Starting /dee2/code/volunteer_pipeline.sh SRR22839644 current disk space = 3088657887232 free memory = 1496421808 SRR22839644 SRAfilesize 04b62c9886aab4dcb9adbdcf1877e0a2 SRR22839644.sra SRR22839644.sra file validated SRR22839644 is paired end SRR22839644 is conventional basespace SRR22839644 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22839644_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.38 32.0 32.0 32.0 27.0 32.0 2 29.2325 32.0 32.0 32.0 12.0 32.0 3 27.035 32.0 12.0 32.0 12.0 37.0 4 35.28875 37.0 32.0 37.0 32.0 37.0 5 35.92375 37.0 37.0 37.0 32.0 37.0 6 36.48325 41.0 37.0 41.0 27.0 41.0 7 38.9875 41.0 37.0 41.0 37.0 41.0 8 39.692 41.0 41.0 41.0 37.0 41.0 9 40.07325 41.0 41.0 41.0 37.0 41.0 10-14 38.9847 41.0 39.4 41.0 34.0 41.0 15-19 39.404599999999995 41.0 41.0 41.0 36.0 41.0 20-24 38.72435 41.0 38.6 41.0 32.0 41.0 25-29 38.8563 41.0 40.2 41.0 34.0 41.0 30-34 38.62005 41.0 40.2 41.0 33.0 41.0 35-39 39.4397 41.0 41.0 41.0 37.0 41.0 40-44 37.7333 41.0 37.6 41.0 29.0 41.0 45-49 37.26755 41.0 36.8 41.0 28.0 41.0 50-54 37.2309 41.0 37.0 41.0 26.0 41.0 55-59 35.8341 41.0 33.0 41.0 21.0 41.0 60-64 31.22585 34.0 25.0 40.2 15.0 41.0 65-69 36.69955 40.2 36.0 41.0 25.0 41.0 70-74 32.74980000000001 36.8 25.0 41.0 14.0 41.0 75-79 35.72365 39.4 32.0 41.0 24.0 41.0 80-84 39.829049999999995 41.0 41.0 41.0 37.0 41.0 85-89 39.26395 41.0 40.2 41.0 34.0 41.0 90-94 36.50150000000001 41.0 35.0 41.0 23.0 41.0 95-99 37.23100000000001 41.0 36.8 41.0 26.0 41.0 100-104 36.8091 41.0 37.0 41.0 26.0 41.0 105-109 36.44775 41.0 35.8 41.0 22.0 41.0 110-114 36.3732 40.2 34.6 41.0 27.0 41.0 115-119 37.4268 41.0 37.6 41.0 27.0 41.0 120-124 35.51925 41.0 34.0 41.0 21.0 41.0 125-129 34.035199999999996 38.6 29.0 41.0 16.0 41.0 130-134 34.285849999999996 38.2 31.0 40.2 21.0 41.0 135-139 33.6009 36.8 29.0 41.0 18.0 41.0 140-144 31.813850000000002 34.8 26.0 40.2 19.0 41.0 145-149 32.91465 36.8 27.0 40.2 20.0 41.0 150 35.23025 41.0 32.0 41.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 4.0 22 11.0 23 12.0 24 17.0 25 19.0 26 36.0 27 48.0 28 63.0 29 89.0 30 131.0 31 149.0 32 194.0 33 242.0 34 248.0 35 293.0 36 326.0 37 316.0 38 432.0 39 654.0 40 714.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.174999999999997 15.6 22.35 36.875 2 22.325 23.35 36.8 17.525 3 22.0 25.275 29.299999999999997 23.425 4 23.525 31.175000000000004 20.625 24.675 5 23.625 36.175000000000004 23.474999999999998 16.725 6 18.85 38.9 23.45 18.8 7 17.424999999999997 17.625 43.25 21.7 8 18.975 23.724999999999998 30.025000000000002 27.275 9 21.25 22.925 31.45 24.375 10-14 20.655 30.39 27.465 21.490000000000002 15-19 20.645 28.065 28.965000000000003 22.325 20-24 21.404999999999998 28.65 28.03 21.915000000000003 25-29 21.279999999999998 28.675 27.445000000000004 22.6 30-34 21.245 28.465 28.000000000000004 22.29 35-39 21.634999999999998 28.205000000000002 28.035 22.125 40-44 21.5 28.365000000000002 28.09 22.045 45-49 21.97 28.435 27.975 21.62 50-54 22.045 28.449999999999996 27.560000000000002 21.945 55-59 21.87 27.785 27.735 22.61 60-64 22.555 