Starting /dee2/code/volunteer_pipeline.sh SRR22905632 current disk space = 3088644333568 free memory = 1473903384 SRR22905632 SRAfilesize eaf37421288f940516dc237c35ddea2a SRR22905632.sra SRR22905632.sra file validated SRR22905632 is paired end SRR22905632 is conventional basespace SRR22905632 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22905632_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.99175 37.0 36.0 37.0 34.0 38.0 2 35.44425 37.0 36.0 37.0 33.0 38.0 3 36.18475 37.0 36.0 37.0 35.0 38.0 4 35.821 37.0 36.0 37.0 34.0 38.0 5 36.10275 37.0 36.0 37.0 35.0 38.0 6 35.99475 37.0 36.0 37.0 35.0 38.0 7 36.11025 37.0 36.0 37.0 35.0 38.0 8 35.8545 37.0 36.0 37.0 34.0 38.0 9 36.009 37.0 36.0 37.0 35.0 38.0 10-14 35.98505 37.0 36.0 37.0 34.6 38.0 15-19 35.91709999999999 37.0 36.0 37.0 34.4 38.0 20-24 35.9503 37.0 36.0 37.0 34.4 38.0 25-29 35.9088 37.0 36.0 37.0 34.4 38.0 30-34 35.960899999999995 37.0 36.0 37.0 34.4 38.0 35-39 35.952600000000004 37.0 36.0 37.0 34.8 38.0 40-44 35.740050000000004 37.0 36.0 37.0 34.0 38.0 45-49 35.850350000000006 37.0 36.0 37.0 34.0 38.0 50-54 35.77655 37.0 36.0 37.0 34.4 38.0 55-59 35.83535 37.0 36.0 37.0 34.2 38.0 60-64 35.65105 37.0 36.0 37.0 33.6 38.0 65-69 35.63055 37.0 36.0 37.0 33.4 38.0 70-74 35.658100000000005 37.0 36.0 37.0 33.6 38.0 75-79 35.67465 37.0 36.0 37.0 33.6 38.0 80-84 35.5086 37.0 36.0 37.0 33.4 38.0 85-89 35.4343 37.0 36.0 37.0 32.8 38.0 90-94 35.47595 37.0 36.0 37.0 33.0 38.0 95-99 35.33305 37.0 36.0 37.0 32.4 38.0 100-104 35.216249999999995 37.0 36.0 37.0 32.0 38.0 105-109 35.2295 37.0 36.0 37.0 32.2 38.0 110-114 35.0272 37.0 36.0 37.0 31.0 38.0 115-119 35.047799999999995 37.0 35.8 37.0 31.2 38.0 120-124 35.08345 37.0 35.8 37.0 31.6 38.0 125-129 34.961349999999996 37.0 35.8 37.0 30.6 38.0 130-134 34.7006 37.0 35.0 37.0 29.6 38.0 135-139 34.734449999999995 37.0 35.2 37.0 29.6 38.0 140-144 34.71635 37.0 35.0 37.0 29.6 38.0 145-149 34.5099 37.0 35.0 37.0 28.6 38.0 150 34.02375 37.0 35.0 37.0 26.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 6.0 28 34.0 29 63.0 30 94.0 31 100.0 32 179.0 33 224.0 34 351.0 35 776.0 36 1580.0 37 593.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.875 16.75 11.125 38.25 2 18.975 22.650000000000002 45.275 13.100000000000001 3 14.6 27.175 33.175 25.05 4 19.675 35.825 27.05 17.45 5 19.825 36.725 26.450000000000003 17.0 6 15.875 34.65 29.65 19.825 7 14.399999999999999 15.45 47.125 23.025000000000002 8 18.475 22.075 30.525000000000002 28.925 9 20.150000000000002 22.3 30.4 27.150000000000002 10-14 21.18 28.849999999999998 27.915 22.055 15-19 20.919999999999998 28.199999999999996 28.910000000000004 21.97 20-24 21.2 28.1 28.53 22.17 25-29 22.02 28.810000000000002 28.275 20.895 30-34 21.22 28.48 28.055000000000003 22.245 35-39 21.015 28.715000000000003 28.634999999999998 21.634999999999998 40-44 21.375 28.694999999999997 28.68 21.25 45-49 22.16 29.054999999999996 27.325 21.46 50-54 20.995 29.235 28.335 21.435000000000002 55-59 22.16 28.625 27.77 21.445 60-64 21.525 28.43 27.855 22.189999999999998 65-69 22.145 28.244999999999997 27.845 21.765 70-74 22.009999999999998 28.955 27.529999999999998 21.505 75-79 21.495 28.17 28.275 22.06 80-84 21.975 28.610000000000003 27.715 21.7 85-89 21.8 28.53 27.67 22.0 