Starting /dee2/code/volunteer_pipeline.sh SRR22215353 current disk space = 3052633489408 free memory = 1570525752 SRR22215353 SRAfilesize 473c86e6db2e9912bcf86d03abab0f2f SRR22215353.sra SRR22215353.sra file validated SRR22215353 is paired end SRR22215353 is conventional basespace SRR22215353 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215353_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.895 37.0 37.0 37.0 37.0 37.0 2 36.106 37.0 37.0 37.0 37.0 37.0 3 36.2595 37.0 37.0 37.0 37.0 37.0 4 36.284 37.0 37.0 37.0 37.0 37.0 5 36.3775 37.0 37.0 37.0 37.0 37.0 6 36.3785 37.0 37.0 37.0 37.0 37.0 7 36.3145 37.0 37.0 37.0 37.0 37.0 8 36.2335 37.0 37.0 37.0 37.0 37.0 9 36.255 37.0 37.0 37.0 37.0 37.0 10-14 36.3533 37.0 37.0 37.0 37.0 37.0 15-19 36.3357 37.0 37.0 37.0 37.0 37.0 20-24 36.2867 37.0 37.0 37.0 37.0 37.0 25-29 36.175000000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.13470000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.0945 37.0 37.0 37.0 37.0 37.0 40-44 35.9572 37.0 37.0 37.0 37.0 37.0 45-49 35.9221 37.0 37.0 37.0 37.0 37.0 50-54 35.8428 37.0 37.0 37.0 37.0 37.0 55-59 35.7274 37.0 37.0 37.0 37.0 37.0 60-64 35.58540000000001 37.0 37.0 37.0 37.0 37.0 65-69 35.5723 37.0 37.0 37.0 37.0 37.0 70-74 35.7797 37.0 37.0 37.0 37.0 37.0 75-79 35.8317 37.0 37.0 37.0 37.0 37.0 80-84 35.7682 37.0 37.0 37.0 37.0 37.0 85-89 35.7673 37.0 37.0 37.0 37.0 37.0 90-94 35.695299999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.6503 37.0 37.0 37.0 37.0 37.0 100-104 35.618100000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.603699999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.6242 37.0 37.0 37.0 37.0 37.0 115-119 35.5642 37.0 37.0 37.0 37.0 37.0 120-124 35.4568 37.0 37.0 37.0 37.0 37.0 125-129 35.437 37.0 37.0 37.0 37.0 37.0 130-134 35.4602 37.0 37.0 37.0 37.0 37.0 135-139 35.477999999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.3743 37.0 37.0 37.0 37.0 37.0 145-149 35.2894 37.0 37.0 37.0 32.2 37.0 150-151 35.19075 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 2.0 22 2.0 23 3.0 24 1.0 25 6.0 26 14.0 27 18.0 28 28.0 29 31.0 30 55.0 31 68.0 32 86.0 33 165.0 34 201.0 35 469.0 36 2643.0 37 206.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.516129032258064 11.643145161290322 16.910282258064516 31.930443548387093 2 29.90466633216257 15.127947817360763 29.90466633216257 25.062719518314097 3 25.95 20.349999999999998 26.450000000000003 27.250000000000004 4 28.525 25.025 21.475 24.975 5 28.549999999999997 29.875 22.95 18.625 6 19.425 33.475 24.8 22.3 7 14.099999999999998 31.1 37.4 17.4 8 15.45 28.375 32.15 24.025 9 18.025 25.0 33.1 23.875 10-14 18.625 32.26 27.21 21.905 15-19 18.875 30.159999999999997 27.775 23.189999999999998 20-24 19.064999999999998 30.53 27.845 22.56 25-29 18.93 29.95 27.900000000000002 23.22 30-34 19.189999999999998 29.835 28.255000000000003 22.720000000000002 35-39 19.11 29.715000000000003 28.04 23.135 40-44 19.62 30.445 27.21 22.725 45-49 19.74 30.225 26.85 23.185 50-54 19.64 29.185 27.305 23.87 55-59 19.785 29.475 27.32 23.419999999999998 60-64 19.945 28.575 28.244999999999997 23.235 65-69 20.349999999999998 29.735 26.779999999999998 23.135 70-74 