Starting /dee2/code/volunteer_pipeline.sh SRR22215355 current disk space = 3053937180672 free memory = 1405338932 SRR22215355 SRAfilesize 00b80ddcbd33b7b2faf9f7eb37ae0ff7 SRR22215355.sra SRR22215355.sra file validated SRR22215355 is paired end SRR22215355 is conventional basespace SRR22215355 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215355_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.04375 37.0 37.0 37.0 37.0 37.0 2 36.036 37.0 37.0 37.0 37.0 37.0 3 36.2395 37.0 37.0 37.0 37.0 37.0 4 36.308 37.0 37.0 37.0 37.0 37.0 5 36.365 37.0 37.0 37.0 37.0 37.0 6 36.273 37.0 37.0 37.0 37.0 37.0 7 36.2155 37.0 37.0 37.0 37.0 37.0 8 36.264 37.0 37.0 37.0 37.0 37.0 9 36.2425 37.0 37.0 37.0 37.0 37.0 10-14 36.276799999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.24249999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.214999999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.0763 37.0 37.0 37.0 37.0 37.0 30-34 36.0175 37.0 37.0 37.0 37.0 37.0 35-39 35.98819999999999 37.0 37.0 37.0 37.0 37.0 40-44 35.898 37.0 37.0 37.0 37.0 37.0 45-49 35.886300000000006 37.0 37.0 37.0 37.0 37.0 50-54 35.826100000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.86 37.0 37.0 37.0 37.0 37.0 60-64 35.810900000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.763099999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.7284 37.0 37.0 37.0 37.0 37.0 75-79 35.717000000000006 37.0 37.0 37.0 37.0 37.0 80-84 35.6788 37.0 37.0 37.0 37.0 37.0 85-89 35.6118 37.0 37.0 37.0 37.0 37.0 90-94 35.638 37.0 37.0 37.0 37.0 37.0 95-99 35.6023 37.0 37.0 37.0 37.0 37.0 100-104 35.52140000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.4837 37.0 37.0 37.0 37.0 37.0 110-114 35.5181 37.0 37.0 37.0 37.0 37.0 115-119 35.458800000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.4209 37.0 37.0 37.0 37.0 37.0 125-129 35.412099999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.37179999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.3546 37.0 37.0 37.0 32.2 37.0 140-144 35.2318 37.0 37.0 37.0 29.8 37.0 145-149 35.2086 37.0 37.0 37.0 29.8 37.0 150-151 34.9795 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 1.0 19 0.0 20 0.0 21 2.0 22 3.0 23 1.0 24 4.0 25 8.0 26 11.0 27 19.0 28 38.0 29 37.0 30 62.0 31 66.0 32 81.0 33 133.0 34 219.0 35 496.0 36 2661.0 37 157.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.33007273639328 11.863556558816153 16.854778028592925 38.95159267619764 2 28.198695434019065 15.077772202709482 34.49573507275464 22.22779729051681 3 25.35 21.2 25.3 28.15 4 25.624999999999996 27.85 23.9 22.625 5 25.0 31.65 24.525 18.825 6 18.625 35.6 23.45 22.325 7 14.05 29.225 39.1 17.625 8 16.650000000000002 25.2 33.650000000000006 24.5 9 16.900000000000002 24.15 35.15 23.799999999999997 10-14 19.3 30.955 27.275 22.470000000000002 15-19 19.885 30.11 27.29 22.715 20-24 19.52 29.299999999999997 28.084999999999997 23.095 25-29 19.195 29.759999999999998 28.38 22.665 30-34 19.43 30.03 27.375 23.165 35-39 19.395 29.82 27.495000000000005 23.29 40-44 19.189999999999998 29.099999999999998 28.49 23.22 45-49 19.869999999999997 29.21 27.439999999999998 23.48 50-54 19.49 29.825000000000003 27.639999999999997 23.044999999999998 55-59 19.89 29.095 27.505000000000003 