Starting /dee2/code/volunteer_pipeline.sh SRR22839645 current disk space = 3088892026880 free memory = 1429264240 SRR22839645 SRAfilesize bfc0e6029a7a4cbe4771ede540023567 SRR22839645.sra SRR22839645.sra file validated SRR22839645 is paired end SRR22839645 is conventional basespace SRR22839645 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22839645_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.7675 32.0 32.0 32.0 32.0 32.0 2 29.20875 32.0 32.0 32.0 12.0 32.0 3 33.54 32.0 32.0 37.0 32.0 37.0 4 33.46625 37.0 32.0 37.0 27.0 37.0 5 33.835 37.0 32.0 37.0 27.0 37.0 6 35.4695 37.0 32.0 41.0 27.0 41.0 7 36.3945 41.0 37.0 41.0 27.0 41.0 8 36.85925 41.0 37.0 41.0 27.0 41.0 9 36.42475 41.0 37.0 41.0 27.0 41.0 10-14 37.50615 40.2 36.0 41.0 29.0 41.0 15-19 38.8615 41.0 38.6 41.0 34.0 41.0 20-24 39.32665 41.0 40.2 41.0 36.0 41.0 25-29 38.39365 41.0 38.6 41.0 33.0 41.0 30-34 39.66 41.0 41.0 41.0 37.0 41.0 35-39 39.3565 41.0 40.2 41.0 35.0 41.0 40-44 38.7353 41.0 40.2 41.0 35.0 41.0 45-49 38.68665 41.0 40.2 41.0 34.0 41.0 50-54 38.40065 41.0 38.6 41.0 33.0 41.0 55-59 38.5486 41.0 38.6 41.0 33.0 41.0 60-64 38.304249999999996 41.0 38.6 41.0 32.0 41.0 65-69 37.243100000000005 41.0 37.8 41.0 28.0 41.0 70-74 37.16445 41.0 36.8 41.0 28.0 41.0 75-79 36.60515 40.2 35.0 41.0 27.0 41.0 80-84 36.61665 41.0 36.0 41.0 25.0 41.0 85-89 37.026799999999994 41.0 36.0 41.0 26.0 41.0 90-94 36.628499999999995 41.0 34.0 41.0 26.0 41.0 95-99 36.806000000000004 40.2 35.0 41.0 26.0 41.0 100-104 36.0474 40.2 34.0 41.0 23.0 41.0 105-109 37.23555 41.0 36.0 41.0 27.0 41.0 110-114 36.853049999999996 41.0 37.0 41.0 26.0 41.0 115-119 37.38005 41.0 36.0 41.0 28.0 41.0 120-124 36.9211 40.2 35.8 41.0 26.0 41.0 125-129 36.59805 41.0 36.0 41.0 24.0 41.0 130-134 37.34365 41.0 37.0 41.0 29.0 41.0 135-139 37.77895 41.0 37.0 41.0 29.0 41.0 140-144 36.4904 40.2 35.0 41.0 27.0 41.0 145-149 34.643100000000004 37.8 32.0 41.0 20.0 41.0 150 34.82975 37.0 32.0 41.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 5.0 24 5.0 25 12.0 26 11.0 27 15.0 28 28.0 29 50.0 30 66.0 31 104.0 32 123.0 33 171.0 34 206.0 35 288.0 36 334.0 37 458.0 38 558.0 39 811.0 40 754.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.124999999999996 16.075 21.4 37.4 2 20.125 23.925 37.1 18.85 3 20.424999999999997 26.700000000000003 28.725 24.15 4 25.2 32.300000000000004 20.8 21.7 5 23.825 35.55 22.325 18.3 6 18.125 39.825 22.925 19.125 7 15.975 19.1 42.55 22.375 8 18.9 23.25 30.025000000000002 27.825 9 21.5 22.650000000000002 32.074999999999996 23.775 10-14 20.54 30.42 27.884999999999998 21.154999999999998 15-19 21.04 28.634999999999998 28.105000000000004 22.220000000000002 20-24 21.18 29.01 27.889999999999997 21.92 25-29 21.404999999999998 28.465 28.1 22.03 30-34 20.985 28.715000000000003 27.685 22.615 35-39 20.895 29.365000000000002 27.189999999999998 22.55 40-44 21.77 28.08 28.249999999999996 21.9 45-49 21.6 28.26 27.435 22.705000000000002 50-54 21.6 28.595 27.584999999999997 22.220000000000002 55-59 21.46 28.395 27.88 22.264999999999997 