Starting /dee2/code/volunteer_pipeline.sh SRR22839646 current disk space = 3088828841984 free memory = 1458036000 SRR22839646 SRAfilesize 320eb89f2c60de13411bc19ed5f362a2 SRR22839646.sra SRR22839646.sra file validated SRR22839646 is paired end SRR22839646 is conventional basespace SRR22839646 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22839646_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.72375 32.0 32.0 32.0 32.0 32.0 2 28.9575 32.0 32.0 32.0 12.0 32.0 3 33.00875 32.0 32.0 37.0 27.0 37.0 4 33.09375 37.0 32.0 37.0 27.0 37.0 5 33.4675 37.0 32.0 37.0 27.0 37.0 6 35.1395 37.0 32.0 41.0 27.0 41.0 7 36.1035 37.0 32.0 41.0 27.0 41.0 8 36.676 41.0 37.0 41.0 27.0 41.0 9 36.283 41.0 37.0 41.0 27.0 41.0 10-14 37.28935 40.2 35.0 41.0 29.0 41.0 15-19 38.77695 41.0 38.6 41.0 34.0 41.0 20-24 39.216449999999995 41.0 39.4 41.0 35.0 41.0 25-29 38.21015 41.0 37.8 41.0 32.0 41.0 30-34 39.562650000000005 41.0 41.0 41.0 37.0 41.0 35-39 39.33030000000001 41.0 39.4 41.0 35.0 41.0 40-44 38.62185 41.0 39.4 41.0 35.0 41.0 45-49 38.487649999999995 41.0 40.2 41.0 33.0 41.0 50-54 38.201100000000004 41.0 38.6 41.0 32.0 41.0 55-59 38.4062 41.0 38.6 41.0 33.0 41.0 60-64 38.101350000000004 41.0 38.6 41.0 32.0 41.0 65-69 37.051300000000005 41.0 37.8 41.0 27.0 41.0 70-74 37.0614 41.0 36.8 41.0 28.0 41.0 75-79 36.36995 40.2 35.0 41.0 26.0 41.0 80-84 36.301050000000004 41.0 34.0 41.0 25.0 41.0 85-89 36.79365 41.0 35.0 41.0 26.0 41.0 90-94 36.3201 41.0 34.0 41.0 24.0 41.0 95-99 36.401599999999995 40.2 35.0 41.0 26.0 41.0 100-104 35.75065 40.2 33.0 41.0 23.0 41.0 105-109 37.0359 41.0 35.0 41.0 27.0 41.0 110-114 36.67955 41.0 36.0 41.0 25.0 41.0 115-119 37.22045000000001 41.0 36.0 41.0 26.0 41.0 120-124 36.64105 40.2 35.8 41.0 25.0 41.0 125-129 36.3733 41.0 36.0 41.0 24.0 41.0 130-134 37.199600000000004 41.0 37.0 41.0 29.0 41.0 135-139 37.6392 41.0 37.0 41.0 29.0 41.0 140-144 36.196799999999996 40.2 35.0 41.0 26.0 41.0 145-149 34.1274 37.8 31.0 41.0 17.0 41.0 150 34.25125 37.0 32.0 41.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 2.0 22 2.0 23 0.0 24 5.0 25 7.0 26 22.0 27 21.0 28 36.0 29 57.0 30 82.0 31 93.0 32 131.0 33 158.0 34 227.0 35 312.0 36 366.0 37 500.0 38 566.0 39 773.0 40 639.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.55 14.975 21.525 36.95 2 20.95 24.349999999999998 35.025 19.675 3 21.25 27.400000000000002 28.575 22.775000000000002 4 23.9 33.0 21.425 21.675 5 24.45 36.175000000000004 22.525000000000002 16.85 6 17.575 39.125 24.15 19.15 7 15.925 20.549999999999997 42.825 20.7 8 18.875 23.200000000000003 30.475 27.450000000000003 9 20.375 22.95 32.574999999999996 24.099999999999998 10-14 20.235 30.935000000000002 27.425 21.404999999999998 15-19 20.585 29.18 28.46 21.775 20-24 20.945 28.605000000000004 28.28 22.17 25-29 20.925 28.694999999999997 28.000000000000004 22.38 30-34 20.89 28.455000000000002 28.425 22.23 35-39 21.185000000000002 28.475 27.975 22.365 40-44 21.43 29.145 27.71 21.715 45-49 20.544999999999998 