23.51 60-64 19.535 29.544999999999998 27.425 23.494999999999997 65-69 19.845 29.409999999999997 27.71 23.035 70-74 20.205000000000002 29.035 27.42 23.34 75-79 19.869999999999997 29.4 27.21 23.52 80-84 19.895 29.285 27.705000000000002 23.115 85-89 20.115 29.265 26.979999999999997 23.64 90-94 19.61 29.520000000000003 27.42 23.45 95-99 19.814999999999998 29.354999999999997 27.57 23.26 100-104 20.02 29.099999999999998 27.605 23.275000000000002 105-109 19.86 28.7 27.87 23.57 110-114 20.419999999999998 28.935 27.339999999999996 23.305 115-119 20.0 29.770000000000003 26.715 23.515 120-124 20.06 29.270000000000003 27.93 22.74 125-129 20.215 28.499999999999996 27.76 23.525 130-134 20.3 28.884999999999998 27.515 23.3 135-139 20.71 29.585 26.69 23.015 140-144 21.060000000000002 29.49 26.145000000000003 23.305 145-149 21.2 29.494999999999997 26.025 23.28 150-151 21.45 29.95 25.525 23.075000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.5 20 1.5 21 1.5 22 1.5 23 4.0 24 6.5 25 8.0 26 11.5 27 14.5 28 22.5 29 29.0 30 32.5 31 40.0 32 46.5 33 61.5 34 81.5 35 101.0 36 121.5 37 134.5 38 162.5 39 184.0 40 192.5 41 197.5 42 205.5 43 243.0 44 266.5 45 250.0 46 230.0 47 226.5 48 204.5 49 178.5 50 146.5 51 109.0 52 99.5 53 79.0 54 62.5 55 53.5 56 35.0 57 33.0 58 29.0 59 16.0 60 11.5 61 10.0 62 6.5 63 4.0 64 4.0 65 5.5 66 5.0 67 2.5 68 2.5 69 2.5 70 1.0 71 1.5 72 1.0 73 1.5 74 2.5 75 2.0 76 2.0 77 2.0 78 1.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.35000000000000003 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.55 #Duplication Level Percentage of deduplicated Percentage of total 1 93.42597541421699 87.4 2 6.280064136825227 11.75 3 0.26723677177979693 0.75 4 0.026723677177979688 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.2625 0.0 0.0 0.0 0.0 112-113 0.325 0.0 0.0 0.0 0.0 114-115 0.4 0.0 0.0 0.0 0.0 116-117 0.5 0.0 0.0 0.0 0.0 118-119 0.6125 0.0 0.0 0.0 0.0 120-121 0.7 0.0 0.0 0.0 0.0 122-123 0.9249999999999999 0.0 0.0 0.0 0.0 124-125 1.1625 0.0 0.0 0.0 0.0 126-127 1.5375 0.0 0.0 0.0 0.0 128-129 1.9625 0.0 0.0 0.0 0.0 130-131 2.2874999999999996 0.0 0.0 0.0 0.0 132-133 2.7875 0.0 0.0 0.0 0.0 134-135 3.2625 0.0 0.0 0.0 0.0 136-137 4.074999999999999 0.0 0.0 0.0 0.0 138-139 4.762499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAGATG 10 0.006830828 145.0 3 CTCCCTT 15 1.1411342E-4 145.0 8 GCAAGAT 10 0.006830828 145.0 2 AAGATGG 10 0.006830828 145.0 4 TGGAAGA 10 0.006830828 145.0 8 TCTCCCT 10 0.006830828 145.0 7 CGCAAGA 10 0.006830828 145.0 1 AAAAAAA 80 0.0020131238 12.6875 120-124 >>END_MODULE SRR22215355 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215355_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.386 37.0 37.0 37.0 37.0 37.0 2 36.1295 37.0 37.0 37.0 37.0 37.0 3 35.9745 37.0 37.0 37.0 37.0 37.0 4 35.916 37.0 37.0 37.0 37.0 37.0 5 35.976 37.0 37.0 37.0 37.0 37.0 6 36.007 37.0 37.0 37.0 37.0 37.0 7 35.9425 37.0 37.0 37.0 37.0 37.0 8 36.0035 37.0 37.0 37.0 37.0 37.0 9 35.9975 37.0 37.0 37.0 37.0 37.0 10-14 35.9654 37.0 37.0 37.0 37.0 37.0 15-19 35.9033 37.0 37.0 37.0 37.0 37.0 20-24 35.9174 37.0 37.0 37.0 37.0 37.0 25-29 35.8138 37.0 37.0 37.0 37.0 37.0 30-34 35.7349 37.0 37.0 37.0 37.0 37.0 35-39 35.7531 37.0 37.0 37.0 37.0 37.0 40-44 