20.674999999999997 29.080000000000002 27.155 23.09 75-79 20.990000000000002 29.15 26.784999999999997 23.075000000000003 80-84 21.095 29.044999999999998 26.665 23.195 85-89 20.94 28.375 27.284999999999997 23.400000000000002 90-94 20.925 28.92 26.72 23.435 95-99 21.055 28.455000000000002 27.625 22.865 100-104 20.855 28.935 27.084999999999997 23.125 105-109 20.895 28.52 27.325 23.26 110-114 20.86 27.97 27.87 23.3 115-119 20.549999999999997 28.175 27.11 24.165 120-124 20.8 28.525 26.955000000000002 23.72 125-129 21.145 28.455000000000002 27.279999999999998 23.119999999999997 130-134 21.235 28.83 27.134999999999998 22.8 135-139 21.240000000000002 27.35 27.395000000000003 24.015 140-144 21.34 27.96 26.395000000000003 24.305 145-149 21.825 28.73 26.545 22.900000000000002 150-151 22.625 28.499999999999996 25.4875 23.3875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.5 18 2.0 19 2.5 20 2.0 21 0.0 22 2.5 23 5.5 24 6.5 25 8.5 26 10.0 27 15.0 28 21.5 29 34.5 30 46.5 31 50.5 32 59.0 33 70.0 34 82.5 35 97.0 36 113.0 37 138.0 38 161.0 39 168.5 40 183.0 41 209.0 42 218.5 43 223.5 44 242.0 45 231.0 46 209.5 47 200.5 48 190.0 49 176.0 50 142.5 51 113.5 52 95.0 53 84.0 54 69.0 55 45.5 56 36.0 57 30.0 58 19.0 59 15.5 60 16.0 61 13.5 62 13.5 63 14.0 64 13.0 65 13.5 66 19.5 67 19.5 68 11.5 69 7.5 70 4.5 71 1.0 72 2.5 73 5.0 74 3.5 75 1.0 76 0.5 77 1.0 78 2.0 79 1.5 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8 2 0.35000000000000003 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.525 #Duplication Level Percentage of deduplicated Percentage of total 1 91.49406241369788 82.825 2 7.732670533001933 14.000000000000002 3 0.6351836509251587 1.725 4 0.08285004142502071 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.055233360950013806 1.15 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGC 26 0.65 TruSeq Adapter, Index 10 (100% over 50bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCGCGTATGC 20 0.5 TruSeq Adapter, Index 10 (98% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.1375 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.25 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.275 0.0 0.0 0.0 0.0 118-119 0.3875 0.0 0.0 0.0 0.0 120-121 0.5375 0.0 0.0 0.0 0.0 122-123 0.7875 0.0 0.0 0.0 0.0 124-125 0.9125 0.0 0.0 0.0 0.0 126-127 1.1375000000000002 0.0 0.0 0.0 0.0 128-129 1.3125 0.0 0.0 0.0 0.0 130-131 1.6625 0.0 0.0 0.0 0.0 132-133 2.05 0.0 0.0 0.0 0.0 134-135 2.4625000000000004 0.0 0.0 0.0 0.0 136-137 2.9375 0.0 0.0 0.0 0.0 138-139 3.5875000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACTAGC 10 0.006830828 145.0 9 >>END_MODULE SRR22215353 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215353_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.6855 37.0 37.0 37.0 37.0 37.0 2 36.0725 37.0 37.0 37.0 37.0 37.0 3 36.181 37.0 37.0 37.0 37.0 37.0 4 36.269 37.0 37.0 37.0 37.0 37.0 5 36.0085 37.0 37.0 37.0 37.0 37.0 6 36.1925 37.0 37.0 37.0 37.0 37.0 7 36.0385 37.0 37.0 37.0 37.0 37.0 8 36.103 37.0 37.0 37.0 37.0 37.0 9 36.1285 37.0 37.0 37.0 37.0 37.0 10-14 36.0827 37.0 37.0 37.0 37.0 37.0 15-19 35.9871 37.0 37.0 37.0 37.0 37.0 20-24 35.9206 37.0 37.0 37.0 37.0 37.0 25-29 35.7854 37.0 