28.58 28.375 22.5 50-54 21.37 28.560000000000002 27.900000000000002 22.17 55-59 20.735 28.199999999999996 28.689999999999998 22.375 60-64 21.215 28.249999999999996 28.1 22.435 65-69 21.44 28.845 27.775 21.94 70-74 21.425 28.685 27.965 21.925 75-79 21.675 28.365000000000002 27.72 22.24 80-84 21.740000000000002 28.99 27.51 21.759999999999998 85-89 21.97 28.37 27.445000000000004 22.215 90-94 21.36 28.585 28.775000000000002 21.279999999999998 95-99 22.0 28.560000000000002 27.465 21.975 100-104 21.97 28.585 27.27 22.175 105-109 21.57 29.385 27.295 21.75 110-114 21.275 28.455000000000002 27.834999999999997 22.435 115-119 21.875 28.865000000000002 28.16 21.099999999999998 120-124 22.16 27.725 27.815 22.3 125-129 21.9 28.48 27.639999999999997 21.98 130-134 21.584999999999997 28.29 27.98 22.145 135-139 22.17 28.42 27.47 21.94 140-144 21.82 29.7 26.83 21.65 145-149 22.125 27.775 27.705000000000002 22.395 150 22.900000000000002 28.1 27.150000000000002 21.85 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.5 22 2.5 23 1.5 24 2.0 25 4.5 26 10.0 27 9.0 28 6.5 29 12.0 30 22.5 31 31.0 32 35.5 33 53.5 34 68.5 35 78.0 36 99.0 37 129.0 38 165.0 39 197.5 40 224.5 41 252.5 42 257.5 43 263.0 44 263.0 45 266.0 46 255.5 47 220.5 48 211.0 49 191.0 50 147.5 51 109.5 52 92.0 53 67.5 54 54.5 55 45.0 56 25.5 57 26.0 58 23.0 59 9.5 60 10.0 61 13.5 62 9.0 63 7.0 64 7.5 65 6.5 66 4.0 67 1.0 68 0.0 69 1.5 70 2.0 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.62368972746332 91.225 2 3.9832285115303985 7.6 3 0.34067085953878407 0.975 4 0.052410901467505246 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.1875 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.36250000000000004 0.0 0.0 0.0 0.0 118-119 0.475 0.0 0.0 0.0 0.0 120-121 0.475 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.525 0.0 0.0 0.0 0.0 126-127 0.5375000000000001 0.0 0.0 0.0 0.0 128-129 0.6 0.0 0.0 0.0 0.0 130-131 0.6875 0.0 0.0 0.0 0.0 132-133 0.75 0.0 0.0 0.0 0.0 134-135 0.8625 0.0 0.0 0.0 0.0 136-137 0.9874999999999999 0.0 0.0 0.0 0.0 138 1.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACTGGT 10 0.006973645 144.0 4 ACTGGTG 10 0.006973645 144.0 5 >>END_MODULE SRR22839646 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22839646_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.69125 32.0 32.0 32.0 32.0 32.0 2 31.6625 32.0 32.0 32.0 32.0 32.0 3 35.625 37.0 37.0 37.0 32.0 37.0 4 35.66125 37.0 37.0 37.0 32.0 37.0 5 36.32 37.0 37.0 37.0 37.0 37.0 6 39.93425 41.0 41.0 41.0 37.0 41.0 7 39.93725 41.0 41.0 41.0 37.0 41.0 8 40.15 41.0 41.0 41.0 41.0 41.0 9 40.202 41.0 41.0 41.0 41.0 41.0 10-14 39.5378 41.0 40.2 41.0 36.8 41.0 15-19 38.97795 41.0 39.4 41.0 35.0 41.0 20-24 37.1679 41.0 37.8 41.0 27.0 41.0 25-29 36.05815 40.2 34.0 41.0 23.0 41.0 30-34 36.17550000000001 40.2 35.0 41.0 23.0 41.0 35-39 35.032000000000004 40.2 33.0 41.0 19.0 41.0 40-44 35.348 39.4 32.0 41.0 18.0 41.0 45-49 35.91495 41.0 35.0 41.0 23.0 41.0 50-54 35.7403 39.4 34.0 41.0 