Starting /dee2/code/volunteer_pipeline.sh SRR22215354 current disk space = 3053723086848 free memory = 1161756196 SRR22215354 SRAfilesize 63c51ed99208858d2350009af7e2901b SRR22215354.sra SRR22215354.sra file validated SRR22215354 is paired end SRR22215354 is conventional basespace SRR22215354 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215354_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0105 37.0 37.0 37.0 37.0 37.0 2 36.06925 37.0 37.0 37.0 37.0 37.0 3 36.0865 37.0 37.0 37.0 37.0 37.0 4 36.21 37.0 37.0 37.0 37.0 37.0 5 36.318 37.0 37.0 37.0 37.0 37.0 6 36.3675 37.0 37.0 37.0 37.0 37.0 7 36.315 37.0 37.0 37.0 37.0 37.0 8 36.2255 37.0 37.0 37.0 37.0 37.0 9 36.316 37.0 37.0 37.0 37.0 37.0 10-14 36.2816 37.0 37.0 37.0 37.0 37.0 15-19 36.2407 37.0 37.0 37.0 37.0 37.0 20-24 36.2128 37.0 37.0 37.0 37.0 37.0 25-29 36.1608 37.0 37.0 37.0 37.0 37.0 30-34 36.095800000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.0093 37.0 37.0 37.0 37.0 37.0 40-44 35.981899999999996 37.0 37.0 37.0 37.0 37.0 45-49 35.9072 37.0 37.0 37.0 37.0 37.0 50-54 35.8085 37.0 37.0 37.0 37.0 37.0 55-59 35.7673 37.0 37.0 37.0 37.0 37.0 60-64 35.7313 37.0 37.0 37.0 37.0 37.0 65-69 35.7017 37.0 37.0 37.0 37.0 37.0 70-74 35.7001 37.0 37.0 37.0 37.0 37.0 75-79 35.7595 37.0 37.0 37.0 37.0 37.0 80-84 35.723400000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.697 37.0 37.0 37.0 37.0 37.0 90-94 35.6627 37.0 37.0 37.0 37.0 37.0 95-99 35.6554 37.0 37.0 37.0 37.0 37.0 100-104 35.6685 37.0 37.0 37.0 37.0 37.0 105-109 35.547799999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.57379999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.57540000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.541399999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.4658 37.0 37.0 37.0 37.0 37.0 130-134 35.40859999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.3505 37.0 37.0 37.0 34.6 37.0 140-144 35.2388 37.0 37.0 37.0 32.2 37.0 145-149 35.2483 37.0 37.0 37.0 32.2 37.0 150-151 35.00775 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 2.0 22 4.0 23 2.0 24 5.0 25 7.0 26 8.0 27 26.0 28 31.0 29 44.0 30 55.0 31 72.0 32 102.0 33 120.0 34 180.0 35 455.0 36 2677.0 37 209.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.25576730190571 11.409227683049147 18.12938816449348 35.20561685055166 2 32.66482827776385 14.489847079468538 29.43093507144648 23.414389571321134 3 27.675 20.575 24.0 27.750000000000004 4 27.6 26.474999999999998 20.375 25.55 5 27.500000000000004 30.525000000000002 21.475 20.5 6 19.3 33.375 23.775 23.549999999999997 7 13.950000000000001 29.45 38.25 18.35 8 16.475 26.55 31.5 25.474999999999998 9 17.65 23.7 32.324999999999996 26.325 10-14 18.985 31.55 27.195000000000004 22.27 15-19 19.285 29.29 28.425 23.0 20-24 19.45 30.14 27.115000000000002 23.294999999999998 25-29 19.275000000000002 29.7 27.565 23.46 30-34 18.94 29.34 28.23 23.49 35-39 19.67 29.835 27.36 23.135 40-44 19.915 30.154999999999998 27.16 22.770000000000003 45-49 20.155 29.03 27.405 23.41 50-54 19.78 28.79 27.77 23.66 55-59 20.39 29.330000000000002 26.674999999999997 23.605 60-64 19.32 29.17 27.575 23.935000000000002 65-69 20.375 28.985 27.095000000000002 23.544999999999998 70-74 20.064999999999998 28.895 27.365000000000002 