37.0 37.0 37.0 37.0 30-34 35.66109999999999 37.0 37.0 37.0 37.0 37.0 35-39 35.5979 37.0 37.0 37.0 37.0 37.0 40-44 35.5877 37.0 37.0 37.0 37.0 37.0 45-49 35.5416 37.0 37.0 37.0 37.0 37.0 50-54 35.551 37.0 37.0 37.0 37.0 37.0 55-59 35.4567 37.0 37.0 37.0 37.0 37.0 60-64 35.446 37.0 37.0 37.0 37.0 37.0 65-69 35.336200000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.360200000000006 37.0 37.0 37.0 37.0 37.0 75-79 35.4029 37.0 37.0 37.0 37.0 37.0 80-84 35.382999999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.3955 37.0 37.0 37.0 37.0 37.0 90-94 35.3891 37.0 37.0 37.0 37.0 37.0 95-99 35.424800000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.39659999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.3863 37.0 37.0 37.0 37.0 37.0 110-114 35.3575 37.0 37.0 37.0 37.0 37.0 115-119 35.256099999999996 37.0 37.0 37.0 32.2 37.0 120-124 35.217999999999996 37.0 37.0 37.0 32.2 37.0 125-129 35.1663 37.0 37.0 37.0 25.0 37.0 130-134 35.1496 37.0 37.0 37.0 25.0 37.0 135-139 35.151300000000006 37.0 37.0 37.0 29.8 37.0 140-144 35.0167 37.0 37.0 37.0 25.0 37.0 145-149 34.889 37.0 37.0 37.0 25.0 37.0 150-151 34.94925 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 3.0 17 0.0 18 4.0 19 6.0 20 2.0 21 9.0 22 8.0 23 9.0 24 15.0 25 21.0 26 25.0 27 27.0 28 29.0 29 21.0 30 42.0 31 53.0 32 78.0 33 123.0 34 257.0 35 711.0 36 2346.0 37 209.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.875 21.15 17.275 27.700000000000003 2 29.599999999999998 28.025 27.925 14.45 3 23.599999999999998 31.0 28.125 17.275 4 26.224999999999998 34.125 22.875 16.775000000000002 5 29.175 35.575 20.599999999999998 14.649999999999999 6 22.45 39.65 22.05 15.85 7 22.425 19.475 40.575 17.525 8 24.25 23.674999999999997 28.175 23.9 9 25.8 24.075 27.6 22.525000000000002 10-14 25.7 29.235 25.474999999999998 19.59 15-19 25.085 27.575 27.544999999999998 19.794999999999998 20-24 25.35 27.584999999999997 27.400000000000002 19.665 25-29 25.455 28.165000000000003 27.04 19.34 30-34 24.48 28.68 27.250000000000004 19.59 35-39 24.48 28.015 28.015 19.49 40-44 24.575 28.46 27.96 19.005 45-49 25.319999999999997 27.365000000000002 27.98 19.335 50-54 25.145 27.93 27.58 19.345000000000002 55-59 24.86 28.299999999999997 27.450000000000003 19.39 60-64 24.765 27.705000000000002 28.03 19.5 65-69 24.335 28.470000000000002 28.37 18.825 70-74 24.87 27.505000000000003 28.470000000000002 19.155 75-79 25.115 27.355 28.465 19.064999999999998 80-84 25.490000000000002 27.07 28.21 19.23 85-89 25.240000000000002 27.075 28.475 19.21 90-94 24.785 27.084999999999997 28.725 19.405 95-99 24.855 27.445000000000004 28.24 19.46 100-104 24.765 27.125 29.065 19.045 105-109 25.25 27.21 27.865000000000002 19.675 110-114 24.775 27.065 28.384999999999998 19.775000000000002 115-119 25.180000000000003 26.905 28.82 19.095000000000002 120-124 24.990000000000002 27.115000000000002 28.860000000000003 19.035 125-129 25.305 27.944999999999997 27.93 18.82 130-134 24.82 27.62 28.715000000000003 18.845 135-139 25.1 27.589999999999996 28.395 18.915000000000003 140-144 25.5 27.235 28.449999999999996 18.815 145-149 25.515 28.050000000000004 27.634999999999998 18.8 150-151 26.437500000000004 27.712500000000002 