21.0 41.0 55-59 36.1333 40.2 35.0 41.0 24.0 41.0 60-64 37.47705 41.0 37.0 41.0 29.0 41.0 65-69 36.9714 40.2 35.8 41.0 26.0 41.0 70-74 35.89215 40.2 33.0 41.0 22.0 41.0 75-79 33.2786 36.6 29.0 41.0 19.0 41.0 80-84 37.27545 41.0 36.8 41.0 26.0 41.0 85-89 37.152550000000005 41.0 35.8 41.0 26.0 41.0 90-94 36.4122 41.0 35.0 41.0 24.0 41.0 95-99 38.542550000000006 41.0 37.8 41.0 33.0 41.0 100-104 35.581849999999996 39.4 34.8 41.0 19.0 41.0 105-109 37.39925 41.0 37.0 41.0 28.0 41.0 110-114 35.5127 39.4 33.0 41.0 23.0 41.0 115-119 37.0424 40.2 36.0 41.0 27.0 41.0 120-124 37.229150000000004 41.0 37.0 41.0 28.0 41.0 125-129 36.3076 40.2 35.0 41.0 25.0 41.0 130-134 36.8968 41.0 36.0 41.0 28.0 41.0 135-139 35.04795 40.2 33.0 41.0 22.0 41.0 140-144 32.94865 36.6 28.0 41.0 16.0 41.0 145-149 32.8271 36.8 28.0 41.0 17.0 41.0 150 30.486 37.0 22.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 10.0 16 7.0 17 10.0 18 6.0 19 6.0 20 7.0 21 8.0 22 13.0 23 8.0 24 23.0 25 24.0 26 24.0 27 46.0 28 53.0 29 65.0 30 110.0 31 124.0 32 133.0 33 194.0 34 225.0 35 301.0 36 368.0 37 512.0 38 569.0 39 664.0 40 489.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.281884239538964 15.585066399398647 23.101979453770983 36.03106990729141 2 18.65 23.150000000000002 38.725 19.475 3 21.075 26.450000000000003 28.275 24.2 4 23.7 31.900000000000002 21.85 22.55 5 22.875 36.025 23.575 17.525 6 16.825000000000003 38.35 25.4 19.425 7 16.675 18.575 42.55 22.2 8 19.275000000000002 21.75 31.55 27.425 9 20.8 22.575 31.15 25.474999999999998 10-14 20.560000000000002 30.275000000000002 27.815 21.349999999999998 15-19 21.345 28.475 28.585 21.595 20-24 20.84 29.445 27.915 21.8 25-29 21.115000000000002 29.625 27.29 21.97 30-34 20.89 29.299999999999997 28.065 21.745 35-39 21.2 29.020000000000003 28.24 21.54 40-44 21.365000000000002 28.994999999999997 27.98 21.66 45-49 21.154999999999998 28.33 28.405 22.11 50-54 21.55 29.29 27.495000000000005 21.665 55-59 21.02 28.560000000000002 27.82 22.6 60-64 21.560000000000002 28.34 28.235 21.865000000000002 65-69 21.005 27.985 28.27 22.74 70-74 21.95 28.67 27.389999999999997 21.990000000000002 75-79 21.84 28.349999999999998 28.26 21.55 80-84 21.490000000000002 28.43 27.644999999999996 22.435 85-89 21.62 28.439999999999998 27.93 22.009999999999998 90-94 21.13 28.625 28.360000000000003 21.884999999999998 95-99 21.695 28.33 27.400000000000002 22.575 100-104 22.32 28.134999999999998 28.044999999999998 21.5 105-109 22.065 28.360000000000003 27.77 21.805 110-114 22.045 28.439999999999998 27.755000000000003 21.759999999999998 115-119 21.215 28.57 28.24 21.975 120-124 21.315 28.005000000000003 28.189999999999998 22.49 125-129 21.759999999999998 28.685 27.43 22.125 130-134 22.509999999999998 27.67 28.075 21.745 135-139 21.89 28.025 28.43 21.654999999999998 140-144 21.490000000000002 28.38 28.095 22.035 145-149 21.615000000000002 28.735 27.845 21.805 150 21.825 29.125 27.250000000000004 21.