Starting /dee2/code/volunteer_pipeline.sh SRR22839643 current disk space = 3088839847936 free memory = 1450202624 SRR22839643 SRAfilesize bcce1086fe45a3f109033863e21d8e0f SRR22839643.sra SRR22839643.sra file validated SRR22839643 is paired end SRR22839643 is conventional basespace SRR22839643 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22839643_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.80125 32.0 32.0 32.0 32.0 32.0 2 29.26125 32.0 32.0 32.0 12.0 32.0 3 33.50875 32.0 32.0 37.0 32.0 37.0 4 33.35375 37.0 32.0 37.0 27.0 37.0 5 33.855 37.0 32.0 37.0 27.0 37.0 6 35.42125 37.0 32.0 41.0 27.0 41.0 7 36.57425 41.0 37.0 41.0 27.0 41.0 8 36.90675 41.0 37.0 41.0 27.0 41.0 9 36.56675 41.0 37.0 41.0 27.0 41.0 10-14 37.4871 40.2 36.0 41.0 29.0 41.0 15-19 38.842600000000004 41.0 38.6 41.0 34.0 41.0 20-24 39.34975000000001 41.0 40.2 41.0 36.0 41.0 25-29 38.47345 41.0 38.6 41.0 33.0 41.0 30-34 39.653 41.0 41.0 41.0 37.0 41.0 35-39 39.36985 41.0 39.4 41.0 35.0 41.0 40-44 38.69925 41.0 39.4 41.0 35.0 41.0 45-49 38.697900000000004 41.0 40.2 41.0 34.0 41.0 50-54 38.4926 41.0 38.6 41.0 33.0 41.0 55-59 38.6408 41.0 38.6 41.0 34.0 41.0 60-64 38.4068 41.0 38.6 41.0 32.0 41.0 65-69 37.42255 41.0 37.8 41.0 29.0 41.0 70-74 37.36735 41.0 37.8 41.0 28.0 41.0 75-79 36.868 40.2 35.0 41.0 28.0 41.0 80-84 36.748650000000005 41.0 37.0 41.0 26.0 41.0 85-89 37.21355 41.0 37.0 41.0 27.0 41.0 90-94 36.67295 41.0 34.0 41.0 27.0 41.0 95-99 36.76899999999999 40.2 35.0 41.0 26.0 41.0 100-104 36.23845 40.2 34.0 41.0 23.0 41.0 105-109 37.37355 41.0 37.0 41.0 28.0 41.0 110-114 37.08205 41.0 37.0 41.0 27.0 41.0 115-119 37.5736 41.0 36.8 41.0 30.0 41.0 120-124 37.01275 40.2 35.8 41.0 28.0 41.0 125-129 36.7761 41.0 37.0 41.0 26.0 41.0 130-134 37.47885 41.0 37.0 41.0 29.0 41.0 135-139 37.921350000000004 41.0 37.0 41.0 30.0 41.0 140-144 36.44350000000001 40.2 35.0 41.0 27.0 41.0 145-149 34.640499999999996 37.8 31.0 41.0 20.0 41.0 150 34.90775 37.0 32.0 41.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 3.0 24 3.0 25 8.0 26 15.0 27 29.0 28 25.0 29 51.0 30 61.0 31 80.0 32 118.0 33 161.0 34 186.0 35 256.0 36 347.0 37 470.0 38 586.0 39 857.0 40 741.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.55 14.975 20.125 37.35 2 19.75 23.125 37.35 19.775000000000002 3 19.900000000000002 25.624999999999996 31.225 23.25 4 25.25 31.275 20.424999999999997 23.05 5 23.45 36.35 23.7 16.5 6 17.375 38.4 25.1 19.125 7 15.875 20.75 43.5 19.875 8 18.425 22.650000000000002 30.975 27.950000000000003 9 22.175 23.575 30.075000000000003 24.175 10-14 20.919999999999998 29.835 27.76 21.485000000000003 15-19 21.12 28.78 28.425 21.675 20-24 21.285 28.87 28.165000000000003 21.68 25-29 21.415 29.189999999999998 27.584999999999997 21.81 30-34 21.65 27.700000000000003 28.375 22.275 35-39 21.755 28.185 28.535 21.525 40-44 21.224999999999998 28.215 28.050000000000004 22.509999999999998 45-49 21.735 29.03 27.66 21.575 50-54 21.310000000000002 28.785 28.29 21.615000000000002 55-59 22.105 28.02 28.265 