Starting /dee2/code/volunteer_pipeline.sh SRR22215352 current disk space = 3052843798528 free memory = 1578148048 SRR22215352 SRAfilesize ff8cd9bbc66c7dec9b74824aa10efbe4 SRR22215352.sra SRR22215352.sra file validated SRR22215352 is paired end SRR22215352 is conventional basespace SRR22215352 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215352_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0155 37.0 37.0 37.0 37.0 37.0 2 36.05425 37.0 37.0 37.0 37.0 37.0 3 36.195 37.0 37.0 37.0 37.0 37.0 4 36.2475 37.0 37.0 37.0 37.0 37.0 5 36.339 37.0 37.0 37.0 37.0 37.0 6 36.239 37.0 37.0 37.0 37.0 37.0 7 36.1305 37.0 37.0 37.0 37.0 37.0 8 36.3525 37.0 37.0 37.0 37.0 37.0 9 36.278 37.0 37.0 37.0 37.0 37.0 10-14 36.299099999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.2542 37.0 37.0 37.0 37.0 37.0 20-24 36.185500000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.1169 37.0 37.0 37.0 37.0 37.0 30-34 36.03530000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.01809999999999 37.0 37.0 37.0 37.0 37.0 40-44 35.8755 37.0 37.0 37.0 37.0 37.0 45-49 35.804700000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.810199999999995 37.0 37.0 37.0 37.0 37.0 55-59 35.7185 37.0 37.0 37.0 37.0 37.0 60-64 35.6401 37.0 37.0 37.0 37.0 37.0 65-69 35.6275 37.0 37.0 37.0 37.0 37.0 70-74 35.699 37.0 37.0 37.0 37.0 37.0 75-79 35.713499999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.669599999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.659200000000006 37.0 37.0 37.0 37.0 37.0 90-94 35.5912 37.0 37.0 37.0 37.0 37.0 95-99 35.5255 37.0 37.0 37.0 37.0 37.0 100-104 35.527100000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.417 37.0 37.0 37.0 37.0 37.0 110-114 35.3915 37.0 37.0 37.0 37.0 37.0 115-119 35.4219 37.0 37.0 37.0 37.0 37.0 120-124 35.3357 37.0 37.0 37.0 34.6 37.0 125-129 35.3746 37.0 37.0 37.0 37.0 37.0 130-134 35.251999999999995 37.0 37.0 37.0 29.8 37.0 135-139 35.273399999999995 37.0 37.0 37.0 29.8 37.0 140-144 35.169399999999996 37.0 37.0 37.0 27.4 37.0 145-149 35.088 37.0 37.0 37.0 25.0 37.0 150-151 34.881249999999994 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 0.0 23 5.0 24 6.0 25 16.0 26 15.0 27 23.0 28 33.0 29 50.0 30 50.0 31 73.0 32 95.0 33 153.0 34 208.0 35 465.0 36 2605.0 37 201.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.012054244098444 12.154696132596685 18.45806127574083 33.37518834756404 2 28.49260095309757 15.475294707800352 30.875344870830197 25.156759468271883 3 24.625 22.75 25.374999999999996 27.250000000000004 4 27.825 26.75 20.375 25.05 5 25.224999999999998 31.45 24.2 19.125 6 17.275 34.9 25.8 22.025 7 13.625000000000002 30.8 37.675 17.9 8 15.475 27.200000000000003 33.300000000000004 24.025 9 18.6 23.775 31.724999999999998 25.900000000000002 10-14 17.82 32.565 27.065 22.55 15-19 18.695 30.314999999999998 27.61 23.380000000000003 20-24 19.05 30.099999999999998 27.889999999999997 22.96 25-29 18.915000000000003 30.305 27.544999999999998 23.235 30-34 18.575 30.455 27.400000000000002 23.57 35-39 19.125 30.675 27.015 23.185 40-44 19.245 30.505 27.639999999999997 22.61 45-49 19.355 29.609999999999996 27.595 23.44 50-54 19.265 30.285 26.905 23.544999999999998 55-59 19.165 29.785 27.66 23.39 60-64 19.045 30.175 27.33 23.45 65-69 19.025 30.23 27.21 23.535 