Starting /dee2/code/volunteer_pipeline.sh SRR22215356 current disk space = 3053299175424 free memory = 1474109532 SRR22215356 SRAfilesize cd55a27d5d6cdaa5be06eb00a269c0c9 SRR22215356.sra SRR22215356.sra file validated SRR22215356 is paired end SRR22215356 is conventional basespace SRR22215356 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215356_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.879 37.0 37.0 37.0 37.0 37.0 2 36.02175 37.0 37.0 37.0 37.0 37.0 3 36.288 37.0 37.0 37.0 37.0 37.0 4 36.2785 37.0 37.0 37.0 37.0 37.0 5 36.3215 37.0 37.0 37.0 37.0 37.0 6 36.247 37.0 37.0 37.0 37.0 37.0 7 36.201 37.0 37.0 37.0 37.0 37.0 8 36.281 37.0 37.0 37.0 37.0 37.0 9 36.255 37.0 37.0 37.0 37.0 37.0 10-14 36.27819999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.236900000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.1708 37.0 37.0 37.0 37.0 37.0 25-29 36.1089 37.0 37.0 37.0 37.0 37.0 30-34 36.07620000000001 37.0 37.0 37.0 37.0 37.0 35-39 35.9803 37.0 37.0 37.0 37.0 37.0 40-44 35.9678 37.0 37.0 37.0 37.0 37.0 45-49 36.0119 37.0 37.0 37.0 37.0 37.0 50-54 35.940099999999994 37.0 37.0 37.0 37.0 37.0 55-59 35.9198 37.0 37.0 37.0 37.0 37.0 60-64 35.8759 37.0 37.0 37.0 37.0 37.0 65-69 35.9032 37.0 37.0 37.0 37.0 37.0 70-74 35.789300000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.822 37.0 37.0 37.0 37.0 37.0 80-84 35.7043 37.0 37.0 37.0 37.0 37.0 85-89 35.709900000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.5509 37.0 37.0 37.0 37.0 37.0 95-99 35.591899999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.579600000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.582100000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.5244 37.0 37.0 37.0 37.0 37.0 115-119 35.524899999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.4542 37.0 37.0 37.0 37.0 37.0 125-129 35.4563 37.0 37.0 37.0 37.0 37.0 130-134 35.4085 37.0 37.0 37.0 37.0 37.0 135-139 35.3684 37.0 37.0 37.0 34.6 37.0 140-144 35.27810000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.2607 37.0 37.0 37.0 32.2 37.0 150-151 35.11024999999999 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 2.0 21 0.0 22 1.0 23 2.0 24 6.0 25 14.0 26 11.0 27 12.0 28 26.0 29 44.0 30 46.0 31 77.0 32 99.0 33 118.0 34 223.0 35 473.0 36 2625.0 37 220.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.6448362720403 12.418136020151135 16.876574307304786 38.06045340050378 2 30.538172715894866 13.216520650813518 33.69211514392991 22.5531914893617 3 24.725 21.45 25.0 28.825 4 27.150000000000002 26.700000000000003 21.25 24.9 5 25.775 32.35 22.575 19.3 6 17.45 34.449999999999996 26.125 21.975 7 13.4 29.775000000000002 37.875 18.95 8 17.525 26.0 33.625 22.85 9 17.925 23.599999999999998 35.15 23.325000000000003 10-14 19.575 30.865 27.025 22.535 15-19 19.53 29.409999999999997 28.42 22.64 20-24 19.925 29.675 27.76 22.64 25-29 20.085 29.395 27.685 22.835 30-34 19.705000000000002 29.475 27.755000000000003 23.064999999999998 35-39 19.89 29.555 27.48 23.075000000000003 40-44 19.865 29.270000000000003 27.534999999999997 23.330000000000002 45-49 19.62 29.880000000000003 27.084999999999997 23.415 50-54 19.470000000000002 29.880000000000003 27.450000000000003 