21.61 60-64 21.475 28.18 28.33 22.015 65-69 21.695 28.475 28.13 21.7 70-74 21.425 28.48 28.465 21.63 75-79 21.87 27.96 28.355000000000004 21.815 80-84 21.525 27.794999999999998 28.82 21.86 85-89 21.84 28.175 28.18 21.805 90-94 21.865000000000002 28.265 27.505000000000003 22.365 95-99 22.255 28.410000000000004 27.965 21.37 100-104 22.065 28.645 27.805000000000003 21.485000000000003 105-109 22.17 28.475 27.375 21.98 110-114 21.995 28.310000000000002 28.194999999999997 21.5 115-119 22.305 28.155 27.705000000000002 21.834999999999997 120-124 22.0 28.925 27.445000000000004 21.63 125-129 21.85 28.465 27.985 21.7 130-134 22.48 28.315 27.860000000000003 21.345 135-139 21.98 28.21 27.705000000000002 22.105 140-144 22.015 28.075 27.615000000000002 22.295 145-149 22.28 28.235 27.58 21.905 150 22.225 28.1 27.500000000000004 22.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 1.0 22 1.5 23 2.0 24 2.5 25 3.5 26 6.0 27 8.0 28 10.0 29 13.5 30 21.5 31 31.0 32 33.5 33 47.5 34 79.0 35 87.5 36 98.0 37 119.5 38 134.5 39 165.5 40 196.0 41 245.5 42 275.0 43 273.5 44 279.5 45 265.0 46 255.5 47 253.0 48 223.5 49 190.0 50 150.5 51 114.0 52 99.0 53 76.5 54 57.5 55 39.0 56 28.5 57 28.5 58 19.0 59 11.5 60 9.0 61 9.0 62 9.5 63 6.0 64 4.0 65 5.0 66 3.0 67 3.0 68 2.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.25 #Duplication Level Percentage of deduplicated Percentage of total 1 95.22309711286088 90.7 2 4.566929133858268 8.7 3 0.2099737532808399 0.6 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.1875 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.225 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.2625 0.0 0.0 0.0 0.0 118-119 0.2875 0.0 0.0 0.0 0.0 120-121 0.3 0.0 0.0 0.0 0.0 122-123 0.35 0.0 0.0 0.0 0.0 124-125 0.4 0.0 0.0 0.0 0.0 126-127 0.4125 0.0 0.0 0.0 0.0 128-129 0.4375 0.0 0.0 0.0 0.0 130-131 0.4875 0.0 0.0 0.0 0.0 132-133 0.5 0.0 0.0 0.0 0.0 134-135 0.5125 0.0 0.0 0.0 0.0 136-137 0.5625 0.0 0.0 0.0 0.0 138 0.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTTAAA 10 0.006973645 144.0 9 >>END_MODULE SRR22839643 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22839643_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.755 32.0 32.0 32.0 32.0 32.0 2 31.6625 32.0 32.0 32.0 32.0 32.0 3 35.675 37.0 37.0 37.0 32.0 37.0 4 35.63625 37.0 37.0 37.0 32.0 37.0 5 36.2525 37.0 37.0 37.0 37.0 37.0 6 39.90475 41.0 41.0 41.0 37.0 41.0 7 39.88475 41.0 41.0 41.0 37.0 41.0 8 40.08125 41.0 41.0 41.0 41.0 41.0 9 40.14025 41.0 41.0 41.0 41.0 41.0 10-14 39.555150000000005 41.0 40.2 41.0 36.0 41.0 15-19 39.005449999999996 41.0 39.4 41.0 35.0 41.0 20-24 37.22965000000001 41.0 37.8 41.0 27.0 41.0 25-29 36.32955 41.0 36.0 41.0 23.0 41.0 30-34 36.4382 41.0 35.0 41.0 23.0 41.0 35-39 35.069399999999995 40.2 33.0 41.0 21.0 41.0 40-44 35.54665 39.4 33.0 41.0 18.0 41.0 45-49 36.154799999999994 41.0 35.0 41.0 24.0 41.0 50-54 35.67275 39.4 33.0 41.0 21.0 41.0 55-59 36.3505 40.2 36.0 41.0 25.0 41.0 60-64 37.475849999999994 41.0 37.0 41.0 29.0 41.0 65-69 