Starting /dee2/code/volunteer_pipeline.sh SRR22839641 current disk space = 3088768065536 free memory = 1421393132 SRR22839641 SRAfilesize 84c5f5e9f4e14db6cffe4c07948de02d SRR22839641.sra SRR22839641.sra file validated SRR22839641 is paired end SRR22839641 is conventional basespace SRR22839641 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22839641_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.67875 32.0 32.0 32.0 27.0 32.0 2 29.495 32.0 32.0 32.0 12.0 32.0 3 27.6575 32.0 27.0 32.0 12.0 37.0 4 35.3725 37.0 37.0 37.0 32.0 37.0 5 36.01125 37.0 37.0 37.0 32.0 37.0 6 36.664 41.0 37.0 41.0 27.0 41.0 7 38.82475 41.0 37.0 41.0 32.0 41.0 8 39.725 41.0 41.0 41.0 37.0 41.0 9 40.1305 41.0 41.0 41.0 37.0 41.0 10-14 39.0386 41.0 39.4 41.0 34.0 41.0 15-19 39.3343 41.0 41.0 41.0 36.0 41.0 20-24 38.561099999999996 41.0 38.6 41.0 32.0 41.0 25-29 38.66044999999999 41.0 40.2 41.0 34.0 41.0 30-34 38.4471 41.0 38.6 41.0 33.0 41.0 35-39 39.2676 41.0 41.0 41.0 37.0 41.0 40-44 37.587799999999994 41.0 37.6 41.0 28.0 41.0 45-49 36.93945 41.0 36.0 41.0 26.0 41.0 50-54 36.986050000000006 41.0 37.0 41.0 26.0 41.0 55-59 35.7894 40.2 34.0 41.0 21.0 41.0 60-64 31.064600000000002 34.0 25.0 40.2 15.0 41.0 65-69 36.5299 40.2 34.0 41.0 25.0 41.0 70-74 32.4454 36.8 25.0 41.0 14.0 41.0 75-79 35.64834999999999 39.4 32.0 41.0 24.0 41.0 80-84 39.7136 41.0 41.0 41.0 37.0 41.0 85-89 39.1336 41.0 39.4 41.0 34.0 41.0 90-94 36.18675 40.2 34.0 41.0 23.0 41.0 95-99 36.9989 40.2 35.8 41.0 26.0 41.0 100-104 36.51115 41.0 36.0 41.0 25.0 41.0 105-109 36.11645 40.2 33.0 41.0 21.0 41.0 110-114 36.227500000000006 39.4 34.6 41.0 27.0 41.0 115-119 37.4914 41.0 37.6 41.0 27.0 41.0 120-124 35.47565 41.0 33.0 41.0 21.0 41.0 125-129 33.84740000000001 38.6 29.0 41.0 16.0 41.0 130-134 34.1464 37.4 31.0 40.2 21.0 41.0 135-139 33.5196 36.8 28.0 41.0 18.0 41.0 140-144 31.7232 34.8 26.0 40.2 19.0 41.0 145-149 32.767700000000005 35.8 27.0 40.2 20.0 41.0 150 35.283 41.0 32.0 41.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 0.0 22 5.0 23 13.0 24 17.0 25 17.0 26 43.0 27 43.0 28 70.0 29 120.0 30 122.0 31 152.0 32 189.0 33 243.0 34 272.0 35 317.0 36 308.0 37 392.0 38 436.0 39 619.0 40 620.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.4 16.55 20.95 37.1 2 21.875 24.349999999999998 35.65 18.125 3 21.575 27.875 28.599999999999998 21.95 4 24.474999999999998 31.5 21.349999999999998 22.675 5 22.900000000000002 35.15 23.25 18.7 6 18.224999999999998 38.475 24.55 18.75 7 17.224999999999998 18.099999999999998 44.074999999999996 20.599999999999998 8 19.475 22.5 30.0 28.025 9 21.025 22.75 30.15 26.075 10-14 21.15 30.395 27.025 21.43 15-19 21.135 28.42 28.51 21.935 20-24 21.395 28.395 28.34 21.87 25-29 21.58 28.410000000000004 27.875 22.134999999999998 30-34 21.54 28.494999999999997 27.48 22.485 35-39 21.725 28.04 27.985 22.25 40-44 21.47 28.27 28.005000000000003 22.255 45-49 21.505 27.74 28.475 22.28 50-54 21.87 28.410000000000004 27.565 22.155 55-59 22.585 27.415 28.185 21.815 60-64 22.39 28.365000000000002 28.015 21.23 