28.084999999999997 28.34 21.02 65-69 22.09 27.905 27.615000000000002 22.39 70-74 22.575 28.02 27.625 21.78 75-79 21.790000000000003 28.285 27.32 22.605 80-84 21.975 27.805000000000003 27.68 22.54 85-89 21.545 28.735 27.150000000000002 22.57 90-94 21.135 28.050000000000004 28.285 22.53 95-99 22.075 27.29 28.165000000000003 22.470000000000002 100-104 22.465 27.634999999999998 27.855 22.045 105-109 22.0 27.439999999999998 28.27 22.29 110-114 21.985 27.905 27.71 22.400000000000002 115-119 22.405 28.04 27.37 22.185 120-124 22.12 28.16 27.295 22.425 125-129 22.275 28.294999999999998 27.644999999999996 21.785 130-134 22.509999999999998 27.575 27.560000000000002 22.355 135-139 22.585 27.650000000000002 27.655 22.11 140-144 23.56 27.875 27.865000000000002 20.7 145-149 22.6 28.105000000000004 27.915 21.38 150 22.8 28.475 27.500000000000004 21.224999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 1.0 23 1.5 24 2.5 25 1.5 26 2.0 27 8.5 28 10.5 29 8.5 30 12.0 31 21.0 32 33.0 33 40.5 34 61.0 35 75.0 36 76.0 37 94.5 38 131.0 39 170.5 40 196.0 41 238.5 42 275.5 43 285.0 44 282.0 45 278.5 46 278.5 47 264.5 48 235.0 49 192.0 50 156.0 51 128.5 52 99.5 53 74.5 54 61.0 55 48.5 56 38.5 57 30.0 58 18.5 59 12.0 60 10.0 61 9.5 62 5.5 63 7.0 64 7.5 65 4.0 66 2.0 67 1.0 68 1.5 69 1.0 70 0.5 71 0.5 72 1.0 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.85 #Duplication Level Percentage of deduplicated Percentage of total 1 94.78123352662098 89.9 2 5.007907221929362 9.5 3 0.21085925144965736 0.6 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.1375 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.23750000000000002 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.425 0.0 0.0 0.0 0.0 120-121 0.4625 0.0 0.0 0.0 0.0 122-123 0.4875 0.0 0.0 0.0 0.0 124-125 0.5375 0.0 0.0 0.0 0.0 126-127 0.575 0.0 0.0 0.0 0.0 128-129 0.6125 0.0 0.0 0.0 0.0 130-131 0.625 0.0 0.0 0.0 0.0 132-133 0.6625000000000001 0.0 0.0 0.0 0.0 134-135 0.7 0.0 0.0 0.0 0.0 136-137 0.775 0.0 0.0 0.0 0.0 138 0.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGAGGA 10 0.006973645 144.0 9 TTTGGTA 10 0.006973645 144.0 8 >>END_MODULE SRR22839644 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22839644_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.76875 32.0 27.0 32.0 12.0 32.0 2 31.33125 32.0 32.0 32.0 32.0 32.0 3 34.37875 37.0 32.0 37.0 32.0 37.0 4 35.68125 37.0 37.0 37.0 32.0 37.0 5 35.70875 37.0 37.0 37.0 32.0 37.0 6 38.47 41.0 37.0 41.0 32.0 41.0 7 38.76 41.0 41.0 41.0 32.0 41.0 8 27.9425 32.0 12.0 41.0 12.0 41.0 9 37.764 41.0 37.0 41.0 32.0 41.0 10-14 38.320800000000006 41.0 38.4 41.0 31.0 41.0 15-19 39.17185 41.0 40.2 41.0 36.0 41.0 20-24 36.04885 39.2 33.6 41.0 27.0 41.0 25-29 35.2798 40.2 32.0 41.0 19.0 41.0 30-34 32.230199999999996 35.6 25.0 40.2 17.0 41.0 35-39 30.38975 32.0 20.0 38.6 17.0 41.0 40-44 34.05135 37.6 29.0 41.0 20.0 41.0 45-49 34.1924 38.6 30.0 41.0 20.0 41.0 50-54 32.01965 36.8 24.0 41.0 18.0 41.0 55-59 35.6339 40.2 33.0 41.0 24.0 41.0 60-64 36.381899999999995 41.0 35.0 41.0 24.0 41.0 65-69 34.60735 37.6 30.0 41.0 21.0 41.0 