37.0449 41.0 36.8 41.0 27.0 41.0 70-74 36.16635 40.2 36.0 41.0 22.0 41.0 75-79 33.583850000000005 37.6 30.0 41.0 18.0 41.0 80-84 37.34125 41.0 36.8 41.0 26.0 41.0 85-89 37.3095 41.0 36.8 41.0 26.0 41.0 90-94 36.610949999999995 41.0 35.0 41.0 25.0 41.0 95-99 38.5388 41.0 37.8 41.0 33.0 41.0 100-104 35.6491 39.4 34.8 41.0 19.0 41.0 105-109 37.345 41.0 37.0 41.0 28.0 41.0 110-114 35.711200000000005 39.4 33.0 41.0 24.0 41.0 115-119 37.0262 41.0 36.0 41.0 26.0 41.0 120-124 37.03235000000001 41.0 37.0 41.0 27.0 41.0 125-129 36.2005 40.2 35.0 41.0 25.0 41.0 130-134 36.9918 41.0 36.0 41.0 30.0 41.0 135-139 35.1336 40.2 32.0 41.0 22.0 41.0 140-144 33.143550000000005 36.6 28.0 41.0 16.0 41.0 145-149 32.94205 36.8 28.0 41.0 17.0 41.0 150 30.64075 37.0 22.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 7.0 15 6.0 16 4.0 17 2.0 18 5.0 19 6.0 20 3.0 21 12.0 22 13.0 23 14.0 24 20.0 25 30.0 26 41.0 27 49.0 28 51.0 29 70.0 30 91.0 31 126.0 32 143.0 33 174.0 34 211.0 35 271.0 36 364.0 37 440.0 38 572.0 39 724.0 40 550.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.68991470145509 16.031108881083796 22.854992473657802 35.423983943803314 2 21.125 22.650000000000002 38.175 18.05 3 21.725 25.525 29.375 23.375 4 23.425 30.95 22.650000000000002 22.975 5 22.7 35.55 23.275000000000002 18.475 6 18.175 36.6 25.55 19.675 7 17.4 18.95 43.8 19.85 8 19.900000000000002 22.525000000000002 29.5 28.075 9 20.875 22.625 31.25 25.25 10-14 20.62 30.099999999999998 28.095 21.185000000000002 15-19 20.665 28.955 28.225 22.155 20-24 20.575 28.994999999999997 28.32 22.11 25-29 21.17 29.294999999999998 27.61 21.925 30-34 21.099999999999998 28.910000000000004 27.865000000000002 22.125 35-39 20.735 29.425 27.515 22.325 40-44 21.11 28.410000000000004 28.325 22.155 45-49 21.43 28.549999999999997 27.465 22.555 50-54 21.02 28.99 28.139999999999997 21.85 55-59 21.095 28.249999999999996 28.01 22.645 60-64 20.655 28.21 28.33 22.805 65-69 21.22 28.325 28.21 22.245 70-74 21.38 28.410000000000004 28.610000000000003 21.6 75-79 21.86 27.73 27.534999999999997 22.875 80-84 21.625 28.675 27.29 22.41 85-89 21.92 28.050000000000004 28.050000000000004 21.98 90-94 21.14 28.455000000000002 28.025 22.38 95-99 21.64 27.725 28.625 22.009999999999998 100-104 21.404999999999998 28.79 27.595 22.21 105-109 21.295 27.595 28.505000000000003 22.605 110-114 21.8 28.349999999999998 27.700000000000003 22.15 115-119 22.134999999999998 28.305000000000003 27.915 21.645 120-124 22.11 27.21 27.900000000000002 22.78 125-129 22.145 27.950000000000003 27.87 22.035 130-134 21.905 28.34 27.560000000000002 22.195 135-139 22.0 27.644999999999996 28.565 21.790000000000003 140-144 22.165000000000003 27.589999999999996 27.810000000000002 22.435 145-149 21.959999999999997 28.7 27.525 21.815 150 21.975 27.700000000000003 28.075 22.