 298.11 Number of splices: Total | 25184425 Number of splices: Annotated (sjdb) | 24634508 Number of splices: GT/AG | 24795022 Number of splices: GC/AG | 305439 Number of splices: AT/AC | 30303 Number of splices: Non-canonical | 53661 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.18 Insertion rate per base | 0.02% Insertion average length | 1.89 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 672950 % of reads mapped to multiple loci | 2.03% Number of reads mapped to too many loci | 529066 % of reads mapped to too many loci | 1.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.90% % of reads unmapped: other | 0.49% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1320869 1320869 1320869 N_multimapping 672950 672950 672950 N_noFeature 1343206 30755020 1516584 N_ambiguous 385745 2257 142969 UnstrandedReadsAssigned:29440739 PositiveStrandReadsAssigned:412413 NegativeStrandReadsAssigned:29510137 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR22215351 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22215351-trimmed-pair1.fastq SRR22215351-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,163,509 reads, 30,202,089 reads pseudoaligned [quant] estimated average fragment length: 193.867 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,122 rounds 52401 SRR22215351.ke.tsv 34699 SRR22215351.se.tsv 87100 total ==> SRR22215351.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1825.13 3846 69.5472 Potri.005G024800.1.v4.1 1035 842.133 1022 40.053 Potri.004G059700.1.v4.1 961 768.133 26 1.11712 Potri.007G009000.2.v4.1 1416 1223.13 1 0.0269831 Potri.003G141000.2.v4.1 2943 2750.13 774.59 9.29573 Potri.016G087400.1.v4.1 270 81.9861 1620 652.138 Potri.015G069301.1.v4.1 564 371.18 0 0 Potri.010G195200.1.v4.1 1773 1580.13 114 2.38109 Potri.012G127500.1.v4.1 977 784.133 5763 242.563 ==> SRR22215351.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1905 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 660 Potri.001G212900.v4.1 11 Potri.001G182400.v4.1 65 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR22215351 completed mapping pipeline successfully