60-64 21.404999999999998 28.475 27.884999999999998 22.235 65-69 21.485000000000003 28.655 27.82 22.040000000000003 70-74 22.125 28.185 27.93 21.759999999999998 75-79 21.335 28.53 27.884999999999998 22.25 80-84 21.959999999999997 28.585 27.62 21.834999999999997 85-89 21.82 28.525 27.439999999999998 22.215 90-94 22.285 28.58 27.495000000000005 21.64 95-99 22.509999999999998 28.46 27.49 21.54 100-104 22.66 28.525 26.96 21.855 105-109 22.255 28.244999999999997 27.189999999999998 22.31 110-114 21.945 28.694999999999997 27.700000000000003 21.66 115-119 22.259999999999998 28.044999999999998 27.38 22.314999999999998 120-124 22.375 28.575 27.435 21.615000000000002 125-129 21.125 28.685 28.345 21.845 130-134 22.05 28.315 27.85 21.785 135-139 22.16 28.110000000000003 27.71 22.02 140-144 22.495 28.110000000000003 27.38 22.015 145-149 21.695 28.275 27.815 22.215 150 21.625 27.825 28.449999999999996 22.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 2.0 24 5.5 25 5.0 26 4.5 27 11.0 28 14.0 29 15.0 30 22.0 31 23.0 32 30.5 33 45.0 34 50.5 35 66.0 36 100.5 37 122.5 38 138.0 39 175.5 40 204.5 41 236.0 42 269.5 43 285.5 44 289.5 45 269.5 46 242.0 47 225.0 48 213.0 49 201.0 50 169.0 51 126.5 52 100.5 53 79.0 54 53.5 55 41.0 56 39.0 57 28.0 58 18.0 59 13.5 60 12.0 61 10.0 62 8.5 63 8.0 64 8.0 65 6.0 66 4.0 67 3.0 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.575 #Duplication Level Percentage of deduplicated Percentage of total 1 95.6055453832069 91.375 2 4.159037405179179 7.95 3 0.23541721161391577 0.675 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.325 0.0 0.0 0.0 0.0 112-113 0.36250000000000004 0.0 0.0 0.0 0.0 114-115 0.4625 0.0 0.0 0.0 0.0 116-117 0.5375000000000001 0.0 0.0 0.0 0.0 118-119 0.5625 0.0 0.0 0.0 0.0 120-121 0.6 0.0 0.0 0.0 0.0 122-123 0.6625000000000001 0.0 0.0 0.0 0.0 124-125 0.75 0.0 0.0 0.0 0.0 126-127 0.8 0.0 0.0 0.0 0.0 128-129 0.875 0.0 0.0 0.0 0.0 130-131 0.925 0.0 0.0 0.0 0.0 132-133 0.975 0.0 0.0 0.0 0.0 134-135 0.975 0.0 0.0 0.0 0.0 136-137 1.0375 0.0 0.0 0.0 0.0 138 1.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR22839645 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22839645_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.89375 32.0 32.0 32.0 32.0 32.0 2 31.7075 32.0 32.0 32.0 32.0 32.0 3 35.81625 37.0 37.0 37.0 32.0 37.0 4 35.95875 37.0 37.0 37.0 32.0 37.0 5 36.44375 37.0 37.0 37.0 37.0 37.0 6 40.10225 41.0 41.0 41.0 37.0 41.0 7 40.094 41.0 41.0 41.0 41.0 41.0 8 40.2445 41.0 41.0 41.0 41.0 41.0 9 40.2785 41.0 41.0 41.0 41.0 41.0 10-14 39.710249999999995 41.0 41.0 41.0 36.8 41.0 15-19 39.19785 41.0 41.0 41.0 35.0 41.0 20-24 37.56535 41.0 37.8 41.0 30.0 41.0 25-29 36.5812 41.0 36.0 41.0 25.0 41.0 30-34 36.70675 41.0 36.0 41.0 25.0 41.0 35-39 35.4856 40.2 34.0 41.0 22.0 41.0 40-44 35.78175 39.4 34.0 41.0 18.0 41.0 45-49 36.4946 41.0 36.0 41.0 24.0 41.0 50-54 36.0547 39.4 34.0 41.0 22.0 41.0 55-59 36.49805 40.2 36.0 41.0 25.0 41.0 60-64 37.7848 41.0 37.0 41.0 30.0 41.0 65-69 37.31425 41.0 36.8 41.0 27.0 41.0 70-74 