70-74 37.759550000000004 41.0 37.8 41.0 30.0 41.0 75-79 36.55319999999999 41.0 36.0 41.0 24.0 41.0 80-84 37.3079 41.0 37.0 41.0 28.0 41.0 85-89 36.0255 40.2 35.0 41.0 22.0 41.0 90-94 35.984500000000004 41.0 34.0 41.0 22.0 41.0 95-99 36.21455 41.0 36.0 41.0 22.0 41.0 100-104 36.70025 40.2 35.0 41.0 26.0 41.0 105-109 33.22805 37.0 28.0 41.0 16.0 41.0 110-114 34.8734 39.4 32.0 41.0 16.0 41.0 115-119 35.4304 40.2 35.0 41.0 21.0 41.0 120-124 36.0652 40.2 35.0 41.0 24.0 41.0 125-129 35.413599999999995 41.0 32.0 41.0 20.0 41.0 130-134 33.59095 37.8 29.0 41.0 14.0 41.0 135-139 32.1717 36.0 27.0 41.0 14.0 41.0 140-144 34.64444999999999 39.4 31.0 41.0 20.0 41.0 145-149 32.54635 36.8 26.0 41.0 18.0 41.0 150 35.59675 37.0 32.0 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 4.0 15 8.0 16 5.0 17 4.0 18 10.0 19 17.0 20 20.0 21 20.0 22 33.0 23 51.0 24 46.0 25 71.0 26 63.0 27 83.0 28 98.0 29 118.0 30 129.0 31 161.0 32 181.0 33 228.0 34 207.0 35 281.0 36 315.0 37 364.0 38 418.0 39 597.0 40 467.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.801026957637998 18.10012836970475 21.925545571245188 35.17329910141206 2 19.975 24.95 37.4 17.675 3 19.85 26.575 28.999999999999996 24.575 4 22.8 30.875000000000004 20.8 25.525 5 22.625 36.25 23.599999999999998 17.525 6 17.325 37.1 25.324999999999996 20.25 7 16.5 19.525000000000002 43.375 20.599999999999998 8 22.3 24.474999999999998 29.925 23.3 9 21.125 22.0 31.574999999999996 25.3 10-14 20.685000000000002 29.14 28.43 21.745 15-19 21.035 27.99 29.14 21.834999999999997 20-24 21.065 28.9 28.410000000000004 21.625 25-29 21.545 28.225 28.585 21.645 30-34 21.02 28.46 29.45 21.07 35-39 21.86 28.105000000000004 29.335 20.7 40-44 21.154999999999998 28.754999999999995 28.645 21.445 45-49 21.67 27.529999999999998 28.585 22.215 50-54 20.979999999999997 28.89 28.155 21.975 55-59 21.935 27.61 28.185 22.27 60-64 21.465 27.955000000000002 28.115000000000002 22.465 65-69 21.959999999999997 27.375 28.815 21.85 70-74 21.295 28.21 28.025 22.470000000000002 75-79 21.425 28.13 27.83 22.615 80-84 22.2 27.694999999999997 27.655 22.45 85-89 21.9 27.775 28.1 22.225 90-94 22.365 27.785 27.800000000000004 22.05 95-99 21.64 28.544999999999998 27.49 22.325 100-104 22.225 28.075 27.29 22.41 105-109 22.05 27.950000000000003 27.889999999999997 22.11 110-114 22.11 28.275 27.73 21.884999999999998 115-119 21.9 27.865000000000002 27.6 22.634999999999998 120-124 22.545 27.61 27.35 22.495 125-129 22.32 27.689999999999998 28.17 21.82 130-134 22.435 27.224999999999998 28.365000000000002 21.975 135-139 23.02 27.305 27.485 22.189999999999998 140-144 22.585 27.755000000000003 27.765 21.895 145-149 23.32 27.555000000000003 27.589999999999996 21.535 150 22.25 26.900000000000002 28.599999999999998 22.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 2.0 21 2.5 22 2.0 23 2.5 24 4.5 25 5.0 26 8.0 27 10.0 28 9.0 29 14.0 30 20.0 31 29.5 32 37.5 33 41.5 34 54.0 35 68.0 36 93.5 37 120.0 38 154.0 39 181.0 40 199.5 41 246.0 42 266.5 43 274.5 44 292.0 45 285.0 46 275.5 47 248.5 48 202.5 49 181.0 50 152.5 51 115.0 52 97.0 53 72.5 54 50.5 55 41.0 56 29.5 57 20.5 58 17.0 59 14.5 60 13.0 61 11.0 62 6.5 63 6.0 64 8.0 65 5.5 66 2.0 67 1.5 68 0.5 69 1.0 70 1.5 71 0.5 72 0.