65-69 22.49 27.87 27.36 22.28 70-74 22.56 27.63 28.035 21.775 75-79 21.990000000000002 27.595 28.365000000000002 22.05 80-84 22.575 28.189999999999998 27.224999999999998 22.009999999999998 85-89 22.155 27.339999999999996 28.299999999999997 22.205 90-94 22.400000000000002 27.615000000000002 27.24 22.745 95-99 23.125 27.485 27.425 21.965 100-104 21.93 27.965 27.765 22.34 105-109 21.87 27.800000000000004 28.17 22.16 110-114 22.585 27.93 27.305 22.18 115-119 22.575 27.889999999999997 27.655 21.88 120-124 22.785 28.005000000000003 26.965 22.245 125-129 22.49 28.299999999999997 27.529999999999998 21.68 130-134 22.59 27.339999999999996 27.935 22.134999999999998 135-139 22.52 28.125 27.495000000000005 21.86 140-144 22.575 27.38 28.575 21.47 145-149 22.314999999999998 27.700000000000003 28.215 21.77 150 22.3 26.85 28.95 21.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.5 23 2.0 24 1.5 25 2.5 26 4.0 27 3.0 28 5.5 29 12.0 30 17.0 31 19.0 32 29.0 33 42.0 34 50.0 35 71.0 36 98.5 37 115.0 38 128.5 39 154.0 40 188.5 41 226.5 42 246.0 43 266.0 44 277.5 45 290.5 46 276.0 47 250.0 48 241.0 49 201.0 50 179.0 51 148.0 52 102.0 53 79.5 54 61.0 55 49.0 56 41.0 57 26.0 58 16.5 59 13.5 60 13.5 61 10.5 62 7.0 63 7.5 64 9.0 65 4.5 66 1.5 67 2.5 68 2.5 69 2.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.74301384173414 91.64999999999999 2 4.048054322277357 7.75 3 0.20893183598850876 0.6 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0125 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.037500000000000006 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.0875 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.16249999999999998 0.0 0.0 0.0 0.0 112-113 0.2375 0.0 0.0 0.0 0.0 114-115 0.325 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.35 0.0 0.0 0.0 0.0 120-121 0.3625 0.0 0.0 0.0 0.0 122-123 0.4 0.0 0.0 0.0 0.0 124-125 0.425 0.0 0.0 0.0 0.0 126-127 0.425 0.0 0.0 0.0 0.0 128-129 0.4375 0.0 0.0 0.0 0.0 130-131 0.4625 0.0 0.0 0.0 0.0 132-133 0.475 0.0 0.0 0.0 0.0 134-135 0.5375000000000001 0.0 0.0 0.0 0.0 136-137 0.5625 0.0 0.0 0.0 0.0 138 0.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR22839641 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22839641_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.42125 32.0 27.0 32.0 12.0 32.0 2 31.2375 32.0 32.0 32.0 32.0 32.0 3 34.37375 37.0 32.0 37.0 32.0 37.0 4 35.5375 37.0 37.0 37.0 32.0 37.0 5 35.4925 37.0 37.0 37.0 32.0 37.0 6 38.22025 41.0 37.0 41.0 32.0 41.0 7 38.49725 41.0 37.0 41.0 32.0 41.0 8 27.286 27.0 12.0 37.0 12.0 41.0 9 37.42275 41.0 37.0 41.0 27.0 41.0 10-14 38.053549999999994 41.0 38.4 41.0 30.0 41.0 15-19 39.01090000000001 41.0 40.2 41.0 34.0 41.0 20-24 35.92565 39.2 33.6 41.0 26.0 41.0 25-29 35.273649999999996 40.2 32.0 41.0 19.0 41.0 30-34 32.00505 35.6 25.0 40.2 17.0 41.0 35-39 30.252750000000002 31.0 20.0 38.6 17.0 41.0 40-44 33.9076 36.8 29.0 41.0 20.0 41.0 45-49 33.9615 38.6 30.0 41.0 20.0 41.0 50-54 31.84035 35.8 24.0 40.2 14.0 41.0 55-59 35.59015 40.2 33.0 41.0 24.0 41.0 60-64 36.2741 