90-94 22.42 28.48 27.685 21.415 95-99 22.13 28.515 27.805000000000003 21.55 100-104 22.335 28.194999999999997 27.905 21.565 105-109 22.264999999999997 28.305000000000003 27.755000000000003 21.675 110-114 21.905 28.544999999999998 28.044999999999998 21.505 115-119 22.770000000000003 28.54 27.625 21.065 120-124 22.185 27.815 27.915 22.085 125-129 22.58 27.565 28.37 21.485000000000003 130-134 22.715 27.744999999999997 28.144999999999996 21.395 135-139 22.53 28.175 27.42 21.875 140-144 22.66 27.565 27.815 21.959999999999997 145-149 22.82 27.805000000000003 28.13 21.245 150 22.45 27.474999999999998 27.175 22.900000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 1.0 15 1.5 16 0.5 17 0.0 18 1.0 19 1.0 20 1.5 21 1.5 22 1.5 23 3.5 24 5.5 25 10.0 26 8.5 27 6.0 28 12.5 29 20.5 30 27.5 31 42.0 32 55.5 33 63.5 34 76.5 35 86.0 36 101.5 37 117.5 38 138.5 39 168.0 40 193.0 41 219.0 42 228.5 43 244.5 44 269.5 45 263.5 46 242.5 47 241.0 48 227.5 49 196.0 50 169.5 51 127.0 52 98.0 53 80.0 54 58.0 55 44.0 56 32.0 57 25.5 58 19.5 59 15.5 60 13.5 61 11.0 62 9.5 63 5.0 64 1.5 65 2.5 66 3.0 67 2.0 68 1.5 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24433249370277 98.5 2 0.7556675062972292 1.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.025 0.0 9 0.0 0.0 0.0 0.025 0.0 10-11 0.0 0.0 0.0 0.025 0.0 12-13 0.0 0.0 0.0 0.025 0.0 14-15 0.0 0.0 0.0 0.025 0.0 16-17 0.0 0.0 0.0 0.025 0.0 18-19 0.0 0.0 0.0 0.025 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.0 0.0 0.0 0.025 0.0 84-85 0.0 0.0 0.0 0.025 0.0 86-87 0.0 0.0 0.0 0.025 0.0 88-89 0.0 0.0 0.0 0.025 0.0 90-91 0.0 0.0 0.0 0.025 0.0 92-93 0.0 0.0 0.0 0.025 0.0 94-95 0.0 0.0 0.0 0.025 0.0 96-97 0.0 0.0 0.0 0.025 0.0 98-99 0.0 0.0 0.0 0.025 0.0 100-101 0.0 0.0 0.0 0.025 0.0 102-103 0.0 0.0 0.0 0.025 0.0 104-105 0.0 0.0 0.0 0.025 0.0 106-107 0.0 0.0 0.0 0.025 0.0 108-109 0.0 0.0 0.0 0.025 0.0 110-111 0.0 0.0 0.0 0.025 0.0 112-113 0.0 0.0 0.0 0.025 0.0 114-115 0.0 0.0 0.0 0.025 0.0 116-117 0.0 0.0 0.0 0.025 0.0 118-119 0.0 0.0 0.0 0.025 0.0 120-121 0.0 0.0 0.0 0.025 0.0 122-123 0.0 0.0 0.0 0.025 0.0 124-125 0.0 0.0 0.0 0.025 0.0 126-127 0.0 0.0 0.0 0.025 0.0 128-129 0.0 0.0 0.0 0.025 0.0 130-131 0.0 0.0 0.0 0.025 0.0 132-133 0.0 0.0 0.0 0.025 0.0 134-135 0.0 0.0 0.0 0.025 0.0 136-137 0.0 0.0 0.0 0.025 0.0 138 0.0 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR22905632 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22905632_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.66225 37.0 36.0 37.0 34.0 38.0 2 35.17625 37.0 36.0 37.0 32.0 38.0 3 36.078 37.0 36.0 37.0 35.0 38.0 4 36.0605 37.0 36.0 37.0 35.0 38.0 5 35.49525 37.0 36.0 37.0 33.0 38.0 6 35.581 37.0 36.0 37.0 34.0 38.0 7 35.4445 37.0 36.0 37.0 33.0 38.0 8 35.56725 37.0 36.0 37.0 34.0 38.0 9 35.9715 37.0 36.0 37.0 34.0 38.0 10-14 35.8102 37.0 36.0 37.0 34.2 38.0 15-19 35.7137 37.0 36.0 37.0 33.4 38.0 20-24 35.609249999999996 37.0 36.0 37.0 33.2 38.0 25-29 35.7122 37.0 36.0 37.0 33.4 38.0 30-34 35.4582 37.0 36.0 37.0 32.8 38.0 35-39 35.52395 37.0 36.0 37.0 33.0 38.0 40-44 35.35244999999999 37.0 36.0 37.0 32.6 38.0 45-49 35.65705 37.0 36.0 37.0 33.8 38.0 50-54 35.4024 37.0 36.0 37.0 32.6 38.0 55-59 35.139149999999994 37.0 35.8 37.0 31.4 38.0 60-64 35.3187 37.0 36.0 37.0 32.4 