36.403749999999995 40.2 36.0 41.0 22.0 41.0 75-79 33.9206 37.6 30.0 41.0 19.0 41.0 80-84 37.5555 41.0 36.8 41.0 28.0 41.0 85-89 37.549 41.0 37.6 41.0 29.0 41.0 90-94 36.89575000000001 41.0 37.0 41.0 26.0 41.0 95-99 38.71210000000001 41.0 39.4 41.0 33.0 41.0 100-104 35.93705 39.4 34.8 41.0 19.0 41.0 105-109 37.64555 41.0 37.0 41.0 29.0 41.0 110-114 36.0647 40.2 33.0 41.0 25.0 41.0 115-119 37.29995000000001 41.0 36.0 41.0 29.0 41.0 120-124 37.444050000000004 41.0 37.0 41.0 29.0 41.0 125-129 36.6291 40.2 36.0 41.0 25.0 41.0 130-134 37.306650000000005 41.0 36.0 41.0 30.0 41.0 135-139 35.64985 40.2 33.0 41.0 23.0 41.0 140-144 33.6214 38.4 29.0 41.0 19.0 41.0 145-149 33.2344 36.8 28.0 41.0 17.0 41.0 150 31.08425 37.0 22.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 8.0 16 6.0 17 4.0 18 3.0 19 3.0 20 9.0 21 10.0 22 9.0 23 25.0 24 23.0 25 23.0 26 28.0 27 35.0 28 64.0 29 59.0 30 63.0 31 90.0 32 123.0 33 174.0 34 217.0 35 286.0 36 313.0 37 416.0 38 616.0 39 770.0 40 623.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.404809619238478 14.879759519038076 22.49498997995992 35.22044088176352 2 19.7 24.9 37.075 18.325 3 20.549999999999997 26.525 27.400000000000002 25.525 4 23.225 32.275 21.375 23.125 5 23.025000000000002 35.775 23.45 17.75 6 17.775 37.7 24.65 19.875 7 17.7 19.175 41.65 21.475 8 18.15 23.724999999999998 30.049999999999997 28.075 9 20.849999999999998 22.75 32.2 24.2 10-14 20.294999999999998 29.849999999999998 27.794999999999998 22.06 15-19 21.715 27.79 28.515 21.98 20-24 21.61 28.455000000000002 27.834999999999997 22.1 25-29 21.23 28.565 28.110000000000003 22.095000000000002 30-34 21.085 28.410000000000004 28.4 22.105 35-39 21.89 28.415000000000003 27.900000000000002 21.795 40-44 21.505 28.34 28.299999999999997 21.855 45-49 20.8 28.465 28.325 22.41 50-54 20.87 28.65 28.044999999999998 22.435 55-59 21.16 27.994999999999997 28.08 22.765 60-64 21.44 28.355000000000004 27.49 22.715 65-69 21.404999999999998 28.615000000000002 27.51 22.470000000000002 70-74 21.605 27.884999999999998 28.205000000000002 22.305 75-79 21.47 28.199999999999996 28.235 22.095000000000002 80-84 21.32 28.425 27.765 22.49 85-89 21.565 27.884999999999998 28.134999999999998 22.415 90-94 21.435000000000002 27.73 28.599999999999998 22.235 95-99 22.08 27.905 27.805000000000003 22.21 100-104 21.89 27.855 28.015 22.24 105-109 21.27 27.689999999999998 28.285 22.755 110-114 21.884999999999998 28.749999999999996 27.37 21.995 115-119 21.72 28.34 27.694999999999997 22.245 120-124 22.02 27.49 27.845 22.645 125-129 21.665 28.115000000000002 27.83 22.39 130-134 22.14 27.994999999999997 28.07 21.795 135-139 22.535 26.919999999999998 28.125 22.42 140-144 22.38 27.939999999999998 27.595 22.085 145-149 22.38 27.595 28.615000000000002 21.41 150 22.075 27.725 27.400000000000002 22.