35.6793 37.0 37.0 37.0 37.0 37.0 45-49 35.7449 37.0 37.0 37.0 37.0 37.0 50-54 35.6291 37.0 37.0 37.0 37.0 37.0 55-59 35.6575 37.0 37.0 37.0 37.0 37.0 60-64 35.6263 37.0 37.0 37.0 37.0 37.0 65-69 35.4853 37.0 37.0 37.0 37.0 37.0 70-74 35.4953 37.0 37.0 37.0 37.0 37.0 75-79 35.4532 37.0 37.0 37.0 34.6 37.0 80-84 35.3682 37.0 37.0 37.0 37.0 37.0 85-89 35.3897 37.0 37.0 37.0 34.6 37.0 90-94 35.3622 37.0 37.0 37.0 34.6 37.0 95-99 35.357 37.0 37.0 37.0 37.0 37.0 100-104 35.300599999999996 37.0 37.0 37.0 32.2 37.0 105-109 35.312400000000004 37.0 37.0 37.0 34.6 37.0 110-114 35.1777 37.0 37.0 37.0 29.8 37.0 115-119 35.164500000000004 37.0 37.0 37.0 27.4 37.0 120-124 35.0145 37.0 37.0 37.0 25.0 37.0 125-129 35.032 37.0 37.0 37.0 25.0 37.0 130-134 35.0187 37.0 37.0 37.0 25.0 37.0 135-139 34.933 37.0 37.0 37.0 25.0 37.0 140-144 34.763999999999996 37.0 37.0 37.0 25.0 37.0 145-149 34.698 37.0 37.0 37.0 25.0 37.0 150-151 34.66675 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 1.0 17 1.0 18 1.0 19 0.0 20 2.0 21 4.0 22 5.0 23 7.0 24 11.0 25 15.0 26 17.0 27 22.0 28 26.0 29 37.0 30 59.0 31 82.0 32 88.0 33 153.0 34 286.0 35 811.0 36 2229.0 37 141.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.35 21.45 16.125 30.075000000000003 2 28.975 26.825 30.675 13.525 3 22.900000000000002 30.975 28.675 17.45 4 25.6 34.325 22.900000000000002 17.175 5 25.7 37.25 21.224999999999998 15.825 6 19.025 39.625 24.725 16.625 7 19.925 19.3 41.125 19.650000000000002 8 22.650000000000002 23.375 30.125 23.849999999999998 9 23.799999999999997 24.099999999999998 29.625 22.475 10-14 24.26 28.475 26.82 20.445 15-19 23.799999999999997 28.575 27.805000000000003 19.82 20-24 23.669999999999998 28.725 27.384999999999998 20.22 25-29 23.815 28.384999999999998 28.144999999999996 19.655 30-34 23.799999999999997 28.485 28.005000000000003 19.71 35-39 23.119999999999997 28.194999999999997 28.384999999999998 20.3 40-44 23.405 27.939999999999998 28.455000000000002 20.200000000000003 45-49 23.78 28.389999999999997 28.035 19.794999999999998 50-54 23.66 28.595 27.935 19.81 55-59 23.395 27.095000000000002 29.439999999999998 20.07 60-64 23.225 27.88 28.535 20.36 65-69 23.375 27.66 29.154999999999998 19.81 70-74 23.849999999999998 27.785 28.405 19.96 75-79 22.645 27.800000000000004 29.104999999999997 20.45 80-84 23.799999999999997 27.55 28.799999999999997 19.85 85-89 23.775 27.705000000000002 28.465 20.055 90-94 23.915 28.21 28.785 19.09 95-99 22.945 28.88 28.685 19.49 100-104 23.95 28.04 28.754999999999995 19.255 105-109 22.825 27.68 29.770000000000003 19.725 110-114 23.419999999999998 27.474999999999998 29.255 19.85 115-119 23.794999999999998 27.97 28.9 19.335 120-124 23.465 28.115000000000002 28.845 19.575 125-129 23.805 27.88 29.044999999999998 19.27 130-134 23.544999999999998 28.1 28.494999999999997 19.86 135-139 24.615000000000002 28.17 27.860000000000003 19.355 140-144 24.375 28.725 27.71 19.189999999999998 145-149 25.290000000000003 28.895 27.169999999999998 18.645 150-151 24.85 29.062500000000004 27.187499999999996 18.9 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 2.0 20 3.5 21 3.0 22 3.0 23 2.5 24 2.0 25 3.0 26 7.0 27 10.0 28 11.5 29 14.5 30 20.0 31 29.5 32 36.5 33 52.5 34 59.0 35 73.0 36 102.5 37 119.0 38 154.0 39 190.0 40 207.0 41 224.5 42 247.5 43 288.5 44 312.0 45 274.5 46 230.5 47 232.0 48 227.0 49 177.5 50 126.0 51 109.5 52 88.5 53 68.0 54 62.0 55 48.5 56 34.0 57 23.5 58 22.5 59 18.0 60 14.0 61 11.0 62 8.5 63 6.5 64 5.0 65 4.5 66 3.0 67 3.5 68 5.5 69 3.0 70 0.5 71 0.5 72 0.0 73 1.5 74 2.5 75 1.0 76 0.5 77 1.0 78 0.5 79 0.0 80 1.