70-74 20.05 29.475 27.229999999999997 23.244999999999997 75-79 19.465 29.835 26.979999999999997 23.72 80-84 20.175 29.095 27.025 23.705000000000002 85-89 19.625 29.835 27.250000000000004 23.29 90-94 19.73 28.555000000000003 27.85 23.865 95-99 20.035 28.95 27.35 23.665 100-104 20.27 29.26 26.795 23.674999999999997 105-109 19.88 29.005 27.67 23.445 110-114 20.115 29.17 27.375 23.34 115-119 19.475 29.270000000000003 27.505000000000003 23.75 120-124 20.005 29.085 27.224999999999998 23.685000000000002 125-129 20.119999999999997 28.865000000000002 27.694999999999997 23.32 130-134 21.0 28.98 26.384999999999998 23.635 135-139 21.135 28.854999999999997 26.16 23.849999999999998 140-144 20.71 28.935 26.790000000000003 23.565 145-149 21.740000000000002 29.189999999999998 25.905 23.165 150-151 20.775 29.375 25.874999999999996 23.974999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.5 2 0.5 3 0.5 4 1.0 5 1.0 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.5 19 1.0 20 1.5 21 4.0 22 3.0 23 4.5 24 8.5 25 8.0 26 12.0 27 16.5 28 24.5 29 39.5 30 50.5 31 56.5 32 67.0 33 76.5 34 84.0 35 98.5 36 125.5 37 137.0 38 147.0 39 188.5 40 194.5 41 207.0 42 232.5 43 225.5 44 218.0 45 204.0 46 199.5 47 201.0 48 189.0 49 166.5 50 133.0 51 114.5 52 102.0 53 85.0 54 68.5 55 51.5 56 48.0 57 36.5 58 28.0 59 23.5 60 14.5 61 11.5 62 10.5 63 5.5 64 5.5 65 7.5 66 8.5 67 10.0 68 8.5 69 8.5 70 6.5 71 4.0 72 2.5 73 1.5 74 1.5 75 1.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.05 #Duplication Level Percentage of deduplicated Percentage of total 1 92.36827810972298 85.02499999999999 2 7.088538837588267 13.05 3 0.43454644215100485 1.2 4 0.05431830526887561 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05431830526887561 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCGCGTATGC 11 0.27499999999999997 TruSeq Adapter, Index 5 (98% over 50bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC 10 0.25 TruSeq Adapter, Index 5 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.3375 0.0 0.0 0.0 0.0 114-115 0.3625 0.0 0.0 0.0 0.0 116-117 0.525 0.0 0.0 0.0 0.0 118-119 0.7250000000000001 0.0 0.0 0.0 0.0 120-121 0.9125000000000001 0.0 0.0 0.0 0.0 122-123 1.075 0.0 0.0 0.0 0.0 124-125 1.275 0.0 0.0 0.0 0.0 126-127 1.6375000000000002 0.0 0.0 0.0 0.0 128-129 1.9625000000000001 0.0 0.0 0.0 0.0 130-131 2.4875 0.0 0.0 0.0 0.0 132-133 2.8625 0.0 0.0 0.0 0.0 134-135 3.4875 0.0 0.0 0.0 0.0 136-137 4.1 0.0 0.0 0.0 0.0 138-139 4.800000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGATGC 10 0.006333164 148.66666 1 >>END_MODULE SRR22215352 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215352_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.741 37.0 37.0 37.0 37.0 37.0 2 36.2545 37.0 37.0 37.0 37.0 37.0 3 36.1785 37.0 37.0 37.0 37.0 37.0 4 35.9955 37.0 37.0 37.0 37.0 37.0 5 36.0935 37.0 37.0 37.0 37.0 37.0 6 36.138 37.0 37.0 37.0 37.0 37.0 7 36.057 37.0 37.0 37.0 37.0 37.0 8 36.165 37.0 37.0 37.0 37.0 37.0 9 36.1545 37.0 37.0 37.0 37.0 37.0 10-14 36.113 37.0 37.0 37.0 37.0 37.0 15-19 36.0707 37.0 37.0 37.0 37.0 37.0 20-24 35.98350000000001 37.0 37.0 37.0 37.0 37.0 25-29 35.94840000000001 37.0 37.0 37.0 37.0 37.0 30-34 35.85510000000001 37.0 37.0 37.0 37.0 37.0 35-39 35.8154 37.0 37.0 37.0 37.0 37.0 40-44 35.7784 37.0 37.0 