26.6 19.25 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 1.5 19 0.5 20 1.5 21 1.5 22 0.5 23 2.5 24 4.5 25 5.0 26 7.0 27 11.5 28 11.5 29 14.0 30 23.0 31 32.5 32 41.0 33 48.5 34 54.5 35 59.5 36 91.0 37 126.0 38 150.0 39 187.0 40 200.5 41 195.5 42 237.5 43 261.0 44 246.0 45 258.0 46 258.0 47 243.5 48 215.5 49 195.5 50 169.0 51 120.5 52 87.5 53 71.0 54 64.0 55 45.0 56 31.5 57 28.0 58 24.0 59 19.0 60 12.5 61 13.0 62 13.5 63 9.0 64 5.5 65 4.0 66 2.5 67 2.5 68 3.5 69 4.0 70 4.0 71 4.5 72 4.5 73 3.0 74 2.0 75 2.5 76 2.0 77 3.0 78 3.0 79 1.5 80 2.0 81 1.5 82 1.0 83 1.5 84 2.5 85 2.5 86 3.0 87 3.0 88 1.5 89 3.0 90 5.0 91 5.0 92 4.0 93 2.5 94 1.5 95 0.5 96 0.5 97 1.0 98 0.5 99 1.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.57499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.72809172809173 84.0 2 7.5075075075075075 13.750000000000002 3 0.6825006825006825 1.875 4 0.054600054600054605 0.2 5 0.0 0.0 6 0.0 0.0 7 0.027300027300027303 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.25 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.2875 0.0 0.0 0.0 0.0 118-119 0.4125 0.0 0.0 0.0 0.0 120-121 0.5625 0.0 0.0 0.0 0.0 122-123 0.825 0.0 0.0 0.0 0.0 124-125 0.95 0.0 0.0 0.0 0.0 126-127 1.1875 0.0 0.0 0.0 0.0 128-129 1.3625 0.0 0.0 0.0 0.0 130-131 1.7375 0.0 0.0 0.0 0.0 132-133 2.1500000000000004 0.0 0.0 0.0 0.0 134-135 2.55 0.0 0.0 0.0 0.0 136-137 3.0125 0.0 0.0 0.0 0.0 138-139 3.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAGGGA 10 0.006830828 145.0 8 TTTGTGA 10 0.006830828 145.0 8 >>END_MODULE Read 2147219 spots for SRR22215353.sra Written 2147219 spots for SRR22215353.sra Read 2147219 spots for SRR22215353.sra Written 2147219 spots for SRR22215353.sra Read 2147219 spots for SRR22215353.sra Written 2147219 spots for SRR22215353.sra Read 2147219 spots for SRR22215353.sra Written 2147219 spots for SRR22215353.sra Read 2147219 spots for SRR22215353.sra Written 2147219 spots for SRR22215353.sra Read 2147219 spots for SRR22215353.sra Written 2147219 spots for SRR22215353.sra Read 2147219 spots for SRR22215353.sra Written 2147219 spots for SRR22215353.sra Read 2147219 spots for SRR22215353.sra Written 2147219 spots for SRR22215353.sra Read 2147219 spots for SRR22215353.sra Written 2147219 spots for SRR22215353.sra Read 2147219 spots for SRR22215353.sra Written 2147219 spots for SRR22215353.sra Read 2147219 spots for SRR22215353.sra Written 2147219 spots for SRR22215353.sra Read 2147220 spots for SRR22215353.sra Written 2147220 spots for SRR22215353.sra Read 2147219 spots for SRR22215353.sra Written 2147219 spots for SRR22215353.sra Read 2147219 spots for SRR22215353.sra Written 2147219 spots for SRR22215353.sra Read 2147219 spots for SRR22215353.sra Written 2147219 spots for SRR22215353.sra Read 2147219 spots for SRR22215353.sra Written 2147219 spots for SRR22215353.sra Read 2147219 spots for SRR22215353.sra Written 2147219 spots for SRR22215353.sra Read 2147219 spots for SRR22215353.sra Written 2147219 spots for SRR22215353.sra Read 2147219 spots for SRR22215353.sra Written 2147219 spots for SRR22215353.sra Read 2147219 spots for SRR22215353.sra Written 2147219 spots for SRR22215353.sra SRR ids: ['SRR22215353.