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 3.0 22 2.5 23 1.0 24 1.0 25 6.5 26 9.0 27 10.5 28 10.5 29 9.5 30 18.5 31 28.5 32 34.0 33 45.5 34 65.0 35 78.0 36 94.5 37 118.5 38 150.0 39 190.5 40 214.0 41 241.0 42 277.0 43 285.5 44 292.0 45 279.5 46 243.0 47 240.0 48 220.0 49 163.0 50 130.0 51 108.5 52 94.5 53 83.5 54 60.0 55 41.5 56 36.0 57 27.0 58 14.5 59 10.5 60 13.5 61 11.5 62 6.0 63 6.5 64 6.5 65 4.5 66 1.5 67 0.5 68 1.0 69 1.5 70 1.5 71 1.5 72 1.0 73 1.0 74 1.0 75 0.0 76 0.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.975 #Duplication Level Percentage of deduplicated Percentage of total 1 95.98853868194843 92.125 2 3.82912216723105 7.35 3 0.18233915082052618 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.1875 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.25 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.2875 0.0 0.0 0.0 0.0 118-119 0.3125 0.0 0.0 0.0 0.0 120-121 0.325 0.0 0.0 0.0 0.0 122-123 0.35 0.0 0.0 0.0 0.0 124-125 0.4 0.0 0.0 0.0 0.0 126-127 0.4375 0.0 0.0 0.0 0.0 128-129 0.4625 0.0 0.0 0.0 0.0 130-131 0.5125 0.0 0.0 0.0 0.0 132-133 0.55 0.0 0.0 0.0 0.0 134-135 0.5625 0.0 0.0 0.0 0.0 136-137 0.6125 0.0 0.0 0.0 0.0 138 0.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGATTG 10 0.006973645 144.0 2 >>END_MODULE Read 738113 spots for SRR22839643.sra Written 738113 spots for SRR22839643.sra Read 738113 spots for SRR22839643.sra Written 738113 spots for SRR22839643.sra Read 738113 spots for SRR22839643.sra Written 738113 spots for SRR22839643.sra Read 738113 spots for SRR22839643.sra Written 738113 spots for SRR22839643.sra Read 738113 spots for SRR22839643.sra Written 738113 spots for SRR22839643.sra Read 738113 spots for SRR22839643.sra Written 738113 spots for SRR22839643.sra Read 738113 spots for SRR22839643.sra Written 738113 spots for SRR22839643.sra Read 738113 spots for SRR22839643.sra Written 738113 spots for SRR22839643.sra Read 738113 spots for SRR22839643.sra Written 738113 spots for SRR22839643.sra Read 738113 spots for SRR22839643.sra Written 738113 spots for SRR22839643.sra Read 738113 spots for SRR22839643.sra Written 738113 spots for SRR22839643.sra Read 738113 spots for SRR22839643.sra Written 738113 spots for SRR22839643.sra Read 738113 spots for SRR22839643.sra Written 738113 spots for SRR22839643.sra Read 738113 spots for SRR22839643.sra Written 738113 spots for SRR22839643.sra Read 738113 spots for SRR22839643.sra Written 738113 spots for SRR22839643.sra Read 738113 spots for SRR22839643.sra Written 738113 spots for SRR22839643.sra Read 738113 spots for SRR22839643.sra Written 738113 spots for SRR22839643.sra Read 738113 spots for SRR22839643.sra Written 738113 spots for SRR22839643.sra Read 738113 spots for SRR22839643.sra Written 738113 spots for SRR22839643.sra Read 738126 spots for SRR22839643.sra Written 738126 spots for SRR22839643.sra SRR ids: ['SRR22839643.