40.2 35.0 41.0 23.0 41.0 65-69 34.40385 37.6 29.0 41.0 20.0 41.0 70-74 37.721 41.0 37.8 41.0 30.0 41.0 75-79 36.2885 40.2 35.0 41.0 23.0 41.0 80-84 37.26565 41.0 37.0 41.0 28.0 41.0 85-89 36.05505 40.2 35.0 41.0 22.0 41.0 90-94 35.842150000000004 41.0 34.0 41.0 20.0 41.0 95-99 36.18035 41.0 36.0 41.0 22.0 41.0 100-104 36.6238 40.2 35.0 41.0 27.0 41.0 105-109 32.6018 37.0 27.0 41.0 14.0 41.0 110-114 34.54525 39.4 31.0 41.0 16.0 41.0 115-119 35.06075 40.2 34.0 41.0 21.0 41.0 120-124 35.9831 40.2 35.0 41.0 24.0 41.0 125-129 35.37945 40.2 33.0 41.0 20.0 41.0 130-134 33.3108 37.8 28.0 41.0 14.0 41.0 135-139 31.9507 36.0 27.0 41.0 14.0 41.0 140-144 34.60665 39.4 31.0 41.0 20.0 41.0 145-149 32.42865 36.8 26.0 41.0 18.0 41.0 150 35.57225 37.0 32.0 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 5.0 15 11.0 16 4.0 17 5.0 18 7.0 19 13.0 20 30.0 21 24.0 22 46.0 23 42.0 24 56.0 25 53.0 26 55.0 27 82.0 28 109.0 29 131.0 30 138.0 31 165.0 32 174.0 33 214.0 34 253.0 35 298.0 36 307.0 37 376.0 38 422.0 39 555.0 40 424.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.249169435215947 17.659085100945564 20.725785842064912 36.36595962177358 2 20.775 22.975 36.725 19.525000000000002 3 21.05 26.174999999999997 28.7 24.075 4 22.55 32.0 20.349999999999998 25.1 5 22.8 35.3 22.75 19.15 6 18.125 37.35 24.075 20.45 7 17.575 19.0 42.95 20.474999999999998 8 22.900000000000002 24.325 29.049999999999997 23.724999999999998 9 20.724999999999998 22.375 32.775 24.125 10-14 21.279999999999998 29.525000000000002 27.534999999999997 21.66 15-19 20.825 28.67 28.194999999999997 22.31 20-24 21.085 28.735 28.360000000000003 21.82 25-29 21.475 28.96 28.27 21.295 30-34 21.029999999999998 29.310000000000002 28.810000000000002 20.849999999999998 35-39 21.62 28.87 28.144999999999996 21.365000000000002 40-44 21.195 28.54 28.09 22.175 45-49 21.23 28.005000000000003 28.110000000000003 22.655 50-54 20.974999999999998 28.655 27.68 22.689999999999998 55-59 21.385 28.060000000000002 27.76 22.795 60-64 21.565 28.7 27.405 22.33 65-69 21.9 28.895 27.025 22.18 70-74 21.32 28.52 27.88 22.28 75-79 21.305 28.165000000000003 27.47 23.06 80-84 21.855 28.175 27.305 22.665 85-89 22.055 27.565 28.325 22.055 90-94 21.47 28.57 27.345000000000002 22.615 95-99 21.834999999999997 27.505000000000003 27.544999999999998 23.115 100-104 22.09 28.175 27.045 22.689999999999998 105-109 21.654999999999998 27.58 28.03 22.735 110-114 21.415 28.165000000000003 27.32 23.1 115-119 21.37 28.095 27.72 22.814999999999998 120-124 21.675 27.584999999999997 27.935 22.805 125-129 21.855 27.775 27.925 22.445 130-134 22.189999999999998 27.905 27.589999999999996 22.314999999999998 135-139 22.035 27.905 27.045 23.015 140-144 22.24 27.54 27.474999999999998 22.745 145-149 22.54 27.334999999999997 28.1 22.025 150 23.599999999999998 26.900000000000002 26.950000000000003 22.55 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 0.5 23 1.5 24 3.5 25 3.5 26 5.0 27 11.0 28 14.5 29 15.5 30 19.5 31 27.0 32 42.0 33 53.5 34 61.5 35 70.0 36 88.0 37 117.0 38 135.0 39 148.0 40 187.0 41 242.0 42 275.5 43 265.0 44 263.0 45 276.0 46 267.5 47 253.5 48 222.5 49 186.0 50 166.5 51 140.0 52 99.0 53 81.0 54 65.0 55 39.0 56 29.5 57 25.5 58 20.5 59 16.0 60 12.0 61 8.5 62 7.5 63 8.5 64 6.5 65 3.5 66 3.0 67 2.5 68 1.5 69 2.5 70 1.