37.0 37.0 37.0 45-49 35.697199999999995 37.0 37.0 37.0 37.0 37.0 50-54 35.734500000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.708000000000006 37.0 37.0 37.0 37.0 37.0 60-64 35.644 37.0 37.0 37.0 37.0 37.0 65-69 35.5595 37.0 37.0 37.0 37.0 37.0 70-74 35.6418 37.0 37.0 37.0 37.0 37.0 75-79 35.5538 37.0 37.0 37.0 37.0 37.0 80-84 35.5591 37.0 37.0 37.0 37.0 37.0 85-89 35.5781 37.0 37.0 37.0 37.0 37.0 90-94 35.5201 37.0 37.0 37.0 37.0 37.0 95-99 35.5392 37.0 37.0 37.0 37.0 37.0 100-104 35.4681 37.0 37.0 37.0 37.0 37.0 105-109 35.537 37.0 37.0 37.0 37.0 37.0 110-114 35.4666 37.0 37.0 37.0 37.0 37.0 115-119 35.4345 37.0 37.0 37.0 37.0 37.0 120-124 35.3403 37.0 37.0 37.0 32.2 37.0 125-129 35.278999999999996 37.0 37.0 37.0 32.2 37.0 130-134 35.2436 37.0 37.0 37.0 32.2 37.0 135-139 35.1871 37.0 37.0 37.0 27.4 37.0 140-144 35.0663 37.0 37.0 37.0 27.4 37.0 145-149 35.00320000000001 37.0 37.0 37.0 25.0 37.0 150-151 34.99525 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 0.0 16 1.0 17 0.0 18 0.0 19 2.0 20 5.0 21 4.0 22 5.0 23 5.0 24 15.0 25 10.0 26 23.0 27 26.0 28 22.0 29 29.0 30 50.0 31 50.0 32 82.0 33 121.0 34 226.0 35 658.0 36 2416.0 37 247.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.975 22.0 17.75 27.275 2 28.025 28.125 29.599999999999998 14.249999999999998 3 23.825 32.1 27.325 16.75 4 26.924999999999997 34.025 21.975 17.075000000000003 5 26.775 37.974999999999994 20.175 15.075 6 20.150000000000002 39.175 23.05 17.625 7 20.45 20.125 40.675 18.75 8 23.75 23.599999999999998 28.849999999999998 23.799999999999997 9 24.975 23.825 28.075 23.125 10-14 25.095 28.71 25.874999999999996 20.32 15-19 24.58 28.21 28.08 19.13 20-24 25.045 28.050000000000004 27.51 19.395 25-29 24.945 28.74 27.279999999999998 19.035 30-34 24.455 28.050000000000004 27.779999999999998 19.715 35-39 24.75 26.93 29.244999999999997 19.075 40-44 24.8 28.16 28.084999999999997 18.955 45-49 24.345 27.405 29.025000000000002 19.225 50-54 24.945 27.925 27.595 19.535 55-59 23.985 28.444999999999997 28.475 19.095000000000002 60-64 24.19 27.839999999999996 28.625 19.345000000000002 65-69 23.835 27.965 28.52 19.68 70-74 24.43 27.91 28.12 19.54 75-79 24.09 27.915 28.665000000000003 19.33 80-84 25.11 27.255000000000003 28.76 18.875 85-89 24.64 27.68 28.4 19.28 90-94 24.555 27.529999999999998 28.865000000000002 19.05 95-99 24.445 27.555000000000003 28.815 19.185 100-104 24.505 26.88 29.54 19.075 105-109 24.115000000000002 27.589999999999996 28.799999999999997 19.495 110-114 24.095 28.189999999999998 28.735 18.98 115-119 24.490000000000002 27.834999999999997 28.705000000000002 18.970000000000002 120-124 23.785 27.58 29.715000000000003 18.92 125-129 24.535 27.445000000000004 28.725 19.295 130-134 24.834999999999997 27.534999999999997 29.160000000000004 18.47 135-139 24.555 27.55 29.24 18.655 140-144 24.92 27.994999999999997 28.71 18.375 145-149 24.805 27.815 28.76 18.62 150-151 25.687500000000004 28.225 27.575 18.512500000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.5 14 1.0 15 1.0 16 0.5 17 0.5 18 0.5 19 1.0 20 2.0 21 2.0 22 2.0 23 3.0 24 4.5 25 3.5 26 4.0 27 9.5 28 13.0 29 18.0 30 22.5 31 27.0 32 37.5 33 50.5 34 71.5 35 97.0 36 116.0 37 127.5 38 151.5 39 168.5 40 185.5 41 224.0 42 243.0 43 256.0 44 255.0 45 247.0 46 245.0 47 220.5 48 196.5 49 175.0 50 149.5 51 124.5 52 101.5 53 89.5 54 77.0 55 54.0 56 35.5 57 30.5 58 24.5 59 17.5 60 13.0 61 9.0 62 12.5 63 11.5 64 6.0 65 3.0 66 1.5 67 2.5 68 3.0 69 3.5 70 3.0 71 2.5 72 4.0 73 3.5 74 1.5 75 1.5 76 2.0 77 1.0 78 1.5 79 2.0 80 0.5 81 0.0 82 0.0 83 0.0 84 1.0 85 1.5 86 1.5 87 1.5 88 2.5 89 2.0 90 0.0 91 0.5 92 0.5 93 1.0 94 1.0 95 0.0 96 0.0 97 0.0 98 1.0 99 1.