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hjjne7fg SRR22215353.sra spots: 42944381 blocks: [[1, 2147219], [2147220, 4294438], [4294439, 6441657], [6441658, 8588876], [8588877, 10736095], [10736096, 12883314], [12883315, 15030533], [15030534, 17177752], [17177753, 19324971], [19324972, 21472190], [21472191, 23619409], [23619410, 25766628], [25766629, 27913847], [27913848, 30061066], [30061067, 32208285], [32208286, 34355504], [34355505, 36502723], [36502724, 38649942], [38649943, 40797161], [40797162, 42944381]] SRR22215353 file size 14572679 SRR22215353 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22215353 SRR22215353_1.fastq SRR22215353_2.fastq Input file: SRR22215353_1.fastq Paired file: SRR22215353_2.fastq trimmed: SRR22215353-trimmed-pair1.fastq, SRR22215353-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 11:01:12 2025 >> started Tue Feb 11 11:02:04 2025 >> done (51.581s) 42944381 read pairs processed; of these: 725 ( 0.00%) short read pairs filtered out after trimming by size control 414577 ( 0.97%) empty read pairs filtered out after trimming by size control 42529079 (99.03%) read pairs available; of these: 4799013 (11.28%) trimmed read pairs available after processing 37730066 (88.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 28 0.00% 20 18 0.00% 21 39 0.00% 22 15 0.00% 23 11 0.00% 24 3 0.00% 25 10 0.00% 26 17 0.00% 27 50 0.00% 28 18 0.00% 29 153 0.00% 30 24 0.00% 31 45 0.00% 32 27 0.00% 33 27 0.00% 34 16 0.00% 35 24 0.00% 36 26 0.00% 37 32 0.00% 38 41 0.00% 39 17 0.00% 40 11 0.00% 41 24 0.00% 42 36 0.00% 43 38 0.00% 44 37 0.00% 45 48 0.00% 46 50 0.00% 47 54 0.00% 48 71 0.00% 49 73 0.00% 50 79 0.00% 51 96 0.00% 52 60 0.00% 53 68 0.00% 54 109 0.00% 55 107 0.00% 56 101 0.00% 57 88 0.00% 58 101 0.00% 59 77 0.00% 60 66 0.00% 61 64 0.00% 62 79 0.00% 63 97 0.00% 64 112 0.00% 65 93 0.00% 66 115 0.00% 67 144 0.00% 68 157 0.00% 69 151 0.00% 70 164 0.00% 71 208 0.00% 72 209 0.00% 73 270 0.00% 74 274 0.00% 75 315 0.00% 76 377 0.00% 77 440 0.00% 78 440 0.00% 79 484 0.00% 80 567 0.00% 81 616 0.00% 82 655 0.00% 83 801 0.00% 84 854 0.00% 85 925 0.00% 86 984 0.00% 87 1152 0.00% 88 1313 0.00% 89 1474 0.00% 90 1618 0.00% 91 1840 0.00% 92 1989 0.00% 93 2127 0.01% 94 2512 0.01% 95 2808 0.01% 96 2926 0.01% 97 3322 0.01% 98 3812 0.01% 99 3959 0.01% 100 4399 0.01% 101 4705 0.01% 102 5187 0.01% 103 5920 0.01% 104 6429 0.02% 105 7033 0.02% 106 7682 0.02% 107 8522 0.02% 108 9214 0.02% 109 10362 0.02% 110 11358 0.03% 111 12182 0.03% 112 13474 0.03% 113 15133 0.04% 114 16761 0.04% 115 18717 0.04% 116 20817 0.05% 117 23846 0.06% 118 26516 0.06% 119 29209 0.07% 120 32829 0.08% 121 37055 0.09% 122 39961 0.09% 123 44818 0.11% 124 49727 0.12% 125 55533 0.13% 126 60964 0.14% 127 68559 0.16% 128 75773 0.18% 129 83232 0.20% 130 92462 0.22% 131 99340 0.23% 132 107043 0.25% 133 115283 0.27% 134 124165 0.29% 135 133150 0.31% 136 143434 0.34% 137 154659 0.36% 138 166013 0.39% 139 177258 0.42% 140 190010 0.45% 141 199787 0.47% 142 209860 0.49% 143 219630 0.52% 144 227723 0.54% 145 236024 0.55% 146 245318 0.58% 147 258464 0.61% 148 269203 0.63% 149 281916 0.66% 150 299858 0.71% 151 37730066 88.72% 