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.575 #Duplication Level Percentage of deduplicated Percentage of total 1 98.6812072026376 97.275 2 1.1919857976160284 2.35 3 0.12680699974638598 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.037500000000000006 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.0625 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.1125 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.3875 0.0 0.0 0.0 0.0 122-123 0.42500000000000004 0.0 0.0 0.0 0.0 124-125 0.45 0.0 0.0 0.0 0.0 126-127 0.45 0.0 0.0 0.0 0.0 128-129 0.4625 0.0 0.0 0.0 0.0 130-131 0.4875 0.0 0.0 0.0 0.0 132-133 0.525 0.0 0.0 0.0 0.0 134-135 0.6125 0.0 0.0 0.0 0.0 136-137 0.6375 0.0 0.0 0.0 0.0 138 0.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGCATC 10 0.0064622764 147.66667 1 >>END_MODULE Read 803030 spots for SRR22839641.sra Written 803030 spots for SRR22839641.sra Read 803030 spots for SRR22839641.sra Written 803030 spots for SRR22839641.sra Read 803030 spots for SRR22839641.sra Written 803030 spots for SRR22839641.sra Read 803030 spots for SRR22839641.sra Written 803030 spots for SRR22839641.sra Read 803030 spots for SRR22839641.sra Written 803030 spots for SRR22839641.sra Read 803030 spots for SRR22839641.sra Written 803030 spots for SRR22839641.sra Read 803030 spots for SRR22839641.sra Written 803030 spots for SRR22839641.sra Read 803030 spots for SRR22839641.sra Written 803030 spots for SRR22839641.sra Read 803030 spots for SRR22839641.sra Written 803030 spots for SRR22839641.sra Read 803030 spots for SRR22839641.sra Written 803030 spots for SRR22839641.sra Read 803030 spots for SRR22839641.sra Written 803030 spots for SRR22839641.sra Read 803030 spots for SRR22839641.sra Written 803030 spots for SRR22839641.sra Read 803030 spots for SRR22839641.sra Written 803030 spots for SRR22839641.sra Read 803030 spots for SRR22839641.sra Written 803030 spots for SRR22839641.sra Read 803030 spots for SRR22839641.sra Written 803030 spots for SRR22839641.sra Read 803030 spots for SRR22839641.sra Written 803030 spots for SRR22839641.sra Read 803030 spots for SRR22839641.sra Written 803030 spots for SRR22839641.sra Read 803030 spots for SRR22839641.sra Written 803030 spots for SRR22839641.sra Read 803030 spots for SRR22839641.sra Written 803030 spots for SRR22839641.sra Read 803040 spots for SRR22839641.sra Written 803040 spots for SRR22839641.sra SRR ids: ['SRR22839641.