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 2.0 21 3.5 22 2.5 23 1.5 24 3.5 25 6.5 26 9.5 27 11.0 28 15.0 29 17.0 30 20.5 31 31.5 32 39.5 33 50.5 34 70.5 35 81.5 36 95.0 37 129.0 38 156.5 39 173.5 40 209.0 41 227.5 42 242.5 43 277.5 44 293.5 45 268.0 46 247.0 47 240.5 48 211.5 49 178.0 50 144.5 51 116.5 52 93.5 53 78.0 54 63.5 55 50.5 56 32.0 57 21.5 58 20.5 59 12.5 60 8.0 61 5.5 62 6.0 63 4.0 64 3.0 65 3.0 66 2.5 67 5.0 68 4.5 69 2.5 70 2.0 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.775 #Duplication Level Percentage of deduplicated Percentage of total 1 95.90185330200993 91.85 2 3.8110154006786736 7.3 3 0.261028452101279 0.75 4 0.026102845210127904 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.07500000000000001 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.16249999999999998 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.36250000000000004 0.0 0.0 0.0 0.0 118-119 0.475 0.0 0.0 0.0 0.0 120-121 0.475 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.525 0.0 0.0 0.0 0.0 126-127 0.5625 0.0 0.0 0.0 0.0 128-129 0.625 0.0 0.0 0.0 0.0 130-131 0.7124999999999999 0.0 0.0 0.0 0.0 132-133 0.775 0.0 0.0 0.0 0.0 134-135 0.8875 0.0 0.0 0.0 0.0 136-137 1.0 0.0 0.0 0.0 0.0 138 1.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 745628 spots for SRR22839646.sra Written 745628 spots for SRR22839646.sra Read 745628 spots for SRR22839646.sra Written 745628 spots for SRR22839646.sra Read 745628 spots for SRR22839646.sra Written 745628 spots for SRR22839646.sra Read 745628 spots for SRR22839646.sra Written 745628 spots for SRR22839646.sra Read 745628 spots for SRR22839646.sra Written 745628 spots for SRR22839646.sra Read 745628 spots for SRR22839646.sra Written 745628 spots for SRR22839646.sra Read 745628 spots for SRR22839646.sra Written 745628 spots for SRR22839646.sra Read 745628 spots for SRR22839646.sra Written 745628 spots for SRR22839646.sra Read 745628 spots for SRR22839646.sra Written 745628 spots for SRR22839646.sra Read 745628 spots for SRR22839646.sra Written 745628 spots for SRR22839646.sra Read 745628 spots for SRR22839646.sra Written 745628 spots for SRR22839646.sra Read 745628 spots for SRR22839646.sra Written 745628 spots for SRR22839646.sra Read 745628 spots for SRR22839646.sra Written 745628 spots for SRR22839646.sra Read 745628 spots for SRR22839646.sra Written 745628 spots for SRR22839646.sra Read 745628 spots for SRR22839646.sra Written 745628 spots for SRR22839646.sra Read 745628 spots for SRR22839646.sra Written 745628 spots for SRR22839646.sra Read 745628 spots for SRR22839646.sra Written 745628 spots for SRR22839646.sra Read 745628 spots for SRR22839646.sra Written 745628 spots for SRR22839646.sra Read 745646 spots for SRR22839646.sra Written 745646 spots for SRR22839646.sra Read 745628 spots for SRR22839646.sra Written 745628 spots for SRR22839646.sra SRR ids: ['SRR22839646.