38.0 65-69 35.182249999999996 37.0 35.6 37.0 31.6 38.0 70-74 35.0418 37.0 35.6 37.0 31.4 38.0 75-79 34.9488 37.0 35.4 37.0 31.0 38.0 80-84 35.06505000000001 37.0 35.8 37.0 31.4 38.0 85-89 34.824600000000004 37.0 35.0 37.0 30.2 38.0 90-94 34.6259 37.0 35.0 37.0 29.6 38.0 95-99 34.496500000000005 37.0 35.0 37.0 28.6 38.0 100-104 34.59655 37.0 35.0 37.0 29.4 38.0 105-109 34.263400000000004 37.0 35.0 37.0 27.8 37.8 110-114 34.135949999999994 37.0 35.0 37.0 27.0 37.8 115-119 33.9177 36.8 34.6 37.0 25.6 37.4 120-124 33.8975 36.8 34.8 37.0 26.0 38.0 125-129 33.49055 36.2 34.2 37.0 23.8 37.4 130-134 33.582800000000006 36.2 34.2 37.0 24.6 37.4 135-139 33.477 36.2 34.2 37.0 23.8 37.4 140-144 33.04785 36.0 33.6 37.0 22.2 37.2 145-149 33.06845 36.0 33.6 37.0 21.6 37.4 150 32.978 36.0 33.0 37.0 22.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 3.0 27 17.0 28 61.0 29 107.0 30 152.0 31 200.0 32 252.0 33 363.0 34 557.0 35 785.0 36 1086.0 37 417.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.95 17.05 11.225 39.775 2 17.375 25.25 44.800000000000004 12.575 3 15.525 27.0 31.900000000000002 25.575 4 19.75 37.75 26.200000000000003 16.3 5 19.3 36.825 27.125 16.75 6 15.4 34.875 29.925 19.8 7 14.45 15.25 47.075 23.225 8 18.95 21.7 28.199999999999996 31.15 9 19.825 22.5 30.75 26.924999999999997 10-14 20.335 28.645 28.000000000000004 23.02 15-19 20.875 28.235 28.77 22.12 20-24 20.965 28.939999999999998 27.24 22.855 25-29 20.919999999999998 28.754999999999995 28.475 21.85 30-34 21.075 28.74 28.1 22.085 35-39 20.580000000000002 28.910000000000004 28.139999999999997 22.37 40-44 21.709999999999997 28.895 27.400000000000002 21.995 45-49 21.05 29.04 27.71 22.2 50-54 21.125 28.939999999999998 27.889999999999997 22.045 55-59 21.45 28.26 27.834999999999997 22.455 60-64 21.740000000000002 28.64 27.689999999999998 21.93 65-69 21.425 28.415000000000003 27.985 22.175 70-74 20.905 28.439999999999998 28.075 22.58 75-79 20.986049302465123 28.54142707135357 27.806390319515977 22.666133306665333 80-84 21.525 27.91 27.85 22.715 85-89 22.0 28.105000000000004 27.785 22.11 90-94 21.886094304715236 27.91139556977849 27.60138006900345 22.601130056502825 95-99 21.68608430421521 28.22641132056603 27.92139606980349 22.16610830541527 100-104 21.34 27.735 28.299999999999997 22.625 105-109 21.416070803540176 28.366418320916047 27.9813990699535 22.23611180559028 110-114 21.745 27.92 27.76 22.575 115-119 21.990000000000002 27.615000000000002 27.855 22.54 120-124 22.13 27.565 27.884999999999998 22.42 125-129 22.075 27.88 27.755000000000003 22.29 130-134 21.915000000000003 27.975 28.03 22.08 135-139 21.65 28.175 27.515 22.66 140-144 22.352235223522353 27.73777377737774 27.96279627962796 21.947194719471945 145-149 21.881094054702736 27.78138906945347 27.991399569978498 22.34611730586529 150 22.3 27.275 27.275 23.150000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.5 23 2.0 24 6.0 25 9.0 26 7.0 27 7.0 28 17.5 29 23.5 30 27.0 31 36.0 32 46.5 33 52.0 34 60.5 35 79.5 36 91.5 37 116.0 38 148.0 39 166.0 40 191.5 41 218.5 42 242.0 43 258.5 44 276.0 45 286.5 46 266.0 47 231.0 48 199.5 49 177.5 50 165.5 51 143.0 52 111.0 53 85.5 54 63.5 55 45.5 56 32.0 57 27.5 58 16.5 59 8.0 60 12.5 61 11.5 62 7.0 63 5.0 64 4.0 65 4.5 66 3.5 67 3.0 68 1.