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.35 #Duplication Level Percentage of deduplicated Percentage of total 1 92.36599891716297 85.3 2 7.038440714672442 13.0 3 0.5414185165132648 1.5 4 0.05414185165132648 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0125 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.0 0.0 0.0 0.025 0.0 84-85 0.0 0.0 0.0 0.025 0.0 86-87 0.0 0.0 0.0 0.025 0.0 88-89 0.0125 0.0 0.0 0.025 0.0 90-91 0.037500000000000006 0.0 0.0 0.025 0.0 92-93 0.0625 0.0 0.0 0.025 0.0 94-95 0.075 0.0 0.0 0.025 0.0 96-97 0.075 0.0 0.0 0.025 0.0 98-99 0.075 0.0 0.0 0.025 0.0 100-101 0.1 0.0 0.0 0.025 0.0 102-103 0.15 0.0 0.0 0.025 0.0 104-105 0.15 0.0 0.0 0.025 0.0 106-107 0.15 0.0 0.0 0.025 0.0 108-109 0.175 0.0 0.0 0.025 0.0 110-111 0.23750000000000002 0.0 0.0 0.025 0.0 112-113 0.3375 0.0 0.0 0.025 0.0 114-115 0.3625 0.0 0.0 0.025 0.0 116-117 0.525 0.0 0.0 0.025 0.0 118-119 0.7250000000000001 0.0 0.0 0.025 0.0 120-121 0.925 0.0 0.0 0.025 0.0 122-123 1.1 0.0 0.0 0.025 0.0 124-125 1.3 0.0 0.0 0.025 0.0 126-127 1.6875 0.0 0.0 0.025 0.0 128-129 2.0375 0.0 0.0 0.025 0.0 130-131 2.5625 0.0 0.0 0.025 0.0 132-133 2.9625000000000004 0.0 0.0 0.025 0.0 134-135 3.5875 0.0 0.0 0.025 0.0 136-137 4.199999999999999 0.0 0.0 0.025 0.0 138-139 4.9 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGAGA 10 0.006830828 145.0 5 >>END_MODULE Read 1493686 spots for SRR22215352.sra Written 1493686 spots for SRR22215352.sra Read 1493686 spots for SRR22215352.sra Written 1493686 spots for SRR22215352.sra Read 1493686 spots for SRR22215352.sra Written 1493686 spots for SRR22215352.sra Read 1493686 spots for SRR22215352.sra Written 1493686 spots for SRR22215352.sra Read 1493686 spots for SRR22215352.sra Written 1493686 spots for SRR22215352.sra Read 1493686 spots for SRR22215352.sra Written 1493686 spots for SRR22215352.sra Read 1493686 spots for SRR22215352.sra Written 1493686 spots for SRR22215352.sra Read 1493686 spots for SRR22215352.sra Written 1493686 spots for SRR22215352.sra Read 1493686 spots for SRR22215352.sra Written 1493686 spots for SRR22215352.sra Read 1493686 spots for SRR22215352.sra Written 1493686 spots for SRR22215352.sra Read 1493686 spots for SRR22215352.sra Written 1493686 spots for SRR22215352.sra Read 1493686 spots for SRR22215352.sra Written 1493686 spots for SRR22215352.sra Read 1493686 spots for SRR22215352.sra Written 1493686 spots for SRR22215352.sra Read 1493686 spots for SRR22215352.sra Written 1493686 spots for SRR22215352.sra Read 1493686 spots for SRR22215352.sra Written 1493686 spots for SRR22215352.sra Read 1493686 spots for SRR22215352.sra Written 1493686 spots for SRR22215352.sra Read 1493686 spots for SRR22215352.sra Written 1493686 spots for SRR22215352.sra Read 1493699 spots for SRR22215352.sra Written 1493699 spots for SRR22215352.sra Read 1493686 spots for SRR22215352.sra Written 1493686 spots for SRR22215352.sra Read 1493686 spots for SRR22215352.sra Written 1493686 spots for SRR22215352.sra SRR ids: ['SRR22215352.