Starting /dee2/code/volunteer_pipeline.sh SRR22839642 current disk space = 3088817713152 free memory = 1395686196 SRR22839642 SRAfilesize fdc429ea20c96ea1cff4db9493f9f671 SRR22839642.sra SRR22839642.sra file validated SRR22839642 is paired end SRR22839642 is conventional basespace SRR22839642 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22839642_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.70625 32.0 32.0 32.0 32.0 32.0 2 28.41 32.0 27.0 32.0 12.0 32.0 3 32.7125 32.0 32.0 37.0 27.0 37.0 4 31.63 37.0 32.0 37.0 12.0 37.0 5 32.2625 37.0 32.0 37.0 12.0 37.0 6 33.02975 37.0 32.0 41.0 12.0 41.0 7 35.44475 37.0 32.0 41.0 27.0 41.0 8 35.48525 37.0 32.0 41.0 27.0 41.0 9 35.184 37.0 32.0 41.0 27.0 41.0 10-14 36.64665 40.2 35.0 41.0 28.0 41.0 15-19 38.2916 41.0 37.8 41.0 33.0 41.0 20-24 38.89485 41.0 39.4 41.0 34.0 41.0 25-29 37.51469999999999 41.0 36.8 41.0 29.0 41.0 30-34 39.521 41.0 40.2 41.0 37.0 41.0 35-39 39.1575 41.0 39.4 41.0 34.8 41.0 40-44 38.11449999999999 41.0 37.6 41.0 32.0 41.0 45-49 38.166 41.0 37.6 41.0 32.0 41.0 50-54 37.8937 41.0 36.8 41.0 30.0 41.0 55-59 37.9613 41.0 37.0 41.0 32.0 41.0 60-64 37.5506 41.0 37.6 41.0 30.0 41.0 65-69 36.0696 39.4 34.8 41.0 26.0 41.0 70-74 36.10795 40.2 34.8 41.0 24.0 41.0 75-79 35.560649999999995 38.6 33.0 41.0 24.0 41.0 80-84 35.335699999999996 38.6 34.0 41.0 20.0 41.0 85-89 36.0875 39.4 34.0 41.0 25.0 41.0 90-94 35.0653 38.6 33.0 41.0 18.0 41.0 95-99 35.43505 40.2 33.0 41.0 24.0 41.0 100-104 34.29005 38.6 29.0 41.0 18.0 41.0 105-109 35.6929 39.4 34.0 41.0 24.0 41.0 110-114 35.45085 39.4 34.0 41.0 22.0 41.0 115-119 36.24995 40.2 35.0 41.0 26.0 41.0 120-124 35.84245 39.4 33.0 41.0 24.0 41.0 125-129 35.16745 38.6 33.0 41.0 23.0 41.0 130-134 36.5187 41.0 34.0 41.0 25.0 41.0 135-139 37.2823 41.0 37.0 41.0 28.0 41.0 140-144 35.6015 39.4 33.0 41.0 24.0 41.0 145-149 33.277049999999996 37.8 29.0 41.0 16.0 41.0 150 33.17025 37.0 27.0 41.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 4.0 24 4.0 25 14.0 26 12.0 27 29.0 28 55.0 29 77.0 30 90.0 31 113.0 32 176.0 33 225.0 34 305.0 35 371.0 36 487.0 37 546.0 38 675.0 39 614.0 40 201.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.1 15.725 21.125 37.05 2 20.95 24.224999999999998 38.35 16.475 3 21.55 25.75 28.375 24.325 4 23.35 34.2 21.125 21.325 5 23.7 35.6 24.05 16.650000000000002 6 17.974999999999998 38.4 25.474999999999998 18.15 7 17.299999999999997 18.6 42.925000000000004 21.175 8 18.275 23.875 29.875 27.975 9 20.849999999999998 24.15 30.625000000000004 24.375 10-14 20.580000000000002 30.714999999999996 27.52 21.185000000000002 15-19 21.675 28.084999999999997 28.544999999999998 21.695 20-24 21.15 28.945 28.52 21.385 25-29 21.315 28.365000000000002 27.955000000000002 22.365 30-34 21.72 29.145 27.875 21.26 35-39 20.75 28.33 28.744999999999997 22.175 40-44 21.8 28.185 27.955000000000002 22.06 45-49 21.445 29.075 27.334999999999997 22.145 50-54 21.64 28.115000000000002 27.975 22.27 55-59 21.215 28.125 28.26 22.400000000000002 60-64 21.154999999999998 27.97 28.71 22.165000000000003 65-69 21.94 27.939999999999998 28.57 21.55 70-74 