23.200000000000003 55-59 19.0 29.349999999999998 27.83 23.82 60-64 19.220000000000002 29.845 27.689999999999998 23.244999999999997 65-69 19.775000000000002 29.360000000000003 27.37 23.494999999999997 70-74 19.64 29.84 27.200000000000003 23.32 75-79 19.86 29.104999999999997 27.72 23.315 80-84 19.78 29.25 27.43 23.54 85-89 20.07 29.354999999999997 27.015 23.56 90-94 20.330000000000002 28.315 28.349999999999998 23.005 95-99 20.04 28.865000000000002 27.884999999999998 23.21 100-104 20.07 29.215000000000003 27.145000000000003 23.57 105-109 20.07 28.73 27.66 23.54 110-114 20.724999999999998 28.985 27.38 22.91 115-119 19.950000000000003 29.385 27.339999999999996 23.325000000000003 120-124 20.44 28.77 27.265 23.525 125-129 20.380000000000003 28.939999999999998 27.055 23.625 130-134 20.625 28.645 27.12 23.61 135-139 20.995 28.565 27.485 22.955000000000002 140-144 21.08 28.315 27.315 23.29 145-149 21.165 29.21 26.985 22.64 150-151 21.55 29.049999999999997 26.325 23.075000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 2.5 19 3.0 20 1.5 21 1.5 22 2.5 23 3.5 24 6.5 25 7.5 26 8.5 27 13.5 28 15.0 29 22.5 30 31.5 31 38.5 32 47.0 33 63.0 34 84.0 35 103.0 36 111.0 37 121.0 38 148.0 39 186.0 40 198.0 41 204.5 42 229.0 43 245.0 44 253.0 45 238.0 46 233.0 47 239.5 48 210.0 49 170.0 50 146.0 51 117.0 52 95.0 53 79.0 54 69.5 55 58.0 56 38.0 57 33.0 58 29.0 59 19.5 60 14.0 61 12.0 62 9.0 63 7.0 64 6.5 65 4.5 66 4.0 67 2.0 68 1.5 69 3.5 70 3.5 71 1.5 72 0.5 73 0.5 74 1.0 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.75 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.75 #Duplication Level Percentage of deduplicated Percentage of total 1 92.64150943396227 85.925 2 6.900269541778976 12.8 3 0.4582210242587601 1.275 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.037500000000000006 0.0 0.0 0.0 0.0 108-109 0.0875 0.0 0.0 0.0 0.0 110-111 0.1125 0.0 0.0 0.0 0.0 112-113 0.15 0.0 0.0 0.0 0.0 114-115 0.16249999999999998 0.0 0.0 0.0 0.0 116-117 0.1875 0.0 0.0 0.0 0.0 118-119 0.25 0.0 0.0 0.0 0.0 120-121 0.425 0.0 0.0 0.0 0.0 122-123 0.6499999999999999 0.0 0.0 0.0 0.0 124-125 0.8125 0.0 0.0 0.0 0.0 126-127 0.95 0.0 0.0 0.0 0.0 128-129 1.175 0.0 0.0 0.0 0.0 130-131 1.5375 0.0 0.0 0.0 0.0 132-133 1.8125 0.0 0.0 0.0 0.0 134-135 2.1875 0.0 0.0 0.0 0.0 136-137 2.85 0.0 0.0 0.0 0.0 138-139 3.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR22215356 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215356_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.7385 37.0 37.0 37.0 37.0 37.0 2 36.2075 37.0 37.0 37.0 37.0 37.0 3 36.1805 37.0 37.0 37.0 37.0 37.0 4 36.015 37.0 37.0 37.0 37.0 37.0 5 36.023 37.0 37.0 37.0 37.0 37.0 6 36.093 37.0 37.0 37.0 37.0 37.0 7 35.9655 37.0 37.0 37.0 37.0 37.0 8 36.1175 37.0 37.0 37.0 37.0 37.0 9 36.2025 37.0 37.0 37.0 37.0 37.0 10-14 36.0948 37.0 37.0 37.0 37.0 37.0 15-19 36.0815 37.0 37.0 37.0 37.0 37.0 20-24 36.1104 37.0 37.0 37.0 37.0 37.0 25-29 36.0777 37.0 37.0 37.0 37.0 37.0 30-34 35.943200000000004 37.0 37.0 37.0 37.0 37.0 35-39 35.9768 37.0 37.0 37.0 37.0 37.0 40-44 35.8495 37.0 37.0 37.0 37.0 37.0 45-49 35.8327 37.0 37.0 37.0 37.0 37.0 50-54 35.805899999999994 37.0 37.0 37.0 37.0 37.0 