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_okiqd8eu SRR22839646.sra spots: 14912578 blocks: [[1, 745628], [745629, 1491256], [1491257, 2236884], [2236885, 2982512], [2982513, 3728140], [3728141, 4473768], [4473769, 5219396], [5219397, 5965024], [5965025, 6710652], [6710653, 7456280], [7456281, 8201908], [8201909, 8947536], [8947537, 9693164], [9693165, 10438792], [10438793, 11184420], [11184421, 11930048], [11930049, 12675676], [12675677, 13421304], [13421305, 14166932], [14166933, 14912578]] SRR22839646 file size 5017119 SRR22839646 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22839646 SRR22839646_1.fastq SRR22839646_2.fastq Input file: SRR22839646_1.fastq Paired file: SRR22839646_2.fastq trimmed: SRR22839646-trimmed-pair1.fastq, SRR22839646-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:58:07 2025 >> started Thu Feb 13 16:58:24 2025 >> done (16.604s) 14912578 read pairs processed; of these: 151 ( 0.00%) short read pairs filtered out after trimming by size control 1106 ( 0.01%) empty read pairs filtered out after trimming by size control 14911321 (99.99%) read pairs available; of these: 405854 ( 2.72%) trimmed read pairs available after processing 14505467 (97.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 7 0.00% 20 11 0.00% 21 11 0.00% 22 9 0.00% 23 22 0.00% 24 24 0.00% 25 13 0.00% 26 11 0.00% 27 20 0.00% 28 8 0.00% 29 11 0.00% 30 18 0.00% 31 16 0.00% 32 22 0.00% 33 20 0.00% 34 28 0.00% 35 27 0.00% 36 35 0.00% 37 22 0.00% 38 33 0.00% 39 36 0.00% 40 38 0.00% 41 31 0.00% 42 33 0.00% 43 25 0.00% 44 22 0.00% 45 33 0.00% 46 47 0.00% 47 40 0.00% 48 40 0.00% 49 48 0.00% 50 37 0.00% 51 53 0.00% 52 37 0.00% 53 32 0.00% 54 47 0.00% 55 41 0.00% 56 40 0.00% 57 58 0.00% 58 44 0.00% 59 49 0.00% 60 77 0.00% 61 84 0.00% 62 70 0.00% 63 80 0.00% 64 77 0.00% 65 88 0.00% 66 84 0.00% 67 77 0.00% 68 101 0.00% 69 129 0.00% 70 153 0.00% 71 173 0.00% 72 195 0.00% 73 201 0.00% 74 234 0.00% 75 203 0.00% 76 185 0.00% 77 235 0.00% 78 228 0.00% 79 278 0.00% 80 346 0.00% 81 413 0.00% 82 423 0.00% 83 488 0.00% 84 492 0.00% 85 515 0.00% 86 468 0.00% 87 468 0.00% 88 573 0.00% 89 594 0.00% 90 694 0.00% 91 795 0.01% 92 982 0.01% 93 1039 0.01% 94 1174 0.01% 95 1140 0.01% 96 1015 0.01% 97 1155 0.01% 98 1131 0.01% 99 1165 0.01% 100 1275 0.01% 101 1419 0.01% 102 1603 0.01% 103 1839 0.01% 104 1793 0.01% 105 1942 0.01% 106 1849 0.01% 107 1821 0.01% 108 1840 0.01% 109 2007 0.01% 110 2135 0.01% 111 2269 0.02% 112 2434 0.02% 113 2771 0.02% 114 2988 0.02% 115 2978 0.02% 116 2904 0.02% 117 2824 0.02% 118 2758 0.02% 119 3007 0.02% 120 2998 0.02% 121 3208 0.02% 122 3507 0.02% 123 3795 0.03% 124 4161 0.03% 125 3955 0.03% 126 4182 0.03% 127 3846 0.03% 128 4033 0.03% 129 3899 0.03% 130 4138 0.03% 131 4320 0.03% 132 4743 0.03% 133 5123 0.03% 134 5375 0.04% 135 5653 0.04% 136 5527 0.04% 137 5355 0.04% 138 5359 0.04% 139 5340 0.04% 140 5525 0.04% 141 5826 0.04% 142 6084 0.04% 143 6729 0.05% 144 7041 0.05% 145 7596 0.05% 146 7660 0.05% 147 9371 0.06% 148 17672 0.12% 149 180145 1.21% 150 14505467 97.28% 14911321 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=39 