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.5 97 1.0 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.575 #Duplication Level Percentage of deduplicated Percentage of total 1 93.61474752872027 87.6 2 5.957787870691958 11.15 3 0.37403152551429336 1.05 4 0.05343307507347048 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.425 0.0 0.0 0.0 0.0 116-117 0.5249999999999999 0.0 0.0 0.0 0.0 118-119 0.6375 0.0 0.0 0.0 0.0 120-121 0.7 0.0 0.0 0.0 0.0 122-123 0.9125 0.0 0.0 0.0 0.0 124-125 1.1375000000000002 0.0 0.0 0.0 0.0 126-127 1.5375 0.0 0.0 0.0 0.0 128-129 1.9625 0.0 0.0 0.0 0.0 130-131 2.325 0.0 0.0 0.0 0.0 132-133 2.875 0.0 0.0 0.0 0.0 134-135 3.3499999999999996 0.0 0.0 0.0 0.0 136-137 4.125 0.0 0.0 0.0 0.0 138-139 4.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTAAGAT 10 0.006830828 145.0 2 TTGCGAG 10 0.006830828 145.0 145 >>END_MODULE Read 1855743 spots for SRR22215355.sra Written 1855743 spots for SRR22215355.sra Read 1855743 spots for SRR22215355.sra Written 1855743 spots for SRR22215355.sra Read 1855743 spots for SRR22215355.sra Written 1855743 spots for SRR22215355.sra Read 1855743 spots for SRR22215355.sra Written 1855743 spots for SRR22215355.sra Read 1855743 spots for SRR22215355.sra Written 1855743 spots for SRR22215355.sra Read 1855743 spots for SRR22215355.sra Written 1855743 spots for SRR22215355.sra Read 1855743 spots for SRR22215355.sra Written 1855743 spots for SRR22215355.sra Read 1855743 spots for SRR22215355.sra Written 1855743 spots for SRR22215355.sra Read 1855743 spots for SRR22215355.sra Written 1855743 spots for SRR22215355.sra Read 1855743 spots for SRR22215355.sra Written 1855743 spots for SRR22215355.sra Read 1855743 spots for SRR22215355.sra Written 1855743 spots for SRR22215355.sra Read 1855750 spots for SRR22215355.sra Written 1855750 spots for SRR22215355.sra Read 1855743 spots for SRR22215355.sra Written 1855743 spots for SRR22215355.sra Read 1855743 spots for SRR22215355.sra Written 1855743 spots for SRR22215355.sra Read 1855743 spots for SRR22215355.sra Written 1855743 spots for SRR22215355.sra Read 1855743 spots for SRR22215355.sra Written 1855743 spots for SRR22215355.sra Read 1855743 spots for SRR22215355.sra Written 1855743 spots for SRR22215355.sra Read 1855743 spots for SRR22215355.sra Written 1855743 spots for SRR22215355.sra Read 1855743 spots for SRR22215355.sra Written 1855743 spots for SRR22215355.sra Read 1855743 spots for SRR22215355.sra Written 1855743 spots for SRR22215355.sra SRR ids: ['SRR22215355.