23.674999999999997 75-79 20.31 28.765 27.42 23.505000000000003 80-84 19.71 28.345 28.16 23.785 85-89 20.22 29.235 26.455000000000002 24.09 90-94 20.544999999999998 28.799999999999997 26.6 24.055 95-99 20.150000000000002 29.07 26.96 23.82 100-104 20.895 28.335 27.065 23.705000000000002 105-109 20.585 27.675 27.805000000000003 23.935000000000002 110-114 20.265 28.675 27.22 23.84 115-119 20.89 28.205000000000002 27.245 23.66 120-124 20.525 27.67 27.595 24.21 125-129 20.765 27.875 26.865 24.495 130-134 21.075 27.925 27.105 23.895 135-139 20.755000000000003 28.544999999999998 26.779999999999998 23.919999999999998 140-144 21.275 28.49 26.979999999999997 23.255 145-149 21.565 28.895 25.855 23.685000000000002 150-151 22.25 28.6125 26.0375 23.1 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 1.0 17 1.0 18 0.0 19 1.0 20 2.0 21 1.5 22 2.5 23 4.0 24 4.0 25 4.0 26 9.5 27 15.0 28 20.0 29 24.5 30 29.0 31 44.0 32 50.5 33 54.5 34 68.0 35 85.5 36 100.5 37 112.0 38 132.0 39 156.5 40 190.0 41 212.5 42 207.0 43 218.5 44 264.5 45 265.0 46 244.0 47 227.5 48 217.0 49 199.5 50 156.5 51 133.0 52 113.0 53 89.0 54 71.0 55 62.5 56 46.0 57 34.0 58 27.0 59 15.0 60 10.5 61 9.0 62 6.5 63 4.5 64 3.5 65 3.5 66 5.5 67 5.5 68 2.5 69 3.0 70 3.5 71 5.0 72 4.5 73 3.5 74 2.5 75 1.5 76 3.5 77 3.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.25993555316863 86.825 2 6.2835660580021475 11.700000000000001 3 0.322234156820623 0.8999999999999999 4 0.08055853920515575 0.3 5 0.02685284640171858 0.125 6 0.02685284640171858 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGGGT 6 0.15 TruSeq Adapter, Index 15 (97% over 40bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGGTT 5 0.125 TruSeq Adapter, Index 15 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1125 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.325 0.0 0.0 0.0 0.0 114-115 0.3625 0.0 0.0 0.0 0.0 116-117 0.3875 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.6625 0.0 0.0 0.0 0.0 122-123 0.875 0.0 0.0 0.0 0.0 124-125 1.05 0.0 0.0 0.0 0.0 126-127 1.4125 0.0 0.0 0.0 0.0 128-129 1.8875 0.0 0.0 0.0 0.0 130-131 2.2249999999999996 0.0 0.0 0.0 0.0 132-133 2.65 0.0 0.0 0.0 0.0 134-135 3.2625 0.0 0.0 0.0 0.0 136-137 4.025 0.0 0.0 0.0 0.0 138-139 4.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGCAC 30 0.0017973486 72.5 145 TCGGAAG 40 0.0076550315 18.125 140-144 AGATCGG 40 0.0076550315 18.125 135-139 >>END_MODULE SRR22215354 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215354_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.275 37.0 37.0 37.0 37.0 37.0 2 35.893 37.0 37.0 37.0 37.0 37.0 3 35.8285 37.0 37.0 37.0 37.0 37.0 4 35.845 37.0 37.0 37.0 37.0 37.0 5 35.788 37.0 37.0 37.0 37.0 37.0 6 35.9135 37.0 37.0 37.0 37.0 37.0 7 35.95 37.0 37.0 37.0 37.0 37.0 8 35.701 37.0 37.0 37.0 37.0 37.0 9 35.8525 37.0 37.0 37.0 37.0 37.0 10-14 35.7971 37.0 37.0 37.0 37.0 37.0 15-19 35.6915 37.0 37.0 37.0 37.0 37.0 20-24 35.673199999999994 37.0 37.0 37.0 37.0 37.0 25-29 35.6047 37.0 37.0 37.0 37.0 37.0 30-34 35.44070000000001 37.0 37.0 37.0 37.0 37.0 35-39 35.528299999999994 37.0 37.0 37.0 37.0 37.0 40-44 35.481399999999994 37.0 37.0 37.0 37.0 37.0 45-49 35.447900000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.432 37.0 37.0 