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.8 #Duplication Level Percentage of deduplicated Percentage of total 1 97.80163599182005 95.65 2 2.147239263803681 4.2 3 0.051124744376278126 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.16249999999999998 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.23750000000000002 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.425 0.0 0.0 0.0 0.0 120-121 0.4625 0.0 0.0 0.0 0.0 122-123 0.5 0.0 0.0 0.0 0.0 124-125 0.575 0.0 0.0 0.0 0.0 126-127 0.6375 0.0 0.0 0.0 0.0 128-129 0.6875 0.0 0.0 0.0 0.0 130-131 0.7124999999999999 0.0 0.0 0.0 0.0 132-133 0.7625 0.0 0.0 0.0 0.0 134-135 0.8625 0.0 0.0 0.0 0.0 136-137 1.0 0.0 0.0 0.0 0.0 138 1.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTGCTA 10 0.0069772652 143.975 8 ACACTTG 10 0.0069772652 143.975 8 CACTTGA 10 0.0069772652 143.975 9 >>END_MODULE Read 828854 spots for SRR22839644.sra Written 828854 spots for SRR22839644.sra Read 828854 spots for SRR22839644.sra Written 828854 spots for SRR22839644.sra Read 828854 spots for SRR22839644.sra Written 828854 spots for SRR22839644.sra Read 828854 spots for SRR22839644.sra Written 828854 spots for SRR22839644.sra Read 828854 spots for SRR22839644.sra Written 828854 spots for SRR22839644.sra Read 828854 spots for SRR22839644.sra Written 828854 spots for SRR22839644.sra Read 828854 spots for SRR22839644.sra Written 828854 spots for SRR22839644.sra Read 828854 spots for SRR22839644.sra Written 828854 spots for SRR22839644.sra Read 828854 spots for SRR22839644.sra Written 828854 spots for SRR22839644.sra Read 828854 spots for SRR22839644.sra Written 828854 spots for SRR22839644.sra Read 828854 spots for SRR22839644.sra Written 828854 spots for SRR22839644.sra Read 828854 spots for SRR22839644.sra Written 828854 spots for SRR22839644.sra Read 828854 spots for SRR22839644.sra Written 828854 spots for SRR22839644.sra Read 828854 spots for SRR22839644.sra Written 828854 spots for SRR22839644.sra Read 828854 spots for SRR22839644.sra Written 828854 spots for SRR22839644.sra Read 828854 spots for SRR22839644.sra Written 828854 spots for SRR22839644.sra Read 828854 spots for SRR22839644.sra Written 828854 spots for SRR22839644.sra Read 828854 spots for SRR22839644.sra Written 828854 spots for SRR22839644.sra Read 828854 spots for SRR22839644.sra Written 828854 spots for SRR22839644.sra Read 828854 spots for SRR22839644.sra Written 828854 spots for SRR22839644.sra SRR ids: ['SRR22839644.