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_04w0qpgz SRR22215352.sra spots: 29873733 blocks: [[1, 1493686], [1493687, 2987372], [2987373, 4481058], [4481059, 5974744], [5974745, 7468430], [7468431, 8962116], [8962117, 10455802], [10455803, 11949488], [11949489, 13443174], [13443175, 14936860], [14936861, 16430546], [16430547, 17924232], [17924233, 19417918], [19417919, 20911604], [20911605, 22405290], [22405291, 23898976], [23898977, 25392662], [25392663, 26886348], [26886349, 28380034], [28380035, 29873733]] SRR22215352 file size 10130701 SRR22215352 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22215352 SRR22215352_1.fastq SRR22215352_2.fastq Input file: SRR22215352_1.fastq Paired file: SRR22215352_2.fastq trimmed: SRR22215352-trimmed-pair1.fastq, SRR22215352-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:56:01 2025 >> started Tue Feb 11 10:56:48 2025 >> done (47.177s) 29873733 read pairs processed; of these: 383 ( 0.00%) short read pairs filtered out after trimming by size control 206717 ( 0.69%) empty read pairs filtered out after trimming by size control 29666633 (99.31%) read pairs available; of these: 3666552 (12.36%) trimmed read pairs available after processing 26000081 (87.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 16 0.00% 20 7 0.00% 21 12 0.00% 22 7 0.00% 23 4 0.00% 24 5 0.00% 25 10 0.00% 26 16 0.00% 27 21 0.00% 28 12 0.00% 29 80 0.00% 30 11 0.00% 31 21 0.00% 32 12 0.00% 33 11 0.00% 34 23 0.00% 35 14 0.00% 36 11 0.00% 37 11 0.00% 38 12 0.00% 39 14 0.00% 40 20 0.00% 41 16 0.00% 42 21 0.00% 43 25 0.00% 44 28 0.00% 45 22 0.00% 46 25 0.00% 47 38 0.00% 48 41 0.00% 49 56 0.00% 50 29 0.00% 51 44 0.00% 52 48 0.00% 53 69 0.00% 54 40 0.00% 55 85 0.00% 56 64 0.00% 57 45 0.00% 58 71 0.00% 59 76 0.00% 60 57 0.00% 61 68 0.00% 62 75 0.00% 63 83 0.00% 64 70 0.00% 65 95 0.00% 66 121 0.00% 67 113 0.00% 68 118 0.00% 69 159 0.00% 70 173 0.00% 71 187 0.00% 72 186 0.00% 73 206 0.00% 74 209 0.00% 75 263 0.00% 76 290 0.00% 77 307 0.00% 78 356 0.00% 79 408 0.00% 80 435 0.00% 81 493 0.00% 82 535 0.00% 83 573 0.00% 84 713 0.00% 85 747 0.00% 86 862 0.00% 87 901 0.00% 88 1008 0.00% 89 1142 0.00% 90 1238 0.00% 91 1335 0.00% 92 1510 0.01% 93 1582 0.01% 94 1921 0.01% 95 2093 0.01% 96 2257 0.01% 97 2556 0.01% 98 2686 0.01% 99 3043 0.01% 100 3202 0.01% 101 3515 0.01% 102 3907 0.01% 103 4155 0.01% 104 4665 0.02% 105 5196 0.02% 106 5803 0.02% 107 6319 0.02% 108 7040 0.02% 109 7609 0.03% 110 8230 0.03% 111 9183 0.03% 112 10287 0.03% 113 11296 0.04% 114 12957 0.04% 115 14727 0.05% 116 16480 0.06% 117 18104 0.06% 118 20566 0.07% 119 22910 0.08% 120 25447 0.09% 121 28355 0.10% 122 31348 0.11% 123 34658 0.12% 124 38543 0.13% 125 42879 0.14% 126 48337 0.16% 127 53536 0.18% 128 59433 0.20% 129 65012 0.22% 130 71291 0.24% 131 77501 0.26% 132 82993 0.28% 133 89462 0.30% 134 96333 0.32% 135 103061 0.35% 136 111221 0.37% 137 119375 0.40% 138 128044 0.43% 139 138202 0.47% 140 143031 0.48% 141 150649 0.51% 142 159209 0.54% 143 166001 0.56% 144 173912 0.59% 145 179887 0.61% 146 187290 0.63% 147 194808 0.66% 148 203061 0.68% 149 212623 0.72% 150 222522 0.75% 151 26000081 87.64% 