37.0 37.0 37.0 55-59 35.334199999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.320299999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.251999999999995 37.0 37.0 37.0 34.6 37.0 70-74 35.2382 37.0 37.0 37.0 34.6 37.0 75-79 35.16959999999999 37.0 37.0 37.0 29.8 37.0 80-84 35.1612 37.0 37.0 37.0 25.0 37.0 85-89 35.2172 37.0 37.0 37.0 32.2 37.0 90-94 35.216899999999995 37.0 37.0 37.0 27.4 37.0 95-99 35.1229 37.0 37.0 37.0 27.4 37.0 100-104 35.0706 37.0 37.0 37.0 25.0 37.0 105-109 35.0798 37.0 37.0 37.0 25.0 37.0 110-114 34.998599999999996 37.0 37.0 37.0 25.0 37.0 115-119 34.95870000000001 37.0 37.0 37.0 25.0 37.0 120-124 34.8935 37.0 37.0 37.0 25.0 37.0 125-129 34.8 37.0 37.0 37.0 25.0 37.0 130-134 34.825300000000006 37.0 37.0 37.0 25.0 37.0 135-139 34.745599999999996 37.0 37.0 37.0 25.0 37.0 140-144 34.5513 37.0 37.0 37.0 25.0 37.0 145-149 34.5321 37.0 37.0 37.0 25.0 37.0 150-151 34.38549999999999 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 1.0 17 1.0 18 3.0 19 2.0 20 7.0 21 1.0 22 8.0 23 10.0 24 20.0 25 28.0 26 25.0 27 32.0 28 28.0 29 56.0 30 40.0 31 71.0 32 95.0 33 162.0 34 313.0 35 906.0 36 2064.0 37 125.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.85 22.5 17.1 27.55 2 28.125 28.349999999999998 29.049999999999997 14.475 3 22.725 31.45 28.050000000000004 17.775 4 24.75 34.65 23.425 17.175 5 28.125 35.675000000000004 20.75 15.45 6 21.85 39.800000000000004 21.25 17.1 7 20.075000000000003 20.45 39.7 19.775000000000002 8 22.175 24.4 28.65 24.775 9 25.275 22.975 27.700000000000003 24.05 10-14 24.625 28.82 26.169999999999998 20.385 15-19 24.58 27.855 27.92 19.645000000000003 20-24 24.295 28.065 27.685 19.955000000000002 25-29 24.315 27.985 27.685 20.015 30-34 24.275 28.084999999999997 28.405 19.235 35-39 24.545 27.794999999999998 27.694999999999997 19.965 40-44 24.33 28.134999999999998 27.889999999999997 19.645000000000003 45-49 24.145 28.175 27.99 19.689999999999998 50-54 23.75 27.82 28.21 20.22 55-59 24.23 27.96 27.855 19.955000000000002 60-64 23.73 28.09 28.075 20.105 65-69 23.835 28.939999999999998 27.584999999999997 19.64 70-74 24.705 27.465 27.894999999999996 19.935 75-79 25.165 27.389999999999997 28.139999999999997 19.305 80-84 24.654999999999998 27.91 27.665 19.77 85-89 24.935 27.939999999999998 27.534999999999997 19.59 90-94 24.62 27.605 27.96 19.814999999999998 95-99 24.635 28.32 27.605 19.439999999999998 100-104 24.75 27.975 28.34 18.935 105-109 23.79 27.96 28.51 19.74 110-114 24.515 27.650000000000002 28.015 19.82 115-119 24.595 27.18 28.57 19.655 120-124 24.485 27.834999999999997 28.96 18.72 125-129 24.12 28.035 28.199999999999996 19.645000000000003 130-134 24.335 27.794999999999998 28.46 19.41 135-139 24.245 28.37 27.810000000000002 19.575 140-144 25.61 28.09 27.465 18.834999999999997 145-149 26.009999999999998 28.365000000000002 27.115000000000002 18.509999999999998 150-151 25.8 27.712500000000002 27.437499999999996 19.05 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.5 14 1.5 15 0.5 16 0.5 17 1.0 18 1.0 19 1.0 20 1.0 21 0.5 22 3.0 23 3.5 24 3.0 25 4.0 26 5.5 27 5.0 28 9.0 29 14.0 30 15.5 31 22.5 32 29.5 33 40.5 34 59.0 35 82.5 36 94.0 37 105.5 38 138.5 39 152.5 40 173.0 41 206.5 42 238.5 43 278.0 44 282.5 45 281.5 46 277.0 47 239.0 