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_50kvoiej SRR22839644.sra spots: 16577080 blocks: [[1, 828854], [828855, 1657708], [1657709, 2486562], [2486563, 3315416], [3315417, 4144270], [4144271, 4973124], [4973125, 5801978], [5801979, 6630832], [6630833, 7459686], [7459687, 8288540], [8288541, 9117394], [9117395, 9946248], [9946249, 10775102], [10775103, 11603956], [11603957, 12432810], [12432811, 13261664], [13261665, 14090518], [14090519, 14919372], [14919373, 15748226], [15748227, 16577080]] SRR22839644 file size 5579539 SRR22839644 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22839644 SRR22839644_1.fastq SRR22839644_2.fastq Input file: SRR22839644_1.fastq Paired file: SRR22839644_2.fastq trimmed: SRR22839644-trimmed-pair1.fastq, SRR22839644-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:15:01 2025 >> started Thu Feb 13 17:15:20 2025 >> done (19.542s) 16577080 read pairs processed; of these: 151 ( 0.00%) short read pairs filtered out after trimming by size control 2221 ( 0.01%) empty read pairs filtered out after trimming by size control 16574708 (99.99%) read pairs available; of these: 582786 ( 3.52%) trimmed read pairs available after processing 15991922 (96.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 19 0.00% 19 11 0.00% 20 24 0.00% 21 20 0.00% 22 27 0.00% 23 24 0.00% 24 20 0.00% 25 14 0.00% 26 25 0.00% 27 21 0.00% 28 38 0.00% 29 29 0.00% 30 25 0.00% 31 27 0.00% 32 29 0.00% 33 46 0.00% 34 18 0.00% 35 26 0.00% 36 54 0.00% 37 41 0.00% 38 47 0.00% 39 41 0.00% 40 43 0.00% 41 48 0.00% 42 61 0.00% 43 46 0.00% 44 54 0.00% 45 50 0.00% 46 68 0.00% 47 54 0.00% 48 51 0.00% 49 65 0.00% 50 48 0.00% 51 56 0.00% 52 79 0.00% 53 91 0.00% 54 69 0.00% 55 63 0.00% 56 88 0.00% 57 69 0.00% 58 83 0.00% 59 83 0.00% 60 78 0.00% 61 85 0.00% 62 82 0.00% 63 87 0.00% 64 99 0.00% 65 99 0.00% 66 97 0.00% 67 115 0.00% 68 125 0.00% 69 123 0.00% 70 127 0.00% 71 161 0.00% 72 162 0.00% 73 193 0.00% 74 181 0.00% 75 185 0.00% 76 170 0.00% 77 179 0.00% 78 197 0.00% 79 220 0.00% 80 252 0.00% 81 285 0.00% 82 327 0.00% 83 379 0.00% 84 409 0.00% 85 412 0.00% 86 405 0.00% 87 427 0.00% 88 372 0.00% 89 448 0.00% 90 524 0.00% 91 645 0.00% 92 748 0.00% 93 788 0.00% 94 866 0.01% 95 846 0.01% 96 793 0.00% 97 812 0.00% 98 849 0.01% 99 937 0.01% 100 1031 0.01% 101 1173 0.01% 102 1196 0.01% 103 1424 0.01% 104 1584 0.01% 105 1525 0.01% 106 1490 0.01% 107 1467 0.01% 108 1515 0.01% 109 1552 0.01% 110 1740 0.01% 111 1992 0.01% 112 2118 0.01% 113 2288 0.01% 114 2706 0.02% 115 2644 0.02% 116 2597 0.02% 117 2586 0.02% 118 2470 0.01% 119 2560 0.02% 120 2636 0.02% 121 2988 0.02% 122 3282 0.02% 123 3814 0.02% 124 4052 0.02% 125 3913 0.02% 126 4124 0.02% 127 3978 0.02% 128 3923 0.02% 129 4085 0.02% 130 4285 0.03% 131 4502 0.03% 132 4957 0.03% 133 5298 0.03% 134 5749 0.03% 135 6164 0.04% 136 6081 0.04% 137 6122 0.04% 138 5907 0.04% 139 5848 0.04% 140 6204 0.04% 141 6332 0.04% 142 7004 0.04% 143 7654 0.05% 144 8839 0.05% 145 9251 0.06% 146 10478 0.06% 147 15688 0.09% 148 39751 0.24% 149 326035 1.97% 150 15991922 96.48% 16574708 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=21.04 fanout-score-rank=10 prefix-density=0.32 prefix-fanout=9.0 sequence=TTCCTCCATTGTACAAAAACGTTGTGCCAGTCACCTGCCGCGGCCCC criterion=fanout-score sequence-density=0.05 sequence-density-rank=34 fanout-score=55.33 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=10.6 