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wtejx9qi SRR22839643.sra spots: 14762273 blocks: [[1, 738113], [738114, 1476226], [1476227, 2214339], [2214340, 2952452], [2952453, 3690565], [3690566, 4428678], [4428679, 5166791], [5166792, 5904904], [5904905, 6643017], [6643018, 7381130], [7381131, 8119243], [8119244, 8857356], [8857357, 9595469], [9595470, 10333582], [10333583, 11071695], [11071696, 11809808], [11809809, 12547921], [12547922, 13286034], [13286035, 14024147], [14024148, 14762273]] SRR22839643 file size 4966333 SRR22839643 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22839643 SRR22839643_1.fastq SRR22839643_2.fastq Input file: SRR22839643_1.fastq Paired file: SRR22839643_2.fastq trimmed: SRR22839643-trimmed-pair1.fastq, SRR22839643-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:57:11 2025 >> started Thu Feb 13 16:57:27 2025 >> done (15.403s) 14762273 read pairs processed; of these: 352 ( 0.00%) short read pairs filtered out after trimming by size control 1584 ( 0.01%) empty read pairs filtered out after trimming by size control 14760337 (99.99%) read pairs available; of these: 364733 ( 2.47%) trimmed read pairs available after processing 14395604 (97.53%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 34 0.00% 19 15 0.00% 20 25 0.00% 21 24 0.00% 22 25 0.00% 23 19 0.00% 24 20 0.00% 25 20 0.00% 26 32 0.00% 27 14 0.00% 28 13 0.00% 29 10 0.00% 30 18 0.00% 31 15 0.00% 32 23 0.00% 33 16 0.00% 34 16 0.00% 35 15 0.00% 36 17 0.00% 37 16 0.00% 38 16 0.00% 39 22 0.00% 40 24 0.00% 41 21 0.00% 42 15 0.00% 43 26 0.00% 44 20 0.00% 45 27 0.00% 46 23 0.00% 47 30 0.00% 48 25 0.00% 49 32 0.00% 50 39 0.00% 51 30 0.00% 52 34 0.00% 53 35 0.00% 54 38 0.00% 55 27 0.00% 56 32 0.00% 57 44 0.00% 58 35 0.00% 59 48 0.00% 60 54 0.00% 61 62 0.00% 62 43 0.00% 63 62 0.00% 64 56 0.00% 65 70 0.00% 66 73 0.00% 67 44 0.00% 68 91 0.00% 69 76 0.00% 70 101 0.00% 71 92 0.00% 72 116 0.00% 73 156 0.00% 74 171 0.00% 75 149 0.00% 76 158 0.00% 77 159 0.00% 78 162 0.00% 79 214 0.00% 80 252 0.00% 81 277 0.00% 82 387 0.00% 83 339 0.00% 84 369 0.00% 85 382 0.00% 86 363 0.00% 87 402 0.00% 88 380 0.00% 89 412 0.00% 90 486 0.00% 91 624 0.00% 92 649 0.00% 93 673 0.00% 94 794 0.01% 95 764 0.01% 96 760 0.01% 97 775 0.01% 98 777 0.01% 99 829 0.01% 100 921 0.01% 101 1067 0.01% 102 1169 0.01% 103 1346 0.01% 104 1371 0.01% 105 1426 0.01% 106 1375 0.01% 107 1326 0.01% 108 1307 0.01% 109 1437 0.01% 110 1460 0.01% 111 1623 0.01% 112 1936 0.01% 113 2080 0.01% 114 2195 0.01% 115 2087 0.01% 116 2100 0.01% 117 2080 0.01% 118 1988 0.01% 119 2158 0.01% 120 2260 0.02% 121 2529 0.02% 122 2612 0.02% 123 2913 0.02% 124 3244 0.02% 125 3305 0.02% 126 3215 0.02% 127 3059 0.02% 128 2960 0.02% 129 3083 0.02% 130 3150 0.02% 131 3462 0.02% 132 3679 0.02% 133 4136 0.03% 134 4329 0.03% 135 4509 0.03% 136 4496 0.03% 137 4421 0.03% 138 4336 0.03% 139 4254 0.03% 140 4464 0.03% 141 4600 0.03% 142 5028 0.03% 143 5434 0.04% 144 5802 0.04% 145 6064 0.04% 146 6616 0.04% 147 8323 0.06% 148 16528 0.11% 149 185637 1.26% 150 14395604 97.53% 14760337 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=15.10 fanout-score-rank=4 prefix-density=0.46 prefix-fanout=7.9 sequence=TTCCTCCATTGTACAAAAACGTTGTGCCAGTCACCTGCCGCGGCCCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=28.04 