48 204.5 49 195.0 50 176.0 51 136.0 52 113.0 53 88.0 54 67.0 55 60.0 56 39.5 57 28.0 58 22.0 59 13.5 60 13.5 61 10.0 62 5.0 63 4.5 64 5.5 65 5.0 66 3.5 67 2.5 68 1.0 69 3.5 70 3.0 71 0.0 72 0.5 73 1.0 74 1.0 75 0.5 76 0.0 77 0.0 78 1.0 79 1.5 80 2.0 81 1.5 82 0.5 83 1.0 84 1.0 85 1.0 86 1.5 87 1.5 88 1.0 89 0.5 90 0.0 91 0.5 92 1.0 93 1.0 94 1.0 95 1.0 96 0.5 97 1.5 98 1.5 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.925 #Duplication Level Percentage of deduplicated Percentage of total 1 93.93132818738356 88.225 2 5.722651051370774 10.75 3 0.2927867979771094 0.8250000000000001 4 0.053233963268565346 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1125 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.325 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.5249999999999999 0.0 0.0 0.0 0.0 120-121 0.6875 0.0 0.0 0.0 0.0 122-123 0.875 0.0 0.0 0.0 0.0 124-125 1.0375 0.0 0.0 0.0 0.0 126-127 1.3875 0.0 0.0 0.0 0.0 128-129 1.85 0.0 0.0 0.0 0.0 130-131 2.175 0.0 0.0 0.0 0.0 132-133 2.6 0.0 0.0 0.0 0.0 134-135 3.2 0.0 0.0 0.0 0.0 136-137 3.975 0.0 0.0 0.0 0.0 138-139 4.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGATTGC 10 0.006830828 145.0 4 TGATATC 10 0.006830828 145.0 2 AGAGCGT 35 0.0033124194 62.14286 145 TCGGAAG 40 0.0076550315 18.125 140-144 AGATCGG 40 0.0076550315 18.125 135-139 >>END_MODULE Read 1875683 spots for SRR22215354.sra Written 1875683 spots for SRR22215354.sra Read 1875683 spots for SRR22215354.sra Written 1875683 spots for SRR22215354.sra Read 1875683 spots for SRR22215354.sra Written 1875683 spots for SRR22215354.sra Read 1875683 spots for SRR22215354.sra Written 1875683 spots for SRR22215354.sra Read 1875683 spots for SRR22215354.sra Written 1875683 spots for SRR22215354.sra Read 1875683 spots for SRR22215354.sra Written 1875683 spots for SRR22215354.sra Read 1875683 spots for SRR22215354.sra Written 1875683 spots for SRR22215354.sra Read 1875683 spots for SRR22215354.sra Written 1875683 spots for SRR22215354.sra Read 1875683 spots for SRR22215354.sra Written 1875683 spots for SRR22215354.sra Read 1875683 spots for SRR22215354.sra Written 1875683 spots for SRR22215354.sra Read 1875701 spots for SRR22215354.sra Written 1875701 spots for SRR22215354.sra Read 1875683 spots for SRR22215354.sra Written 1875683 spots for SRR22215354.sra Read 1875683 spots for SRR22215354.sra Written 1875683 spots for SRR22215354.sra Read 1875683 spots for SRR22215354.sra Written 1875683 spots for SRR22215354.sra Read 1875683 spots for SRR22215354.sra Written 1875683 spots for SRR22215354.sra Read 1875683 spots for SRR22215354.sra Written 1875683 spots for SRR22215354.sra Read 1875683 spots for SRR22215354.sra Written 1875683 spots for SRR22215354.sra Read 1875683 spots for SRR22215354.sra Written 1875683 spots for SRR22215354.sra Read 1875683 spots for SRR22215354.sra Written 1875683 spots for SRR22215354.sra Read 1875683 spots for SRR22215354.sra Written 1875683 spots for SRR22215354.sra SRR ids: ['SRR22215354.