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 2.0 25 2.5 26 3.0 27 7.0 28 9.0 29 15.5 30 21.5 31 27.0 32 39.0 33 50.5 34 61.0 35 76.5 36 93.5 37 108.0 38 138.0 39 194.5 40 215.5 41 224.0 42 263.5 43 276.5 44 266.0 45 253.5 46 245.5 47 248.0 48 224.0 49 192.0 50 166.0 51 134.5 52 116.0 53 80.0 54 53.0 55 50.0 56 38.0 57 21.5 58 18.5 59 18.5 60 10.0 61 6.5 62 6.5 63 3.0 64 3.0 65 3.5 66 2.0 67 2.0 68 1.0 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 1.5 75 1.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.175 #Duplication Level Percentage of deduplicated Percentage of total 1 96.20483493631401 92.525 2 3.6132050948791266 6.950000000000001 3 0.1819599688068625 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.3125 0.0 0.0 0.0 0.0 108-109 0.3625 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.5125 0.0 0.0 0.0 0.0 116-117 0.5874999999999999 0.0 0.0 0.0 0.0 118-119 0.6375 0.0 0.0 0.0 0.0 120-121 0.675 0.0 0.0 0.0 0.0 122-123 0.7375 0.0 0.0 0.0 0.0 124-125 0.825 0.0 0.0 0.0 0.0 126-127 0.875 0.0 0.0 0.0 0.0 128-129 0.95 0.0 0.0 0.0 0.0 130-131 1.0 0.0 0.0 0.0 0.0 132-133 1.0750000000000002 0.0 0.0 0.0 0.0 134-135 1.1 0.0 0.0 0.0 0.0 136-137 1.1749999999999998 0.0 0.0 0.0 0.0 138 1.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 670112 spots for SRR22839645.sra Written 670112 spots for SRR22839645.sra Read 670112 spots for SRR22839645.sra Written 670112 spots for SRR22839645.sra Read 670112 spots for SRR22839645.sra Written 670112 spots for SRR22839645.sra Read 670112 spots for SRR22839645.sra Written 670112 spots for SRR22839645.sra Read 670112 spots for SRR22839645.sra Written 670112 spots for SRR22839645.sra Read 670112 spots for SRR22839645.sra Written 670112 spots for SRR22839645.sra Read 670112 spots for SRR22839645.sra Written 670112 spots for SRR22839645.sra Read 670112 spots for SRR22839645.sra Written 670112 spots for SRR22839645.sra Read 670112 spots for SRR22839645.sra Written 670112 spots for SRR22839645.sra Read 670112 spots for SRR22839645.sra Written 670112 spots for SRR22839645.sra Read 670112 spots for SRR22839645.sra Written 670112 spots for SRR22839645.sra Read 670112 spots for SRR22839645.sra Written 670112 spots for SRR22839645.sra Read 670112 spots for SRR22839645.sra Written 670112 spots for SRR22839645.sra Read 670112 spots for SRR22839645.sra Written 670112 spots for SRR22839645.sra Read 670112 spots for SRR22839645.sra Written 670112 spots for SRR22839645.sra Read 670112 spots for SRR22839645.sra Written 670112 spots for SRR22839645.sra Read 670112 spots for SRR22839645.sra Written 670112 spots for SRR22839645.sra Read 670112 spots for SRR22839645.sra Written 670112 spots for SRR22839645.sra Read 670112 spots for SRR22839645.sra Written 670112 spots for SRR22839645.sra Read 670112 spots for SRR22839645.sra Written 670112 spots for SRR22839645.sra SRR ids: ['SRR22839645.