55-59 35.79440000000001 37.0 37.0 37.0 37.0 37.0 60-64 35.740700000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.72330000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.6925 37.0 37.0 37.0 37.0 37.0 75-79 35.6425 37.0 37.0 37.0 37.0 37.0 80-84 35.62050000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.6341 37.0 37.0 37.0 37.0 37.0 90-94 35.578 37.0 37.0 37.0 37.0 37.0 95-99 35.560500000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.4455 37.0 37.0 37.0 37.0 37.0 105-109 35.44590000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.4809 37.0 37.0 37.0 37.0 37.0 115-119 35.392599999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.267700000000005 37.0 37.0 37.0 34.6 37.0 125-129 35.29 37.0 37.0 37.0 34.6 37.0 130-134 35.2063 37.0 37.0 37.0 29.8 37.0 135-139 35.1992 37.0 37.0 37.0 29.8 37.0 140-144 35.0646 37.0 37.0 37.0 27.4 37.0 145-149 34.9541 37.0 37.0 37.0 25.0 37.0 150-151 35.06275 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 3.0 19 1.0 20 3.0 21 7.0 22 5.0 23 5.0 24 12.0 25 12.0 26 16.0 27 18.0 28 22.0 29 29.0 30 35.0 31 51.0 32 85.0 33 134.0 34 245.0 35 660.0 36 2430.0 37 226.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.25 21.025 17.175 30.55 2 28.15 27.85 30.349999999999998 13.65 3 21.95 31.525 28.7 17.825 4 25.0 35.425000000000004 21.675 17.9 5 27.025 37.275000000000006 20.150000000000002 15.55 6 19.225 40.8 22.7 17.275 7 20.45 18.099999999999998 41.6 19.85 8 22.725 22.55 30.525000000000002 24.2 9 24.15 23.5 28.1 24.25 10-14 23.72 28.660000000000004 26.33 21.29 15-19 23.32 28.415000000000003 27.865000000000002 20.4 20-24 23.79 28.194999999999997 27.66 20.355 25-29 23.995 28.194999999999997 27.6 20.21 30-34 23.57 28.299999999999997 27.735 20.395 35-39 23.005 28.23 28.215 20.549999999999997 40-44 22.765 28.799999999999997 28.33 20.105 45-49 23.78 28.215 28.084999999999997 19.919999999999998 50-54 23.65 28.444999999999997 27.765 20.14 55-59 23.115 28.449999999999996 27.875 20.560000000000002 60-64 22.95 27.884999999999998 28.575 20.59 65-69 23.015 27.915 28.425 20.645 70-74 23.39 28.194999999999997 28.095 20.32 75-79 23.43 28.38 28.110000000000003 20.080000000000002 80-84 24.115000000000002 27.61 28.03 20.244999999999997 85-89 23.61 28.415000000000003 28.294999999999998 19.68 90-94 23.555 27.87 28.65 19.925 95-99 23.345 28.455000000000002 28.365000000000002 19.835 100-104 23.400000000000002 27.775 28.560000000000002 20.265 105-109 23.36 27.765 29.349999999999998 19.525000000000002 110-114 23.26 27.805000000000003 28.895 20.04 115-119 23.375 28.735 28.305000000000003 19.585 120-124 23.28 27.955000000000002 28.575 20.19 125-129 23.669999999999998 28.89 28.025 19.415 130-134 23.365 28.425 28.18 20.03 135-139 23.945 27.295 29.475 19.285 140-144 24.279999999999998 28.405 28.015 19.3 145-149 24.63 28.585 27.705000000000002 19.08 150-151 24.762500000000003 28.8875 27.6375 18.712500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.5 9 0.5 10 0.5 11 1.5 12 1.0 13 0.5 14 0.5 15 1.0 16 2.5 17 2.5 18 1.0 19 0.5 20 1.5 21 2.0 22 1.0 23 2.0 24 3.5 25 3.0 26 3.5 27 8.5 28 15.0 29 17.5 30 15.5 31 21.5 32 38.0 33 48.5 34 59.0 35 79.5 36 88.0 37 113.0 38 138.5 39 158.0 40 196.0 41 229.5 42 248.5 43 269.0 44 273.0 45 260.0 46 279.5 47 267.5 48 231.5 49 189.5 50 148.0 51 115.5 52 90.5 53 82.0 54 70.5 55 52.5 56 32.0 57 19.0 58 19.5 59 18.0 60 13.0 61 16.0 62 11.5 63 7.5 64 6.5 65 5.0 66 3.0 67 2.0 68 0.5 69 0.0 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.5 79 0.5 80 0.5 81 0.