21.745 27.68 28.57 22.005 75-79 21.755 28.060000000000002 28.28 21.905 80-84 22.41 28.349999999999998 27.83 21.41 85-89 22.66 27.88 27.334999999999997 22.125 90-94 21.925 27.925 28.89 21.26 95-99 21.465 28.125 28.13 22.28 100-104 21.740000000000002 28.465 28.225 21.57 105-109 22.14 27.525 28.38 21.955 110-114 22.165000000000003 28.075 28.139999999999997 21.62 115-119 22.015 28.294999999999998 27.905 21.785 120-124 22.18 27.634999999999998 28.544999999999998 21.64 125-129 22.189999999999998 28.13 27.76 21.92 130-134 22.185 28.27 27.92 21.625 135-139 22.185 27.725 28.199999999999996 21.89 140-144 22.28 28.65 27.38 21.69 145-149 21.884999999999998 28.999999999999996 27.625 21.490000000000002 150 22.25 27.750000000000004 28.525 21.475 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 1.0 21 0.5 22 0.5 23 1.5 24 2.0 25 2.0 26 7.5 27 10.5 28 10.5 29 11.5 30 18.0 31 24.5 32 34.5 33 55.5 34 66.0 35 77.5 36 101.5 37 132.0 38 171.0 39 190.5 40 184.0 41 218.0 42 251.5 43 251.0 44 273.0 45 286.0 46 276.5 47 258.0 48 219.0 49 183.0 50 156.5 51 122.5 52 95.5 53 76.5 54 56.5 55 39.0 56 25.5 57 24.5 58 22.5 59 11.5 60 9.5 61 8.5 62 5.0 63 6.5 64 7.5 65 4.5 66 1.5 67 1.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 1.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.925 #Duplication Level Percentage of deduplicated Percentage of total 1 96.87903017797265 93.89999999999999 2 3.069383543977302 5.949999999999999 3 0.051586278050038695 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0125 0.0 0.0 0.0 0.0 102-103 0.037500000000000006 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.0625 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.15 0.0 0.0 0.0 0.0 114-115 0.175 0.0 0.0 0.0 0.0 116-117 0.175 0.0 0.0 0.0 0.0 118-119 0.2 0.0 0.0 0.0 0.0 120-121 0.225 0.0 0.0 0.0 0.0 122-123 0.2625 0.0 0.0 0.0 0.0 124-125 0.3375 0.0 0.0 0.0 0.0 126-127 0.4625 0.0 0.0 0.0 0.0 128-129 0.5375000000000001 0.0 0.0 0.0 0.0 130-131 0.625 0.0 0.0 0.0 0.0 132-133 0.675 0.0 0.0 0.0 0.0 134-135 0.75 0.0 0.0 0.0 0.0 136-137 0.7875000000000001 0.0 0.0 0.0 0.0 138 0.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR22839642 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22839642_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.44375 32.0 32.0 32.0 27.0 32.0 2 31.65375 32.0 32.0 32.0 32.0 32.0 3 35.845 37.0 37.0 37.0 32.0 37.0 4 35.6225 37.0 37.0 37.0 32.0 37.0 5 36.455 37.0 37.0 37.0 37.0 37.0 6 40.1655 41.0 41.0 41.0 41.0 41.0 7 40.11125 41.0 41.0 41.0 41.0 41.0 8 40.19175 41.0 41.0 41.0 41.0 41.0 9 40.23075 41.0 41.0 41.0 41.0 41.0 10-14 39.446349999999995 41.0 40.2 41.0 35.8 41.0 15-19 38.673950000000005 41.0 39.4 41.0 33.0 41.0 20-24 36.2307 40.2 35.0 41.0 23.0 41.0 25-29 34.9945 38.6 33.0 41.0 21.0 41.0 30-34 34.8237 38.6 32.0 41.0 20.0 41.0 35-39 33.4699 37.0 29.0 41.0 16.0 41.0 40-44 33.67465 38.6 31.0 41.0 18.0 41.0 45-49 34.6151 37.8 31.0 41.0 21.0 41.0 50-54 34.31655 39.4 31.0 41.0 20.0 41.0 55-59 34.72585 38.6 32.0 41.0 22.0 41.0 60-64 36.684900000000006 41.0 35.0 41.0 25.0 41.0 65-69 35.924800000000005 40.2 33.0 41.0 24.0 