prefix-density=0.18 prefix-fanout=2.5 sequence=CTCCACACTTGTA criterion=fanout-score sequence-density=0.06 sequence-density-rank=20 fanout-score=147.62 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=19.4 sequence=GCAGCAGCAGCAA criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.89 fanout-score-rank=38 prefix-density=0.18 prefix-fanout=2.7 sequence=CTCCACACTTGTA criterion=fanout-score sequence-density=0.06 sequence-density-rank=14 fanout-score=138.32 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=19.2 sequence=GCAGCAGCAGCAA SRR22839646 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:59:06 Started mapping on | Feb 13 16:59:06 Finished on | Feb 13 17:00:27 Mapping speed, Million of reads per hour | 662.73 Number of input reads | 14911321 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 14223438 Uniquely mapped reads % | 95.39% Average mapped length | 297.57 Number of splices: Total | 13097902 Number of splices: Annotated (sjdb) | 12769082 Number of splices: GT/AG | 12893245 Number of splices: GC/AG | 161449 Number of splices: AT/AC | 13731 Number of splices: Non-canonical | 29477 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.02% Deletion average length | 3.32 Insertion rate per base | 0.01% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 259853 % of reads mapped to multiple loci | 1.74% Number of reads mapped to too many loci | 70435 % of reads mapped to too many loci | 0.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.24% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 428030 428030 428030 N_multimapping 259853 259853 259853 N_noFeature 629824 7397787 7341075 N_ambiguous 196698 41214 41582 UnstrandedReadsAssigned:13396916 PositiveStrandReadsAssigned:6784437 NegativeStrandReadsAssigned:6840781 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR22839646 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22839646-trimmed-pair1.fastq SRR22839646-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,911,321 reads, 13,837,954 reads pseudoaligned [quant] estimated average fragment length: 297.042 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,118 rounds 52401 SRR22839646.ke.tsv 34699 SRR22839646.se.tsv 87100 total ==> SRR22839646.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1721.96 1505 62.1828 Potri.005G024800.1.v4.1 1035 738.958 601 57.8644 Potri.004G059700.1.v4.1 961 664.969 36 3.85174 Potri.007G009000.2.v4.1 1416 1119.96 0 0 Potri.003G141000.2.v4.1 2943 2646.96 389.131 10.4594 Potri.016G087400.1.v4.1 270 53.8786 757 999.622 Potri.015G069301.1.v4.1 564 269.819 0 0 Potri.010G195200.1.v4.1 1773 1476.96 27 1.30063 Potri.012G127500.1.v4.1 977 680.964 2308 241.139 ==> SRR22839646.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1810 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 370 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 38 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR22839646 completed mapping pipeline successfully