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zmsqvdgw SRR22215354.sra spots: 37513678 blocks: [[1, 1875683], [1875684, 3751366], [3751367, 5627049], [5627050, 7502732], [7502733, 9378415], [9378416, 11254098], [11254099, 13129781], [13129782, 15005464], [15005465, 16881147], [16881148, 18756830], [18756831, 20632513], [20632514, 22508196], [22508197, 24383879], [24383880, 26259562], [26259563, 28135245], [28135246, 30010928], [30010929, 31886611], [31886612, 33762294], [33762295, 35637977], [35637978, 37513678]] SRR22215354 file size 12727088 SRR22215354 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22215354 SRR22215354_1.fastq SRR22215354_2.fastq Input file: SRR22215354_1.fastq Paired file: SRR22215354_2.fastq trimmed: SRR22215354-trimmed-pair1.fastq, SRR22215354-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:11:27 2025 >> started Tue Feb 11 10:12:28 2025 >> done (61.490s) 37513678 read pairs processed; of these: 324 ( 0.00%) short read pairs filtered out after trimming by size control 143706 ( 0.38%) empty read pairs filtered out after trimming by size control 37369648 (99.62%) read pairs available; of these: 4290904 (11.48%) trimmed read pairs available after processing 33078744 (88.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 15 0.00% 20 9 0.00% 21 12 0.00% 22 5 0.00% 23 5 0.00% 24 10 0.00% 25 6 0.00% 26 5 0.00% 27 8 0.00% 28 8 0.00% 29 55 0.00% 30 11 0.00% 31 14 0.00% 32 13 0.00% 33 12 0.00% 34 6 0.00% 35 9 0.00% 36 14 0.00% 37 11 0.00% 38 12 0.00% 39 13 0.00% 40 15 0.00% 41 8 0.00% 42 29 0.00% 43 15 0.00% 44 6 0.00% 45 29 0.00% 46 20 0.00% 47 23 0.00% 48 27 0.00% 49 29 0.00% 50 31 0.00% 51 29 0.00% 52 37 0.00% 53 38 0.00% 54 43 0.00% 55 52 0.00% 56 49 0.00% 57 56 0.00% 58 44 0.00% 59 51 0.00% 60 52 0.00% 61 63 0.00% 62 71 0.00% 63 53 0.00% 64 73 0.00% 65 71 0.00% 66 79 0.00% 67 75 0.00% 68 96 0.00% 69 101 0.00% 70 108 0.00% 71 143 0.00% 72 159 0.00% 73 142 0.00% 74 147 0.00% 75 206 0.00% 76 229 0.00% 77 233 0.00% 78 292 0.00% 79 330 0.00% 80 314 0.00% 81 399 0.00% 82 454 0.00% 83 496 0.00% 84 593 0.00% 85 686 0.00% 86 714 0.00% 87 862 0.00% 88 883 0.00% 89 1020 0.00% 90 1070 0.00% 91 1210 0.00% 92 1328 0.00% 93 1434 0.00% 94 1760 0.00% 95 1916 0.01% 96 2083 0.01% 97 2325 0.01% 98 2596 0.01% 99 2787 0.01% 100 3056 0.01% 101 3385 0.01% 102 3724 0.01% 103 4177 0.01% 104 4587 0.01% 105 5191 0.01% 106 5808 0.02% 107 6482 0.02% 108 7336 0.02% 109 8113 0.02% 110 9058 0.02% 111 10127 0.03% 112 11349 0.03% 113 12434 0.03% 114 14218 0.04% 115 16278 0.04% 116 18329 0.05% 117 20984 0.06% 118 23892 0.06% 119 26603 0.07% 120 29918 0.08% 121 33698 0.09% 122 37182 0.10% 123 40908 0.11% 124 46398 0.12% 125 51708 0.14% 126 57083 0.15% 127 64063 0.17% 128 70951 0.19% 129 77473 0.21% 130 85035 0.23% 131 91968 0.25% 132 99118 0.27% 133 105947 0.28% 134 113642 0.30% 135 121707 0.33% 136 131254 0.35% 137 141223 0.38% 138 151174 0.40% 139 161834 0.43% 140 170544 0.46% 141 177868 0.48% 142 187485 0.50% 143 194088 0.52% 144 202644 0.54% 145 210955 0.56% 146 219282 0.59% 147 226892 0.61% 148 238165 0.64% 149 247504 0.66% 150 259511 0.69% 151 33078744 88.52% 37369648 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=3.14 fanout-score-rank=32 prefix-density=0.16 prefix-fanout=3.0 sequence=CTCCACACTTGTA criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=232.11 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=18.4 