41.0 70-74 34.42295 38.6 30.0 41.0 20.0 41.0 75-79 31.7024 35.0 25.0 39.4 18.0 41.0 80-84 36.35665 40.2 35.8 41.0 24.0 41.0 85-89 36.483999999999995 39.4 34.0 41.0 24.0 41.0 90-94 35.88005 41.0 34.0 41.0 24.0 41.0 95-99 38.476749999999996 41.0 37.8 41.0 33.0 41.0 100-104 34.526999999999994 38.6 30.8 41.0 19.0 41.0 105-109 36.8771 41.0 37.0 41.0 27.0 41.0 110-114 34.7432 38.4 31.0 41.0 23.0 41.0 115-119 36.403749999999995 39.4 34.0 41.0 26.0 41.0 120-124 37.0018 41.0 37.0 41.0 27.0 41.0 125-129 35.915800000000004 40.2 34.0 41.0 25.0 41.0 130-134 36.89385 41.0 36.0 41.0 29.0 41.0 135-139 34.344 38.4 31.0 41.0 20.0 41.0 140-144 31.5173 34.0 25.0 39.4 16.0 41.0 145-149 31.524549999999998 34.8 24.0 38.6 16.0 41.0 150 28.1425 32.0 22.0 37.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 10.0 16 9.0 17 6.0 18 5.0 19 7.0 20 9.0 21 3.0 22 11.0 23 21.0 24 24.0 25 25.0 26 32.0 27 44.0 28 85.0 29 101.0 30 121.0 31 177.0 32 191.0 33 241.0 34 281.0 35 370.0 36 466.0 37 555.0 38 569.0 39 486.0 40 148.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.038781163434905 15.361369932007051 21.102996726265424 37.49685217829262 2 18.55 23.325000000000003 39.4 18.725 3 19.5 27.075 29.4 24.025 4 22.225 32.95 22.425 22.400000000000002 5 20.724999999999998 36.449999999999996 24.95 17.875 6 16.6 37.0 26.875 19.525000000000002 7 16.075 18.2 43.225 22.5 8 17.825 22.7 30.725 28.749999999999996 9 21.525 22.075 31.275 25.124999999999996 10-14 19.994999999999997 30.214999999999996 27.505000000000003 22.285 15-19 21.060000000000002 28.465 28.665000000000003 21.81 20-24 20.535 28.904999999999998 27.825 22.735 25-29 20.47 29.134999999999998 28.044999999999998 22.35 30-34 20.965 28.675 28.115000000000002 22.245 35-39 20.785 29.160000000000004 28.035 22.02 40-44 21.095 28.975 28.265 21.665 45-49 21.305 28.925 27.744999999999997 22.025 50-54 21.025 29.715000000000003 27.77 21.490000000000002 55-59 21.07 28.73 28.015 22.185 60-64 21.265 28.835 27.944999999999997 21.955 65-69 21.3 28.395 28.42 21.884999999999998 70-74 21.26 28.494999999999997 28.27 21.975 75-79 21.145 28.53 28.24 22.085 80-84 21.205 28.994999999999997 27.815 21.985 85-89 21.42 27.860000000000003 28.58 22.14 90-94 21.175 28.12 28.16 22.545 95-99 21.69 28.605000000000004 27.92 21.785 100-104 21.834999999999997 28.599999999999998 28.01 21.555 105-109 21.38 28.46 28.025 22.134999999999998 110-114 21.834999999999997 28.435 27.785 21.945 115-119 21.349999999999998 28.335 27.68 22.634999999999998 120-124 21.4 28.225 28.110000000000003 22.264999999999997 125-129 21.775 28.389999999999997 27.655 22.18 130-134 22.025 28.115000000000002 27.944999999999997 21.915000000000003 135-139 21.825 28.54 27.779999999999998 21.855 140-144 21.665 28.375 27.794999999999998 22.165000000000003 145-149 21.9 28.375 27.93 21.795 150 22.75 28.9 27.05 21.