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.0 85-89 0.0 90-94 0.005 95-99 0.005 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.01 145-149 0.005 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32041278630757 98.65 2 0.6795872136924239 1.35 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.025 0.0 0.0 0.0 138 0.0 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1755320 spots for SRR22905632.sra Written 1755320 spots for SRR22905632.sra Read 1755320 spots for SRR22905632.sra Written 1755320 spots for SRR22905632.sra Read 1755320 spots for SRR22905632.sra Written 1755320 spots for SRR22905632.sra Read 1755320 spots for SRR22905632.sra Written 1755320 spots for SRR22905632.sra Read 1755320 spots for SRR22905632.sra Written 1755320 spots for SRR22905632.sra Read 1755320 spots for SRR22905632.sra Written 1755320 spots for SRR22905632.sra Read 1755320 spots for SRR22905632.sra Written 1755320 spots for SRR22905632.sra Read 1755333 spots for SRR22905632.sra Written 1755333 spots for SRR22905632.sra Read 1755320 spots for SRR22905632.sra Written 1755320 spots for SRR22905632.sra Read 1755320 spots for SRR22905632.sra Written 1755320 spots for SRR22905632.sra Read 1755320 spots for SRR22905632.sra Written 1755320 spots for SRR22905632.sra Read 1755320 spots for SRR22905632.sra Written 1755320 spots for SRR22905632.sra Read 1755320 spots for SRR22905632.sra Written 1755320 spots for SRR22905632.sra Read 1755320 spots for SRR22905632.sra Written 1755320 spots for SRR22905632.sra Read 1755320 spots for SRR22905632.sra Written 1755320 spots for SRR22905632.sra Read 1755320 spots for SRR22905632.sra Written 1755320 spots for SRR22905632.sra Read 1755320 spots for SRR22905632.sra Written 1755320 spots for SRR22905632.sra Read 1755320 spots for SRR22905632.sra Written 1755320 spots for SRR22905632.sra Read 1755320 spots for SRR22905632.sra Written 1755320 spots for SRR22905632.sra Read 1755320 spots for SRR22905632.sra Written 1755320 spots for SRR22905632.sra SRR ids: ['SRR22905632.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4fgcqp4f SRR22905632.sra spots: 35106413 blocks: [[1, 1755320], [1755321, 3510640], [3510641, 5265960], [5265961, 7021280], [7021281, 8776600], [8776601, 10531920], [10531921, 12287240], [12287241, 14042560], [14042561, 15797880], [15797881, 17553200], [17553201, 19308520], [19308521, 21063840], [21063841, 22819160], [22819161, 24574480], [24574481, 26329800], [26329801, 28085120], [28085121, 29840440], [29840441, 31595760], [31595761, 33351080], [33351081, 35106413]] SRR22905632 file size 12502666 SRR22905632 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22905632 SRR22905632_1.fastq SRR22905632_2.fastq Input file: SRR22905632_1.fastq Paired file: SRR22905632_2.fastq trimmed: SRR22905632-trimmed-pair1.fastq, SRR22905632-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:41:50 2025 >> started Thu Feb 13 17:42:28 2025 >> done (38.167s) 35092022 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 35092022 (100.00%) read pairs available; of these: 1917280 ( 5.46%) trimmed read pairs available after processing 33174742 (94.