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.5 98 1.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.45 #Duplication Level Percentage of deduplicated Percentage of total 1 92.29313142239049 85.32499999999999 2 7.274202271498107 13.450000000000001 3 0.40562466197944835 1.125 4 0.027041644131963225 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.1125 0.0 0.0 0.0 0.0 110-111 0.1375 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.1875 0.0 0.0 0.0 0.0 116-117 0.21250000000000002 0.0 0.0 0.0 0.0 118-119 0.3 0.0 0.0 0.0 0.0 120-121 0.475 0.0 0.0 0.0 0.0 122-123 0.7 0.0 0.0 0.0 0.0 124-125 0.8625 0.0 0.0 0.0 0.0 126-127 0.9874999999999999 0.0 0.0 0.0 0.0 128-129 1.2 0.0 0.0 0.0 0.0 130-131 1.5625 0.0 0.0 0.0 0.0 132-133 1.8375 0.0 0.0 0.0 0.0 134-135 2.225 0.0 0.0 0.0 0.0 136-137 2.9 0.0 0.0 0.0 0.0 138-139 3.5875000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2082986 spots for SRR22215356.sra Written 2082986 spots for SRR22215356.sra Read 2082986 spots for SRR22215356.sra Written 2082986 spots for SRR22215356.sra Read 2082986 spots for SRR22215356.sra Written 2082986 spots for SRR22215356.sra Read 2082986 spots for SRR22215356.sra Written 2082986 spots for SRR22215356.sra Read 2082986 spots for SRR22215356.sra Written 2082986 spots for SRR22215356.sra Read 2082986 spots for SRR22215356.sra Written 2082986 spots for SRR22215356.sra Read 2082986 spots for SRR22215356.sra Written 2082986 spots for SRR22215356.sra Read 2082986 spots for SRR22215356.sra Written 2082986 spots for SRR22215356.sra Read 2082986 spots for SRR22215356.sra Written 2082986 spots for SRR22215356.sra Read 2082986 spots for SRR22215356.sra Written 2082986 spots for SRR22215356.sra Read 2082986 spots for SRR22215356.sra Written 2082986 spots for SRR22215356.sra Read 2082986 spots for SRR22215356.sra Written 2082986 spots for SRR22215356.sra Read 2082986 spots for SRR22215356.sra Written 2082986 spots for SRR22215356.sra Read 2082986 spots for SRR22215356.sra Written 2082986 spots for SRR22215356.sra Read 2082986 spots for SRR22215356.sra Written 2082986 spots for SRR22215356.sra Read 2082986 spots for SRR22215356.sra Written 2082986 spots for SRR22215356.sra Read 2083000 spots for SRR22215356.sra Written 2083000 spots for SRR22215356.sra Read 2082986 spots for SRR22215356.sra Written 2082986 spots for SRR22215356.sra Read 2082986 spots for SRR22215356.sra Written 2082986 spots for SRR22215356.sra Read 2082986 spots for SRR22215356.sra Written 2082986 spots for SRR22215356.sra SRR ids: ['SRR22215356.