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rko2g91k SRR22839641.sra spots: 16060610 blocks: [[1, 803030], [803031, 1606060], [1606061, 2409090], [2409091, 3212120], [3212121, 4015150], [4015151, 4818180], [4818181, 5621210], [5621211, 6424240], [6424241, 7227270], [7227271, 8030300], [8030301, 8833330], [8833331, 9636360], [9636361, 10439390], [10439391, 11242420], [11242421, 12045450], [12045451, 12848480], [12848481, 13651510], [13651511, 14454540], [14454541, 15257570], [15257571, 16060610]] SRR22839641 file size 5405029 SRR22839641 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22839641 SRR22839641_1.fastq SRR22839641_2.fastq Input file: SRR22839641_1.fastq Paired file: SRR22839641_2.fastq trimmed: SRR22839641-trimmed-pair1.fastq, SRR22839641-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:00:29 2025 >> started Thu Feb 13 17:01:00 2025 >> done (31.050s) 16060610 read pairs processed; of these: 291 ( 0.00%) short read pairs filtered out after trimming by size control 1546 ( 0.01%) empty read pairs filtered out after trimming by size control 16058773 (99.99%) read pairs available; of these: 542442 ( 3.38%) trimmed read pairs available after processing 15516331 (96.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 32 0.00% 19 22 0.00% 20 37 0.00% 21 24 0.00% 22 25 0.00% 23 22 0.00% 24 29 0.00% 25 23 0.00% 26 28 0.00% 27 19 0.00% 28 41 0.00% 29 42 0.00% 30 35 0.00% 31 28 0.00% 32 31 0.00% 33 24 0.00% 34 24 0.00% 35 36 0.00% 36 37 0.00% 37 37 0.00% 38 46 0.00% 39 37 0.00% 40 43 0.00% 41 45 0.00% 42 38 0.00% 43 52 0.00% 44 44 0.00% 45 50 0.00% 46 59 0.00% 47 60 0.00% 48 67 0.00% 49 57 0.00% 50 71 0.00% 51 63 0.00% 52 76 0.00% 53 58 0.00% 54 76 0.00% 55 77 0.00% 56 57 0.00% 57 82 0.00% 58 62 0.00% 59 83 0.00% 60 81 0.00% 61 82 0.00% 62 88 0.00% 63 100 0.00% 64 97 0.00% 65 107 0.00% 66 94 0.00% 67 112 0.00% 68 118 0.00% 69 125 0.00% 70 114 0.00% 71 133 0.00% 72 156 0.00% 73 212 0.00% 74 183 0.00% 75 206 0.00% 76 182 0.00% 77 181 0.00% 78 186 0.00% 79 197 0.00% 80 261 0.00% 81 305 0.00% 82 305 0.00% 83 335 0.00% 84 349 0.00% 85 356 0.00% 86 319 0.00% 87 355 0.00% 88 381 0.00% 89 441 0.00% 90 453 0.00% 91 551 0.00% 92 541 0.00% 93 623 0.00% 94 697 0.00% 95 673 0.00% 96 655 0.00% 97 635 0.00% 98 750 0.00% 99 768 0.00% 100 842 0.01% 101 912 0.01% 102 1074 0.01% 103 1126 0.01% 104 1231 0.01% 105 1186 0.01% 106 1203 0.01% 107 1202 0.01% 108 1289 0.01% 109 1257 0.01% 110 1343 0.01% 111 1518 0.01% 112 1696 0.01% 113 1877 0.01% 114 2068 0.01% 115 2230 0.01% 116 2015 0.01% 117 1930 0.01% 118 2101 0.01% 119 2157 0.01% 120 2243 0.01% 121 2411 0.02% 122 2526 0.02% 123 2984 0.02% 124 3166 0.02% 125 3287 0.02% 126 3141 0.02% 127 3175 0.02% 128 3081 0.02% 129 3338 0.02% 130 3400 0.02% 131 3701 0.02% 132 3983 0.02% 133 4348 0.03% 134 4636 0.03% 135 4815 0.03% 136 4815 0.03% 137 4871 0.03% 138 4839 0.03% 139 4750 0.03% 140 4811 0.03% 141 5305 0.03% 142 5649 0.04% 143 5962 0.04% 144 7340 0.05% 145 7412 0.05% 146 8791 0.05% 147 13829 0.09% 148 38715 0.24% 149 326455 2.03% 150 15516331 96.62% 16058773 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=29.92 fanout-score-rank=10 prefix-density=0.32 prefix-fanout=10.6 sequence=TTCCTCCATTGTACAAAAACGTTGTGCCAGTCACCTGCCGCGGCCCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=75.44 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=10.0 