42529079 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=5.91 fanout-score-rank=17 prefix-density=0.24 prefix-fanout=4.3 sequence=GGTGCTGGAGCTGGAGC criterion=fanout-score sequence-density=0.08 sequence-density-rank=19 fanout-score=168.09 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=21.3 sequence=TCATCTTCATCATCA criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=4.46 fanout-score-rank=21 prefix-density=0.29 prefix-fanout=3.2 sequence=ATCCAGAAGGAGTCCACCCT criterion=fanout-score sequence-density=0.06 sequence-density-rank=28 fanout-score=349.13 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=31.6 sequence=TGATGATGAAGATGA SRR22215353 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 11:02:47 Started mapping on | Feb 11 11:02:47 Finished on | Feb 11 11:06:52 Mapping speed, Million of reads per hour | 624.92 Number of input reads | 42529079 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 39703420 Uniquely mapped reads % | 93.36% Average mapped length | 297.71 Number of splices: Total | 27416729 Number of splices: Annotated (sjdb) | 26763988 Number of splices: GT/AG | 26983179 Number of splices: GC/AG | 327555 Number of splices: AT/AC | 35358 Number of splices: Non-canonical | 70637 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.21 Insertion rate per base | 0.02% Insertion average length | 1.81 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 920042 % of reads mapped to multiple loci | 2.16% Number of reads mapped to too many loci | 448727 % of reads mapped to too many loci | 1.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.91% % of reads unmapped: other | 0.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1905617 1905617 1905617 N_multimapping 920042 920042 920042 N_noFeature 1584378 39112069 1792643 N_ambiguous 588812 2471 204801 UnstrandedReadsAssigned:37530230 PositiveStrandReadsAssigned:588880 NegativeStrandReadsAssigned:37705976 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR22215353 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22215353-trimmed-pair1.fastq SRR22215353-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 42,529,079 reads, 38,630,831 reads pseudoaligned [quant] estimated average fragment length: 192.23 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,192 rounds 52401 SRR22215353.ke.tsv 34699 SRR22215353.se.tsv 87100 total ==> SRR22215353.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1826.77 7586 107.938 Potri.005G024800.1.v4.1 1035 843.77 4761 146.662 Potri.004G059700.1.v4.1 961 769.77 229 7.73249 Potri.007G009000.2.v4.1 1416 1224.77 0 0 Potri.003G141000.2.v4.1 2943 2751.77 834.849 7.88571 Potri.016G087400.1.v4.1 270 83.3666 1899 592.076 Potri.015G069301.1.v4.1 564 372.843 0 0 Potri.010G195200.1.v4.1 1773 1581.77 91 1.49535 Potri.012G127500.1.v4.1 977 785.77 9215 304.821 ==> SRR22215353.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1343 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 945 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 142 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 15 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 13 SRR22215353 completed mapping pipeline successfully