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 140 2 0.00% 141 3 0.00% 142 44 0.00% 143 31 0.00% 144 28 0.00% 145 32 0.00% 146 23 0.00% 147 319 0.00% 148 16685 0.05% 149 1900113 5.41% 150 33174742 94.54% 35092022 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.53 fanout-score-rank=26 prefix-density=0.32 prefix-fanout=2.3 sequence=TGGCTCCTTGTGCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=20 fanout-score=74.75 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=18.8 sequence=TCATCTTCAACAA criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=57.21 fanout-score-rank=2 prefix-density=0.50 prefix-fanout=26.6 sequence=AAGTCGGATCGTAGCCATG criterion=fanout-score sequence-density=0.03 sequence-density-rank=39 fanout-score=150.09 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=15.2 sequence=TGGTGCTGGTGTAGTGAAGGGTCTCCAAGGAAGCCACAACTACGAGCTTCAGGGTGGCGGAGCTAATGTTGTGAATCATGGATACACCAAGGGTGATGGCCTTGGTGCGGAGATAGTCGGTACCTTTGTTCTTGTCTACACTGTCTTCTCTGC SRR22905632 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:43:12 Started mapping on | Feb 13 17:43:12 Finished on | Feb 13 17:46:12 Mapping speed, Million of reads per hour | 701.84 Number of input reads | 35092022 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 33769914 Uniquely mapped reads % | 96.23% Average mapped length | 298.18 Number of splices: Total | 27338892 Number of splices: Annotated (sjdb) | 26707271 Number of splices: GT/AG | 26917641 Number of splices: GC/AG | 317556 Number of splices: AT/AC | 29564 Number of splices: Non-canonical | 74131 Mismatch rate per base, % | 0.57% Deletion rate per base | 0.02% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 1.90 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 677091 % of reads mapped to multiple loci | 1.93% Number of reads mapped to too many loci | 1798 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.82% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 645017 645017 645017 N_multimapping 677091 677091 677091 N_noFeature 1370970 16971998 17852261 N_ambiguous 509633 100620 93936 UnstrandedReadsAssigned:31889311 PositiveStrandReadsAssigned:16697296 NegativeStrandReadsAssigned:15823717 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR22905632 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22905632-trimmed-pair1.fastq SRR22905632-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,092,022 reads, 32,673,644 reads pseudoaligned [quant] estimated average fragment length: 254.678 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,131 rounds 52401 SRR22905632.ke.tsv 34699 SRR22905632.se.tsv 87100 total ==> SRR22905632.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1764.32 5146 86.5596 Potri.005G024800.1.v4.1 1035 781.322 4590 174.344 Potri.004G059700.1.v4.1 961 707.332 66 2.76913 Potri.007G009000.2.v4.1 1416 1162.32 0 0 Potri.003G141000.2.v4.1 2943 2689.32 940.742 10.3813 Potri.016G087400.1.v4.1 270 62.1679 1118.56 533.968 Potri.015G069301.1.v4.1 564 311.257 0 0 Potri.010G195200.1.v4.1 1773 1519.32 34 0.664129 Potri.012G127500.1.v4.1 977 723.332 799 32.7818 ==> SRR22905632.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2334 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 1312 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 165 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR22905632 completed mapping pipeline successfully