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 2.0 22 2.5 23 2.5 24 3.0 25 5.0 26 8.5 27 12.0 28 13.0 29 16.5 30 27.0 31 35.5 32 43.0 33 51.5 34 70.0 35 87.0 36 100.5 37 120.0 38 139.5 39 173.0 40 218.5 41 242.5 42 268.0 43 299.5 44 293.0 45 274.5 46 259.0 47 232.0 48 200.5 49 170.5 50 141.0 51 118.0 52 93.0 53 69.5 54 52.5 55 37.0 56 27.0 57 18.5 58 11.0 59 11.0 60 10.0 61 6.0 62 6.0 63 5.0 64 3.0 65 2.0 66 1.5 67 2.0 68 3.0 69 2.0 70 1.5 71 2.5 72 2.0 73 1.0 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.575 #Duplication Level Percentage of deduplicated Percentage of total 1 97.5659748911094 95.19999999999999 2 2.382782475019216 4.65 3 0.05124263387138099 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0125 0.0 0.0 0.0 0.0 102-103 0.037500000000000006 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.0875 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.2 0.0 0.0 0.0 0.0 116-117 0.2 0.0 0.0 0.0 0.0 118-119 0.2375 0.0 0.0 0.0 0.0 120-121 0.275 0.0 0.0 0.0 0.0 122-123 0.3125 0.0 0.0 0.0 0.0 124-125 0.38749999999999996 0.0 0.0 0.0 0.0 126-127 0.5125 0.0 0.0 0.0 0.0 128-129 0.5874999999999999 0.0 0.0 0.0 0.0 130-131 0.675 0.0 0.0 0.0 0.0 132-133 0.725 0.0 0.0 0.0 0.0 134-135 0.8 0.0 0.0 0.0 0.0 136-137 0.825 0.0 0.0 0.0 0.0 138 0.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGGTGG 10 0.006973645 144.0 8 CTCACTA 10 0.006973645 144.0 5 >>END_MODULE Read 762105 spots for SRR22839642.sra Written 762105 spots for SRR22839642.sra Read 762105 spots for SRR22839642.sra Written 762105 spots for SRR22839642.sra Read 762105 spots for SRR22839642.sra Written 762105 spots for SRR22839642.sra Read 762105 spots for SRR22839642.sra Written 762105 spots for SRR22839642.sra Read 762105 spots for SRR22839642.sra Written 762105 spots for SRR22839642.sra Read 762105 spots for SRR22839642.sra Written 762105 spots for SRR22839642.sra Read 762105 spots for SRR22839642.sra Written 762105 spots for SRR22839642.sra Read 762121 spots for SRR22839642.sra Written 762121 spots for SRR22839642.sra Read 762105 spots for SRR22839642.sra Written 762105 spots for SRR22839642.sra Read 762105 spots for SRR22839642.sra Written 762105 spots for SRR22839642.sra Read 762105 spots for SRR22839642.sra Written 762105 spots for SRR22839642.sra Read 762105 spots for SRR22839642.sra Written 762105 spots for SRR22839642.sra Read 762105 spots for SRR22839642.sra Written 762105 spots for SRR22839642.sra Read 762105 spots for SRR22839642.sra Written 762105 spots for SRR22839642.sra Read 762105 spots for SRR22839642.sra Written 762105 spots for SRR22839642.sra Read 762105 spots for SRR22839642.sra Written 762105 spots for SRR22839642.sra Read 762105 spots for SRR22839642.sra Written 762105 spots for SRR22839642.sra Read 762105 spots for SRR22839642.sra Written 762105 spots for SRR22839642.sra Read 762105 spots for SRR22839642.sra Written 762105 spots for SRR22839642.sra Read 762105 spots for SRR22839642.sra Written 762105 spots for SRR22839642.sra SRR ids: ['SRR22839642.