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j9qa93bm SRR22215355.sra spots: 37114867 blocks: [[1, 1855743], [1855744, 3711486], [3711487, 5567229], [5567230, 7422972], [7422973, 9278715], [9278716, 11134458], [11134459, 12990201], [12990202, 14845944], [14845945, 16701687], [16701688, 18557430], [18557431, 20413173], [20413174, 22268916], [22268917, 24124659], [24124660, 25980402], [25980403, 27836145], [27836146, 29691888], [29691889, 31547631], [31547632, 33403374], [33403375, 35259117], [35259118, 37114867]] SRR22215355 file size 12591555 SRR22215355 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22215355 SRR22215355_1.fastq SRR22215355_2.fastq Input file: SRR22215355_1.fastq Paired file: SRR22215355_2.fastq trimmed: SRR22215355-trimmed-pair1.fastq, SRR22215355-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:05:21 2025 >> started Tue Feb 11 10:06:04 2025 >> done (42.517s) 37114867 read pairs processed; of these: 73 ( 0.00%) short read pairs filtered out after trimming by size control 46103 ( 0.12%) empty read pairs filtered out after trimming by size control 37068691 (99.88%) read pairs available; of these: 4489854 (12.11%) trimmed read pairs available after processing 32578837 (87.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 5 0.00% 20 6 0.00% 21 3 0.00% 22 2 0.00% 23 2 0.00% 24 5 0.00% 25 5 0.00% 26 6 0.00% 27 3 0.00% 28 3 0.00% 29 9 0.00% 30 6 0.00% 31 5 0.00% 32 4 0.00% 33 9 0.00% 34 6 0.00% 35 5 0.00% 36 7 0.00% 37 9 0.00% 38 7 0.00% 39 7 0.00% 40 11 0.00% 41 11 0.00% 42 9 0.00% 43 23 0.00% 44 10 0.00% 45 9 0.00% 46 11 0.00% 47 20 0.00% 48 20 0.00% 49 23 0.00% 50 20 0.00% 51 24 0.00% 52 23 0.00% 53 29 0.00% 54 35 0.00% 55 31 0.00% 56 39 0.00% 57 39 0.00% 58 42 0.00% 59 50 0.00% 60 59 0.00% 61 54 0.00% 62 63 0.00% 63 56 0.00% 64 72 0.00% 65 94 0.00% 66 88 0.00% 67 102 0.00% 68 101 0.00% 69 126 0.00% 70 142 0.00% 71 176 0.00% 72 193 0.00% 73 232 0.00% 74 230 0.00% 75 231 0.00% 76 269 0.00% 77 320 0.00% 78 377 0.00% 79 382 0.00% 80 470 0.00% 81 502 0.00% 82 567 0.00% 83 635 0.00% 84 655 0.00% 85 788 0.00% 86 844 0.00% 87 994 0.00% 88 1077 0.00% 89 1246 0.00% 90 1341 0.00% 91 1483 0.00% 92 1598 0.00% 93 1764 0.00% 94 1981 0.01% 95 2190 0.01% 96 2432 0.01% 97 2528 0.01% 98 2837 0.01% 99 3107 0.01% 100 3430 0.01% 101 3653 0.01% 102 3999 0.01% 103 4389 0.01% 104 5143 0.01% 105 5466 0.01% 106 6329 0.02% 107 6708 0.02% 108 7639 0.02% 109 8570 0.02% 110 9591 0.03% 111 10723 0.03% 112 11826 0.03% 113 13331 0.04% 114 14889 0.04% 115 17191 0.05% 116 19153 0.05% 117 22145 0.06% 118 25111 0.07% 119 27670 0.07% 120 30840 0.08% 121 35280 0.10% 122 38516 0.10% 123 42533 0.11% 124 47874 0.13% 125 53427 0.14% 126 59930 0.16% 127 66431 0.18% 128 73988 0.20% 129 81503 0.22% 130 87912 0.24% 131 95661 0.26% 132 102252 0.28% 133 111274 0.30% 134 118470 0.32% 135 126919 0.34% 136 137517 0.37% 137 148252 0.40% 138 156556 0.42% 139 169174 0.46% 140 178274 0.48% 141 186508 0.50% 142 194919 0.53% 143 202998 0.55% 144 213443 0.58% 145 218652 0.59% 146 228786 0.62% 147 238803 0.64% 148 249708 0.67% 149 261166 0.70% 150 272332 0.73% 151 32578837 87.89% 37068691 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=3.54 fanout-score-rank=17 prefix-density=0.52 prefix-fanout=3.0 sequence=GGTGCTGGAGCTGGAGC criterion=fanout-score sequence-density=0.11 sequence-density-rank=21 fanout-score=30.51 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=10.0 sequence=CCTTCCTTGTCCTGGATCTTAGCCTTGACATTGTCAATGGTGTCTGAGCTCTCCAC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.88 fanout-score-rank=19 prefix-density=0.42 prefix-fanout=2.5 