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_elbq8cqa SRR22215356.sra spots: 41659734 blocks: [[1, 2082986], [2082987, 4165972], [4165973, 6248958], [6248959, 8331944], [8331945, 10414930], [10414931, 12497916], [12497917, 14580902], [14580903, 16663888], [16663889, 18746874], [18746875, 20829860], [20829861, 22912846], [22912847, 24995832], [24995833, 27078818], [27078819, 29161804], [29161805, 31244790], [31244791, 33327776], [33327777, 35410762], [35410763, 37493748], [37493749, 39576734], [39576735, 41659734]] SRR22215356 file size 14136099 SRR22215356 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22215356 SRR22215356_1.fastq SRR22215356_2.fastq Input file: SRR22215356_1.fastq Paired file: SRR22215356_2.fastq trimmed: SRR22215356-trimmed-pair1.fastq, SRR22215356-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:30:45 2025 >> started Tue Feb 11 10:31:37 2025 >> done (51.573s) 41659734 read pairs processed; of these: 86 ( 0.00%) short read pairs filtered out after trimming by size control 22038 ( 0.05%) empty read pairs filtered out after trimming by size control 41637610 (99.95%) read pairs available; of these: 4109425 ( 9.87%) trimmed read pairs available after processing 37528185 (90.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 2 0.00% 21 6 0.00% 22 3 0.00% 23 2 0.00% 24 5 0.00% 25 5 0.00% 26 5 0.00% 27 5 0.00% 28 4 0.00% 29 4 0.00% 30 10 0.00% 31 11 0.00% 32 8 0.00% 33 6 0.00% 34 6 0.00% 35 7 0.00% 36 9 0.00% 37 14 0.00% 38 15 0.00% 39 6 0.00% 40 11 0.00% 41 16 0.00% 42 11 0.00% 43 16 0.00% 44 21 0.00% 45 16 0.00% 46 15 0.00% 47 22 0.00% 48 14 0.00% 49 20 0.00% 50 20 0.00% 51 18 0.00% 52 19 0.00% 53 29 0.00% 54 25 0.00% 55 38 0.00% 56 24 0.00% 57 35 0.00% 58 33 0.00% 59 36 0.00% 60 44 0.00% 61 39 0.00% 62 44 0.00% 63 46 0.00% 64 62 0.00% 65 42 0.00% 66 80 0.00% 67 54 0.00% 68 66 0.00% 69 103 0.00% 70 100 0.00% 71 104 0.00% 72 116 0.00% 73 123 0.00% 74 139 0.00% 75 152 0.00% 76 172 0.00% 77 198 0.00% 78 214 0.00% 79 253 0.00% 80 298 0.00% 81 308 0.00% 82 373 0.00% 83 425 0.00% 84 429 0.00% 85 608 0.00% 86 592 0.00% 87 620 0.00% 88 729 0.00% 89 764 0.00% 90 915 0.00% 91 1048 0.00% 92 1076 0.00% 93 1170 0.00% 94 1344 0.00% 95 1504 0.00% 96 1700 0.00% 97 1938 0.00% 98 2151 0.01% 99 2213 0.01% 100 2469 0.01% 101 2683 0.01% 102 3061 0.01% 103 3375 0.01% 104 3681 0.01% 105 4220 0.01% 106 4522 0.01% 107 5203 0.01% 108 5736 0.01% 109 6351 0.02% 110 7126 0.02% 111 7819 0.02% 112 8768 0.02% 113 9973 0.02% 114 11396 0.03% 115 12601 0.03% 116 14687 0.04% 117 16324 0.04% 118 18643 0.04% 119 21485 0.05% 120 24279 0.06% 121 27223 0.07% 122 30291 0.07% 123 33907 0.08% 124 38272 0.09% 125 43192 0.10% 126 48288 0.12% 127 54529 0.13% 128 61435 0.15% 129 68236 0.16% 130 75086 0.18% 131 82082 0.20% 132 88593 0.21% 133 96822 0.23% 134 104197 0.25% 135 113225 0.27% 136 123694 0.30% 137 132911 0.32% 138 143536 0.34% 139 156496 0.38% 140 165391 0.40% 141 176369 0.42% 142 185512 0.45% 143 193905 0.47% 144 204247 0.49% 145 213377 0.51% 146 221094 0.53% 147 233591 0.56% 148 245994 0.59% 149 257346 0.62% 150 273247 0.66% 151 37528185 90.13% 41637610 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=3.72 fanout-score-rank=18 prefix-density=0.35 prefix-fanout=3.1 sequence=GGTGCTGGAGCTGGAGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=58.82 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=4.4 sequence=AAAAGCAGAATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGCAGCCACAGTTTCCTCCACAGCAAGACATTTTCTGTTGGA criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.92 fanout-score-rank=23 prefix-density=0.30 prefix-fanout=2.5 sequence=GTGAACATAACCACAGGACTTACCAATACAAGTTTATCTGGCACGGTATACACGGACAACCAGCTAGCCATTTATAAGATTGAGAAGGTGCTACTTCCTAAGGACATTTTTGCTTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=139.06 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=7.6 sequence=TCTTCTCTCTGTCTTCTTGATTCCTTGTTTTTCGTTCTGTTTATTACAGCAGCAATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGAAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCCGCAAAGCCTGCAGAAACCGTGGCTGCTGCATAATGTTTATAATACCAATATTTACTATGTGAAACTGTGTTCTACTGGGTTATAGTTAGTTGGGCTTTCTATGATCATGATGTGGATTCTGGATATCCAGCATGCTTTTACTGGGATGTAAGCTATAATAATTTCTCTGGTACATTCATATG SRR22215356 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:32:23 Started mapping on | Feb 11 10:32:23 Finished on | Feb 11 10:37:20 Mapping speed, Million of reads per hour | 504.70 Number of input reads | 41637610 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 39126371 Uniquely mapped reads % | 93.97% Average mapped length | 298.37 Number of splices: Total | 29680545 Number of splices: Annotated (sjdb) | 29002497 Number of splices: GT/AG | 29209606 Number of splices: GC/AG | 361673 Number of splices: AT/AC | 39926 Number of splices: Non-canonical | 69340 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.31 Insertion rate per base | 0.02% Insertion average length | 1.90 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 877592 % of reads mapped to multiple loci | 2.11% Number of reads mapped to too many loci | 573075 % of reads mapped to too many loci | 1.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.13% % of reads unmapped: other | 0.42% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1633647 1633647 1633647 N_multimapping 877592 877592 877592 N_noFeature 1690249 38568384 1888584 N_ambiguous 571332 2521 210278 UnstrandedReadsAssigned:36864790 PositiveStrandReadsAssigned:555466 NegativeStrandReadsAssigned:37027509 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR22215356 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22215356-trimmed-pair1.fastq SRR22215356-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 41,637,610 reads, 38,033,398 reads pseudoaligned [quant] estimated average fragment length: 194.071 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,171 rounds 52401 SRR22215356.ke.tsv 34699 SRR22215356.se.tsv 87100 total ==> SRR22215356.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1824.93 8125 114.123 Potri.005G024800.1.v4.1 1035 841.929 4222 128.54 Potri.004G059700.1.v4.1 961 767.929 293 9.78007 Potri.007G009000.2.v4.1 1416 1222.93 0 0 Potri.003G141000.2.v4.1 2943 2749.93 1037.15 9.66751 Potri.016G087400.1.v4.1 270 81.6171 1482 465.438 Potri.015G069301.1.v4.1 564 370.966 0 0 Potri.010G195200.1.v4.1 1773 1579.93 34 0.551616 Potri.012G127500.1.v4.1 977 783.929 2267 74.1259 ==> SRR22215356.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1925 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 799 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 242 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 12 SRR22215356 completed mapping pipeline successfully