29666633 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=4.23 fanout-score-rank=17 prefix-density=0.33 prefix-fanout=3.5 sequence=GGTGCTGGAGCTGGAGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=46.10 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=9.1 sequence=AACAATCTTACATCAAATTACAAGCACGTATGGTCTTGTAATATTTGCAGTAAACCGAGCTTTTTTTTCTAAAAAGGAAGAAAAACAGTAGATGGACATAACCAAACAAGCCACACATCAAGCATCATCATCACCGTTCTATAGAACACAAGAATACTGCCTGCTGCCCTACTGGGAAGCACTCTCCTTTTCTTTCTCCTTCT criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=4.62 fanout-score-rank=18 prefix-density=0.32 prefix-fanout=3.3 sequence=ATCCAGAAGGAGTCCACCCT criterion=fanout-score sequence-density=0.07 sequence-density-rank=31 fanout-score=264.08 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=26.0 sequence=TGATGATGAAGATGA SRR22215352 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:57:30 Started mapping on | Feb 11 10:57:30 Finished on | Feb 11 11:00:34 Mapping speed, Million of reads per hour | 580.43 Number of input reads | 29666633 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 27478736 Uniquely mapped reads % | 92.63% Average mapped length | 297.41 Number of splices: Total | 17899233 Number of splices: Annotated (sjdb) | 17468204 Number of splices: GT/AG | 17606237 Number of splices: GC/AG | 218583 Number of splices: AT/AC | 23772 Number of splices: Non-canonical | 50641 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.22 Insertion rate per base | 0.02% Insertion average length | 1.81 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 631787 % of reads mapped to multiple loci | 2.13% Number of reads mapped to too many loci | 525946 % of reads mapped to too many loci | 1.77% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.86% % of reads unmapped: other | 0.61% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1556110 1556110 1556110 N_multimapping 631787 631787 631787 N_noFeature 1077753 27036931 1207918 N_ambiguous 451096 1784 138896 UnstrandedReadsAssigned:25949887 PositiveStrandReadsAssigned:440021 NegativeStrandReadsAssigned:26131922 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR22215352 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22215352-trimmed-pair1.fastq SRR22215352-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,666,633 reads, 26,795,269 reads pseudoaligned [quant] estimated average fragment length: 190.292 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,162 rounds 52401 SRR22215352.ke.tsv 34699 SRR22215352.se.tsv 87100 total ==> SRR22215352.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1828.71 3613 68.0058 Potri.005G024800.1.v4.1 1035 845.708 4425 180.101 Potri.004G059700.1.v4.1 961 771.708 319 14.2285 Potri.007G009000.2.v4.1 1416 1226.71 0 0 Potri.003G141000.2.v4.1 2943 2753.71 684 8.54989 Potri.016G087400.1.v4.1 270 84.9486 1450.35 587.677 Potri.015G069301.1.v4.1 564 374.742 0 0 Potri.010G195200.1.v4.1 1773 1583.71 43 0.934579 Potri.012G127500.1.v4.1 977 787.708 7698 336.384 ==> SRR22215352.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1435 Potri.001G233950.v4.1 6 Potri.001G122700.v4.1 596 Potri.001G212900.v4.1 13 Potri.001G182400.v4.1 232 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 21 SRR22215352 completed mapping pipeline successfully