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=3.7 sequence=AACAAGCATCACTTGCATAGTTGCATTTCGAACACTTGAACAAGTATCACTTGCGTAGTTGCATTTGCATTTTTGCAAAGCTTCCAAGCTGTGCAGAGAGCAAAACCTGAAAACCACAAAGATGAAGC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=12.68 fanout-score-rank=4 prefix-density=0.41 prefix-fanout=7.0 sequence=TTCCTCCATTGTACAAAAACGTTGTGCCAGTCACCTGCCGCGGCCCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=41.74 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=2.4 sequence=TTGAACAAGCATCACTTGCATAGTTGCATTTCGAACACTTGAACAAGTATCACTTGCGTAGTTGCATTTGCATTTTTGCAAAGCTTCCAAGCTGTGCAGAGAGCAAAACCTGAAAACCACAAAGATGAAGC SRR22839643 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:58:16 Started mapping on | Feb 13 16:58:16 Finished on | Feb 13 16:59:36 Mapping speed, Million of reads per hour | 664.22 Number of input reads | 14760337 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 14118321 Uniquely mapped reads % | 95.65% Average mapped length | 297.69 Number of splices: Total | 12575648 Number of splices: Annotated (sjdb) | 12283448 Number of splices: GT/AG | 12381957 Number of splices: GC/AG | 151111 Number of splices: AT/AC | 14117 Number of splices: Non-canonical | 28463 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.02% Deletion average length | 3.26 Insertion rate per base | 0.01% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 244906 % of reads mapped to multiple loci | 1.66% Number of reads mapped to too many loci | 50121 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.23% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 397110 397110 397110 N_multimapping 244906 244906 244906 N_noFeature 557476 7283181 7241749 N_ambiguous 224938 36815 37745 UnstrandedReadsAssigned:13335907 PositiveStrandReadsAssigned:6798325 NegativeStrandReadsAssigned:6838827 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR22839643 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22839643-trimmed-pair1.fastq SRR22839643-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,760,337 reads, 13,754,887 reads pseudoaligned [quant] estimated average fragment length: 300.268 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,042 rounds 52401 SRR22839643.ke.tsv 34699 SRR22839643.se.tsv 87100 total ==> SRR22839643.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1718.73 581 24.0905 Potri.005G024800.1.v4.1 1035 735.732 133 12.8828 Potri.004G059700.1.v4.1 961 661.743 162 17.4463 Potri.007G009000.2.v4.1 1416 1116.73 0 0 Potri.003G141000.2.v4.1 2943 2643.73 236.271 6.369 Potri.016G087400.1.v4.1 270 51.9089 704 966.515 Potri.015G069301.1.v4.1 564 266.764 0 0 Potri.010G195200.1.v4.1 1773 1473.73 36 1.74085 Potri.012G127500.1.v4.1 977 677.738 2346 246.686 ==> SRR22839643.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 1987 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 375 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 134 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR22839643 completed mapping pipeline successfully