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dwg2li1y SRR22839645.sra spots: 13402240 blocks: [[1, 670112], [670113, 1340224], [1340225, 2010336], [2010337, 2680448], [2680449, 3350560], [3350561, 4020672], [4020673, 4690784], [4690785, 5360896], [5360897, 6031008], [6031009, 6701120], [6701121, 7371232], [7371233, 8041344], [8041345, 8711456], [8711457, 9381568], [9381569, 10051680], [10051681, 10721792], [10721793, 11391904], [11391905, 12062016], [12062017, 12732128], [12732129, 13402240]] SRR22839645 file size 4506790 SRR22839645 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22839645 SRR22839645_1.fastq SRR22839645_2.fastq Input file: SRR22839645_1.fastq Paired file: SRR22839645_2.fastq trimmed: SRR22839645-trimmed-pair1.fastq, SRR22839645-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:52:50 2025 >> started Thu Feb 13 16:53:05 2025 >> done (14.869s) 13402240 read pairs processed; of these: 283 ( 0.00%) short read pairs filtered out after trimming by size control 3455 ( 0.03%) empty read pairs filtered out after trimming by size control 13398502 (99.97%) read pairs available; of these: 413500 ( 3.09%) trimmed read pairs available after processing 12985002 (96.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 20 0.00% 19 17 0.00% 20 16 0.00% 21 10 0.00% 22 17 0.00% 23 14 0.00% 24 19 0.00% 25 12 0.00% 26 12 0.00% 27 25 0.00% 28 18 0.00% 29 14 0.00% 30 20 0.00% 31 24 0.00% 32 28 0.00% 33 17 0.00% 34 23 0.00% 35 25 0.00% 36 19 0.00% 37 22 0.00% 38 21 0.00% 39 13 0.00% 40 27 0.00% 41 25 0.00% 42 25 0.00% 43 25 0.00% 44 29 0.00% 45 34 0.00% 46 25 0.00% 47 17 0.00% 48 38 0.00% 49 30 0.00% 50 28 0.00% 51 24 0.00% 52 35 0.00% 53 37 0.00% 54 40 0.00% 55 42 0.00% 56 41 0.00% 57 48 0.00% 58 47 0.00% 59 55 0.00% 60 50 0.00% 61 62 0.00% 62 79 0.00% 63 77 0.00% 64 93 0.00% 65 89 0.00% 66 85 0.00% 67 89 0.00% 68 99 0.00% 69 127 0.00% 70 125 0.00% 71 159 0.00% 72 204 0.00% 73 225 0.00% 74 212 0.00% 75 216 0.00% 76 204 0.00% 77 222 0.00% 78 254 0.00% 79 332 0.00% 80 347 0.00% 81 425 0.00% 82 507 0.00% 83 609 0.00% 84 580 0.00% 85 556 0.00% 86 555 0.00% 87 628 0.00% 88 596 0.00% 89 741 0.01% 90 770 0.01% 91 860 0.01% 92 1020 0.01% 93 1156 0.01% 94 1269 0.01% 95 1231 0.01% 96 1153 0.01% 97 1201 0.01% 98 1222 0.01% 99 1363 0.01% 100 1556 0.01% 101 1683 0.01% 102 1837 0.01% 103 2028 0.02% 104 2115 0.02% 105 2103 0.02% 106 2017 0.02% 107 2105 0.02% 108 2048 0.02% 109 2172 0.02% 110 2480 0.02% 111 2575 0.02% 112 2754 0.02% 113 3084 0.02% 114 3189 0.02% 115 3190 0.02% 116 3109 0.02% 117 3166 0.02% 118 3271 0.02% 119 3382 0.03% 120 3481 0.03% 121 3643 0.03% 122 3986 0.03% 123 4378 0.03% 124 4611 0.03% 125 4844 0.04% 126 4734 0.04% 127 4522 0.03% 128 4634 0.03% 129 4622 0.03% 130 4809 0.04% 131 5194 0.04% 132 5429 0.04% 133 5710 0.04% 134 6133 0.05% 135 6423 0.05% 136 6483 0.05% 137 6223 0.05% 138 6256 0.05% 139 6318 0.05% 140 6373 0.05% 141 6825 0.05% 142 7177 0.05% 143 7384 0.06% 144 8090 0.06% 145 8469 0.06% 146 8994 0.07% 147 10174 0.08% 148 17254 0.13% 149 159593 1.19% 150 12985002 96.91% 13398502 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.92 fanout-score-rank=38 prefix-density=0.16 prefix-fanout=2.7 sequence=CTCCACACTTGTA criterion=fanout-score sequence-density=0.08 sequence-density-rank=13 fanout-score=45.84 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=12.3 