sequence=GTGAACATAACCACAGGACTTACCAATACAAGTTTATCTGGCACGGTATACACGGACAACCAGCTAGCCATTTATAAGATTGAGAAGGTGCTACTTCCTAAGGACATTTTTGCTTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=33 fanout-score=30.42 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=4.1 sequence=TCAGACTGTGAAACTGCGAATGGCTCATTAAATCAGTTATAGTTTGTTTGATGGTATTTGCTACTCGGATAACCGTAGTAATTCTAGAGCTAATACGTGCAACAAACCCCGACTTCTGGAAGGGACGCATTTATTAGATAAAAGGTCGACGCGGGCTCTGCCCGTTGCTCTGATGATTCATGATAACTCGACGGATCGCACGGCCTTCGTGCTGGCGACGCATCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTGGTGACGGGTGACGGAGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCTGACACGGGGAGGTAGTGACAATAAATAACAATACCGGGCTCTTCGAGTCTGGTAATTGGAATGAGTACAATCTAAATCCCTTAACGAGGATCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATT SRR22215355 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:06:48 Started mapping on | Feb 11 10:06:48 Finished on | Feb 11 10:10:10 Mapping speed, Million of reads per hour | 660.63 Number of input reads | 37068691 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 34808008 Uniquely mapped reads % | 93.90% Average mapped length | 297.53 Number of splices: Total | 24650331 Number of splices: Annotated (sjdb) | 24097996 Number of splices: GT/AG | 24264992 Number of splices: GC/AG | 291893 Number of splices: AT/AC | 31270 Number of splices: Non-canonical | 62176 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.30 Insertion rate per base | 0.02% Insertion average length | 1.88 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 792000 % of reads mapped to multiple loci | 2.14% Number of reads mapped to too many loci | 487278 % of reads mapped to too many loci | 1.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.17% % of reads unmapped: other | 0.48% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1468683 1468683 1468683 N_multimapping 792000 792000 792000 N_noFeature 1315682 34250519 1488865 N_ambiguous 550717 2233 165481 UnstrandedReadsAssigned:32941609 PositiveStrandReadsAssigned:555256 NegativeStrandReadsAssigned:33153662 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR22215355 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22215355-trimmed-pair1.fastq SRR22215355-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,068,691 reads, 33,946,105 reads pseudoaligned [quant] estimated average fragment length: 190.392 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,214 rounds 52401 SRR22215355.ke.tsv 34699 SRR22215355.se.tsv 87100 total ==> SRR22215355.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1828.61 4945 77.918 Potri.005G024800.1.v4.1 1035 845.608 2555 87.0591 Potri.004G059700.1.v4.1 961 771.613 416 15.5341 Potri.007G009000.2.v4.1 1416 1226.61 0 0 Potri.003G141000.2.v4.1 2943 2753.61 931.224 9.74416 Potri.016G087400.1.v4.1 270 84.796 1647 559.642 Potri.015G069301.1.v4.1 564 374.65 0 0 Potri.010G195200.1.v4.1 1773 1583.61 76 1.3828 Potri.012G127500.1.v4.1 977 787.608 7415 271.265 ==> SRR22215355.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1661 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 745 Potri.001G212900.v4.1 13 Potri.001G182400.v4.1 407 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR22215355 completed mapping pipeline successfully