sequence=CAAGAAAATGGAAACCTTTCTATTCACCTCTGAGTCAGTGAATGAGGGCCACCCTGACAAACTATGTGACCAGATCTCTGATGCAGTGCTCGATGCCTGCCTTGAGCAGGACCCAGACAGCAAGGTTGCTTGCGAGACATGTACAAAGACAAACATGGTCATGGTCTTTGGAGAGATCACCACC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=24.48 fanout-score-rank=6 prefix-density=0.32 prefix-fanout=9.8 sequence=TTCCTCCATTGTACAAAAACGTTGTGCCAGTCACCTGCCGCGGCCCC criterion=fanout-score sequence-density=0.08 sequence-density-rank=13 fanout-score=47.69 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=12.1 sequence=CACCACCACCATGGGCTCCCCAGCCACCATAGGTGTCAATAATGATCTTGCGTCCAGTGAGACCTGCATCACCATGAGGACCACCAATAACAAAACGGCCAGATGGGTTGAGGTGAAAGATAGTTTTCTCATCAAGGTACTTCTCCGGGATAACAGGCTTGATGACATACTCCTTTAGATCAGCGGCAATTTCATCATTTGTGACAGTCTCATCATGCTGAGTAGAGATGAGAACAGTGTGGACACGAACAGGGACCATTGCACCATTGTCATTGAAG SRR22839644 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:16:05 Started mapping on | Feb 13 17:16:06 Finished on | Feb 13 17:17:50 Mapping speed, Million of reads per hour | 573.74 Number of input reads | 16574708 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 15749617 Uniquely mapped reads % | 95.02% Average mapped length | 297.12 Number of splices: Total | 14165773 Number of splices: Annotated (sjdb) | 13835089 Number of splices: GT/AG | 13953173 Number of splices: GC/AG | 165430 Number of splices: AT/AC | 16309 Number of splices: Non-canonical | 30861 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.02% Deletion average length | 3.13 Insertion rate per base | 0.01% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 260199 % of reads mapped to multiple loci | 1.57% Number of reads mapped to too many loci | 51973 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.98% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 564892 564892 564892 N_multimapping 260199 260199 260199 N_noFeature 574379 8102019 8068765 N_ambiguous 236594 41866 42068 UnstrandedReadsAssigned:14938644 PositiveStrandReadsAssigned:7605732 NegativeStrandReadsAssigned:7638784 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR22839644 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22839644-trimmed-pair1.fastq SRR22839644-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,574,708 reads, 15,558,226 reads pseudoaligned [quant] estimated average fragment length: 281.05 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,190 rounds 52401 SRR22839644.ke.tsv 34699 SRR22839644.se.tsv 87100 total ==> SRR22839644.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1737.95 1011 37.1544 Potri.005G024800.1.v4.1 1035 754.95 326 27.5801 Potri.004G059700.1.v4.1 961 680.961 63 5.90901 Potri.007G009000.2.v4.1 1416 1135.95 0 0 Potri.003G141000.2.v4.1 2943 2662.95 289.163 6.93548 Potri.016G087400.1.v4.1 270 52.5228 850 1033.64 Potri.015G069301.1.v4.1 564 284.676 0 0 Potri.010G195200.1.v4.1 1773 1492.95 24 1.02674 Potri.012G127500.1.v4.1 977 696.961 400 36.6562 ==> SRR22839644.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2299 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 466 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 116 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR22839644 completed mapping pipeline successfully