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1amvrh90 SRR22839642.sra spots: 15242116 blocks: [[1, 762105], [762106, 1524210], [1524211, 2286315], [2286316, 3048420], [3048421, 3810525], [3810526, 4572630], [4572631, 5334735], [5334736, 6096840], [6096841, 6858945], [6858946, 7621050], [7621051, 8383155], [8383156, 9145260], [9145261, 9907365], [9907366, 10669470], [10669471, 11431575], [11431576, 12193680], [12193681, 12955785], [12955786, 13717890], [13717891, 14479995], [14479996, 15242116]] SRR22839642 file size 5128467 SRR22839642 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22839642 SRR22839642_1.fastq SRR22839642_2.fastq Input file: SRR22839642_1.fastq Paired file: SRR22839642_2.fastq trimmed: SRR22839642-trimmed-pair1.fastq, SRR22839642-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:40:21 2025 >> started Thu Feb 13 16:40:38 2025 >> done (17.764s) 15242116 read pairs processed; of these: 133 ( 0.00%) short read pairs filtered out after trimming by size control 1356 ( 0.01%) empty read pairs filtered out after trimming by size control 15240627 (99.99%) read pairs available; of these: 387043 ( 2.54%) trimmed read pairs available after processing 14853584 (97.46%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 15 0.00% 20 16 0.00% 21 68 0.00% 22 21 0.00% 23 19 0.00% 24 20 0.00% 25 20 0.00% 26 14 0.00% 27 14 0.00% 28 20 0.00% 29 14 0.00% 30 17 0.00% 31 20 0.00% 32 18 0.00% 33 23 0.00% 34 11 0.00% 35 33 0.00% 36 21 0.00% 37 13 0.00% 38 24 0.00% 39 25 0.00% 40 17 0.00% 41 25 0.00% 42 30 0.00% 43 17 0.00% 44 29 0.00% 45 23 0.00% 46 31 0.00% 47 36 0.00% 48 34 0.00% 49 33 0.00% 50 48 0.00% 51 36 0.00% 52 41 0.00% 53 45 0.00% 54 43 0.00% 55 37 0.00% 56 41 0.00% 57 49 0.00% 58 43 0.00% 59 51 0.00% 60 72 0.00% 61 66 0.00% 62 58 0.00% 63 59 0.00% 64 55 0.00% 65 76 0.00% 66 82 0.00% 67 68 0.00% 68 72 0.00% 69 90 0.00% 70 94 0.00% 71 101 0.00% 72 143 0.00% 73 139 0.00% 74 173 0.00% 75 171 0.00% 76 133 0.00% 77 178 0.00% 78 203 0.00% 79 226 0.00% 80 246 0.00% 81 284 0.00% 82 316 0.00% 83 369 0.00% 84 439 0.00% 85 351 0.00% 86 393 0.00% 87 398 0.00% 88 416 0.00% 89 446 0.00% 90 513 0.00% 91 614 0.00% 92 666 0.00% 93 771 0.01% 94 800 0.01% 95 754 0.00% 96 766 0.01% 97 769 0.01% 98 828 0.01% 99 852 0.01% 100 995 0.01% 101 988 0.01% 102 1126 0.01% 103 1344 0.01% 104 1372 0.01% 105 1416 0.01% 106 1372 0.01% 107 1328 0.01% 108 1418 0.01% 109 1457 0.01% 110 1608 0.01% 111 1751 0.01% 112 1809 0.01% 113 2163 0.01% 114 2204 0.01% 115 2201 0.01% 116 2193 0.01% 117 2248 0.01% 118 2233 0.01% 119 2325 0.02% 120 2537 0.02% 121 2667 0.02% 122 2996 0.02% 123 3235 0.02% 124 3492 0.02% 125 3488 0.02% 126 3396 0.02% 127 3457 0.02% 128 3481 0.02% 129 3479 0.02% 130 3591 0.02% 131 3881 0.03% 132 4282 0.03% 133 4550 0.03% 134 4688 0.03% 135 5085 0.03% 136 5056 0.03% 137 5062 0.03% 138 5010 0.03% 139 5117 0.03% 140 5278 0.03% 141 5356 0.04% 142 5894 0.04% 143 6142 0.04% 144 6447 0.04% 145 7123 0.05% 146 7785 0.05% 147 10289 0.07% 148 23073 0.15% 149 183140 1.20% 150 14853584 97.46% 15240627 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=25.97 fanout-score-rank=6 prefix-density=0.31 prefix-fanout=9.7 sequence=TTCCTCCATTGTACAAAAACGTTGTGCCAGTCACCTGCCGCGGCCCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=71.66 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=9.4 