sequence=ATCATCATGCATGCTCTCCCCCACAAAGAATTGCAAGTCCTTGATTTTTGAAAGCAAGAACTTGGTTGCTCCCTCAATGTTCTTTCTAAAATGTTCCTTCTGGTCCTCATCAAGTTTCTCCGACAGATTCTTGATAAATTTCTTAATCTGTGTAAGAAACTGCTTCTTGTCAAATGGAGGTTGCTCCTGGAGCCTAAATGTGTCAACGATGTCAACAACCTTGGCAGCTTGGTCATCAACACCCTCATCCTCATC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=26.69 fanout-score-rank=12 prefix-density=0.29 prefix-fanout=10.1 sequence=TTCCTCCATTGTACAAAAACGTTGTGCCAGTCACCTGCCGCGGCCCC criterion=fanout-score sequence-density=0.03 sequence-density-rank=35 fanout-score=90.27 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=11.2 sequence=TTCTTCATTGCCCTCCAACCCTAGCTCAGTCACCAGCTGCAGCCCCAGC SRR22839641 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:01:46 Started mapping on | Feb 13 17:01:46 Finished on | Feb 13 17:03:18 Mapping speed, Million of reads per hour | 628.39 Number of input reads | 16058773 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 15241844 Uniquely mapped reads % | 94.91% Average mapped length | 297.18 Number of splices: Total | 13870223 Number of splices: Annotated (sjdb) | 13555955 Number of splices: GT/AG | 13658815 Number of splices: GC/AG | 165768 Number of splices: AT/AC | 15117 Number of splices: Non-canonical | 30523 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.02% Deletion average length | 2.89 Insertion rate per base | 0.01% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 268954 % of reads mapped to multiple loci | 1.67% Number of reads mapped to too many loci | 44309 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.03% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 547975 547975 547975 N_multimapping 268954 268954 268954 N_noFeature 538341 7813366 7818116 N_ambiguous 228284 39823 40244 UnstrandedReadsAssigned:14475219 PositiveStrandReadsAssigned:7388655 NegativeStrandReadsAssigned:7383484 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR22839641 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22839641-trimmed-pair1.fastq SRR22839641-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,058,773 reads, 15,082,721 reads pseudoaligned [quant] estimated average fragment length: 287.684 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,128 rounds 52401 SRR22839641.ke.tsv 34699 SRR22839641.se.tsv 87100 total ==> SRR22839641.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1731.32 905 33.3716 Potri.005G024800.1.v4.1 1035 748.316 127 10.8349 Potri.004G059700.1.v4.1 961 674.321 60 5.68054 Potri.007G009000.2.v4.1 1416 1129.32 0 0 Potri.003G141000.2.v4.1 2943 2656.32 199.175 4.78698 Potri.016G087400.1.v4.1 270 50.8773 844 1059.07 Potri.015G069301.1.v4.1 564 278.192 0 0 Potri.010G195200.1.v4.1 1773 1486.32 55 2.36242 Potri.012G127500.1.v4.1 977 690.316 2453 226.859 ==> SRR22839641.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1945 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 377 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 85 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR22839641 completed mapping pipeline successfully