sequence=AAACAAAAGATGCATGTCATATCAAACCAAACAAAGGGAAGATAGGTAACAGTTTCGATATTACTTAATTTCTTGACACATGCAGGAGGAGCACTATGCTGAGTTTTAATTTGCAGCAGTAGCTTAGAAACCATGAATTTTAATGCTTTCCTTCTTCACAATGCCAGCCTGAACAAGGAAGGTCGATACATTCTTGCGCTGGTCACCTTGAAGTTGAATAACCTGGCCTAATTCAGGGTCCTGCACCACTGTACCATTACAGCAGAACTCTTTCTTGAGGTCCTTTAGTATCTTGTTATAGCTGAATTCTTTTTTCAAACCTTGCACAGTTGTCAAGCTTTTCCTACCATTGCGTTGCTGTATACGAATGTGCACATAATCTTTTGTCCCAGCACCAGAGTCCTCGGCATTTGCATCAGCAAAAGGATCATAAGCTGAAGGAGTTTGGGCGTCGAAATCAGACATGAAAACTTAACTGTTCAAGGAAGTCCAACAACCTGAAAGCTCAGAC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=3.63 fanout-score-rank=29 prefix-density=0.18 prefix-fanout=3.0 sequence=AAGATCCAGGACAAGGAAGG criterion=fanout-score sequence-density=0.06 sequence-density-rank=27 fanout-score=341.76 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=31.2 sequence=TGATGATGAAGATGA SRR22215354 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:13:14 Started mapping on | Feb 11 10:13:14 Finished on | Feb 11 10:17:14 Mapping speed, Million of reads per hour | 560.54 Number of input reads | 37369648 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 35039877 Uniquely mapped reads % | 93.77% Average mapped length | 297.69 Number of splices: Total | 27956996 Number of splices: Annotated (sjdb) | 27335092 Number of splices: GT/AG | 27516163 Number of splices: GC/AG | 340579 Number of splices: AT/AC | 37749 Number of splices: Non-canonical | 62505 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.02% Deletion average length | 2.19 Insertion rate per base | 0.02% Insertion average length | 1.82 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 752714 % of reads mapped to multiple loci | 2.01% Number of reads mapped to too many loci | 442383 % of reads mapped to too many loci | 1.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.58% % of reads unmapped: other | 0.45% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1577057 1577057 1577057 N_multimapping 752714 752714 752714 N_noFeature 1300149 34584096 1469023 N_ambiguous 463026 2113 175090 UnstrandedReadsAssigned:33276702 PositiveStrandReadsAssigned:453668 NegativeStrandReadsAssigned:33395764 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR22215354 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22215354-trimmed-pair1.fastq SRR22215354-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,369,648 reads, 34,199,855 reads pseudoaligned [quant] estimated average fragment length: 192.659 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,189 rounds 52401 SRR22215354.ke.tsv 34699 SRR22215354.se.tsv 87100 total ==> SRR22215354.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1826.34 5670 87.5613 Potri.005G024800.1.v4.1 1035 843.341 4682 156.581 Potri.004G059700.1.v4.1 961 769.341 71 2.60286 Potri.007G009000.2.v4.1 1416 1224.34 0 0 Potri.003G141000.2.v4.1 2943 2751.34 935.415 9.58894 Potri.016G087400.1.v4.1 270 83.0984 1964 666.591 Potri.015G069301.1.v4.1 564 372.376 0 0 Potri.010G195200.1.v4.1 1773 1581.34 75 1.33766 Potri.012G127500.1.v4.1 977 785.341 1995 71.6466 ==> SRR22215354.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1093 Potri.001G233950.v4.1 5 Potri.001G122700.v4.1 667 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 40 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 11 SRR22215354 completed mapping pipeline successfully