sequence=ATCATCATGCATGCTCTCCCCCACAAAGAATTGCAAGTCCTTGATTTTTGAAAGCAAGAACTTGGTTGCTCCCTCAATGTTCTTTCTAAAATGTTCCTTCTGGTCCTCATCAAGTTTCTCCGACAGATTCTTGATAAATTTCTTAATCTGTGTAAGAAACTGCTTCTTGTCAAATGGAGGTTGCTCCTGGAGCCTAAATGTGTCAACGATGTCAACAACCTTGGCAGCTTGGTCATCAACACCCTCA criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=25.87 fanout-score-rank=9 prefix-density=0.24 prefix-fanout=11.0 sequence=CTGCAGCTGCAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=92.24 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=12.0 sequence=ATCATCATGCATGCTCTCCCCCACAAAGAATTGCAAGTCCTTGATTTTTGAAAGCAAGAACTTGGTTGCTCCCTCAATGTTCTTTCTAAAATGTTCCTTCTGGTCCTCATCAAGTTTCTCCGACAGATTCTTGATAAATTTCTTAATCTGTGTAAGAAACTGCTTCTTGTCAAATGGAGGTTGCTCCTGGAGCCTAAATGTGTCAACGATGTCAACAACCTTGGCAGCTTGGTCATCAACACCCTCA SRR22839642 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:41:24 Started mapping on | Feb 13 16:41:25 Finished on | Feb 13 16:42:38 Mapping speed, Million of reads per hour | 751.59 Number of input reads | 15240627 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 14559858 Uniquely mapped reads % | 95.53% Average mapped length | 297.91 Number of splices: Total | 13218355 Number of splices: Annotated (sjdb) | 12923886 Number of splices: GT/AG | 13024101 Number of splices: GC/AG | 152724 Number of splices: AT/AC | 13729 Number of splices: Non-canonical | 27801 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.02% Deletion average length | 2.85 Insertion rate per base | 0.01% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 244562 % of reads mapped to multiple loci | 1.60% Number of reads mapped to too many loci | 117588 % of reads mapped to too many loci | 0.77% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.94% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 436207 436207 436207 N_multimapping 244562 244562 244562 N_noFeature 580717 7528913 7477389 N_ambiguous 209656 37654 38152 UnstrandedReadsAssigned:13769485 PositiveStrandReadsAssigned:6993291 NegativeStrandReadsAssigned:7044317 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR22839642 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22839642-trimmed-pair1.fastq SRR22839642-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,240,627 reads, 14,253,144 reads pseudoaligned [quant] estimated average fragment length: 294.084 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,060 rounds 52401 SRR22839642.ke.tsv 34699 SRR22839642.se.tsv 87100 total ==> SRR22839642.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1724.92 829 35.029 Potri.005G024800.1.v4.1 1035 741.916 141 13.8518 Potri.004G059700.1.v4.1 961 667.928 53 5.78346 Potri.007G009000.2.v4.1 1416 1122.92 0 0 Potri.003G141000.2.v4.1 2943 2649.92 240.068 6.60302 Potri.016G087400.1.v4.1 270 52.5706 679 941.386 Potri.015G069301.1.v4.1 564 272.445 0 0 Potri.010G195200.1.v4.1 1773 1479.92 47 2.31474 Potri.012G127500.1.v4.1 977 683.928 1315 140.138 ==> SRR22839642.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2435 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 344 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 59 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR22839642 completed mapping pipeline successfully