sequence=CACCACCACCATGGGCTCCCCAGCCACCATAGGTGTCAATAATGATCTTGCGTCCAGTGAGACCTGCATCACCATGAGGACCACCAATAACAAAACGGCCAGATGGGTTGAGGTGAAAGATAGTTTTCTCATCAAGGTACTTCTCCGGGATAACAGGCTTGATGACATACTCCTTTAGATCAGCGGCAATTTCATCATTTGTGACAGTCTCATCATGCTGAGTAGAGATGAGAACAGTGTGGACACGAACAGGGACCATTGCACCATTGTCATTGAAGTACTCAACAGTAACTTGAGTCTTGCCATCAGGTCTTAACCAAGGGCAGGTTCCATTCTTCCT criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.91 fanout-score-rank=36 prefix-density=0.16 prefix-fanout=2.7 sequence=CTCCACACTTGTA criterion=fanout-score sequence-density=0.07 sequence-density-rank=22 fanout-score=56.04 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=11.8 sequence=AAGATGAAGCAACAGTACTCAATCTCCTCCATTTCAGTTTTCCTTCTT SRR22839645 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:53:50 Started mapping on | Feb 13 16:53:50 Finished on | Feb 13 16:54:59 Mapping speed, Million of reads per hour | 699.05 Number of input reads | 13398502 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 12855032 Uniquely mapped reads % | 95.94% Average mapped length | 297.43 Number of splices: Total | 11501447 Number of splices: Annotated (sjdb) | 11226378 Number of splices: GT/AG | 11328338 Number of splices: GC/AG | 134819 Number of splices: AT/AC | 12338 Number of splices: Non-canonical | 25952 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.02% Deletion average length | 3.08 Insertion rate per base | 0.01% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 214763 % of reads mapped to multiple loci | 1.60% Number of reads mapped to too many loci | 43695 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.02% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 328707 328707 328707 N_multimapping 214763 214763 214763 N_noFeature 507125 6637065 6611020 N_ambiguous 186916 36435 36902 UnstrandedReadsAssigned:12160991 PositiveStrandReadsAssigned:6181532 NegativeStrandReadsAssigned:6207110 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR22839645 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22839645-trimmed-pair1.fastq SRR22839645-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,398,502 reads, 12,522,206 reads pseudoaligned [quant] estimated average fragment length: 291.468 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,081 rounds 52401 SRR22839645.ke.tsv 34699 SRR22839645.se.tsv 87100 total ==> SRR22839645.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1727.53 983 45.9327 Potri.005G024800.1.v4.1 1035 744.532 279 30.2493 Potri.004G059700.1.v4.1 961 670.559 25 3.00952 Potri.007G009000.2.v4.1 1416 1125.53 0 0 Potri.003G141000.2.v4.1 2943 2652.53 242.093 7.36743 Potri.016G087400.1.v4.1 270 56.3722 608 870.629 Potri.015G069301.1.v4.1 564 276.329 0 0 Potri.010G195200.1.v4.1 1773 1482.53 19 1.03453 Potri.012G127500.1.v4.1 977 686.554 468 55.0258 ==> SRR22839645.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2259 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 315 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 32 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR22839645 completed mapping pipeline successfully