Starting /dee2/code/volunteer_pipeline.sh SRR22905633 current disk space = 3088669065216 free memory = 1451951324 SRR22905633 SRAfilesize 0569f29332becf4e8b8c30246f1a3735 SRR22905633.sra SRR22905633.sra file validated SRR22905633 is paired end SRR22905633 is conventional basespace SRR22905633 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22905633_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.004 37.0 36.0 37.0 34.0 38.0 2 35.36475 37.0 36.0 37.0 33.0 38.0 3 36.23125 37.0 36.0 37.0 35.0 38.0 4 36.0075 37.0 36.0 37.0 34.0 38.0 5 36.2655 37.0 36.0 37.0 35.0 38.0 6 35.86675 37.0 36.0 37.0 34.0 38.0 7 36.0655 37.0 36.0 37.0 35.0 38.0 8 36.05725 37.0 36.0 37.0 35.0 38.0 9 36.09225 37.0 36.0 37.0 34.0 38.0 10-14 36.07405 37.0 36.0 37.0 34.6 38.0 15-19 35.93455 37.0 36.0 37.0 34.4 38.0 20-24 35.953900000000004 37.0 36.0 37.0 34.4 38.0 25-29 35.9427 37.0 36.0 37.0 34.2 38.0 30-34 35.98605 37.0 36.0 37.0 34.4 38.0 35-39 35.96205 37.0 36.0 37.0 34.2 38.0 40-44 35.830349999999996 37.0 36.0 37.0 34.0 38.0 45-49 35.918549999999996 37.0 36.0 37.0 34.4 38.0 50-54 35.76975 37.0 36.0 37.0 33.8 38.0 55-59 35.891949999999994 37.0 36.0 37.0 34.0 38.0 60-64 35.70955 37.0 36.0 37.0 33.6 38.0 65-69 35.705799999999996 37.0 36.0 37.0 33.6 38.0 70-74 35.7388 37.0 36.0 37.0 33.6 38.0 75-79 35.663650000000004 37.0 36.0 37.0 33.8 38.0 80-84 35.4822 37.0 36.0 37.0 32.6 38.0 85-89 35.479499999999994 37.0 36.0 37.0 32.8 38.0 90-94 35.510949999999994 37.0 36.0 37.0 32.6 38.0 95-99 35.3806 37.0 36.0 37.0 32.2 38.0 100-104 35.22135 37.0 36.0 37.0 31.4 38.0 105-109 35.230549999999994 37.0 36.0 37.0 31.8 38.0 110-114 35.1027 37.0 36.0 37.0 31.2 38.0 115-119 34.922900000000006 37.0 35.8 37.0 30.6 38.0 120-124 35.0229 37.0 35.8 37.0 30.6 38.0 125-129 34.826350000000005 37.0 35.8 37.0 30.0 38.0 130-134 34.610499999999995 37.0 35.0 37.0 28.8 38.0 135-139 34.701 37.0 35.0 37.0 29.0 38.0 140-144 34.5367 37.0 35.0 37.0 28.6 38.0 145-149 34.307050000000004 37.0 35.0 37.0 27.4 38.0 150 33.9345 37.0 35.0 37.0 26.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 4.0 28 24.0 29 73.0 30 85.0 31 140.0 32 164.0 33 239.0 34 391.0 35 734.0 36 1405.0 37 741.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.375 17.025000000000002 9.8 38.800000000000004 2 16.27906976744186 23.280820205051263 47.53688422105527 12.903225806451612 3 14.299999999999999 26.375 34.675 24.65 4 18.425 37.2 28.025 16.35 5 19.225 34.5 29.45 16.825000000000003 6 14.649999999999999 35.325 30.65 19.375 7 13.975000000000001 15.65 46.775 23.599999999999998 8 17.875 22.275 29.299999999999997 30.55 9 19.950000000000003 22.625 30.5 26.924999999999997 10-14 21.095 28.63 27.634999999999998 22.64 15-19 21.435000000000002 28.26 28.625 21.68 20-24 21.235 28.799999999999997 28.185 21.78 25-29 21.005 28.17 28.875 21.95 30-34 21.705 27.715 28.79 21.790000000000003 35-39 21.92 28.37 27.705000000000002 22.005 40-44 21.935 29.04 27.57 21.455 45-49 21.404999999999998 28.775000000000002 28.15 21.67 50-54 21.735 29.354999999999997 27.224999999999998 21.685 55-59 21.39 28.465 28.360000000000003 21.785 60-64 21.87 28.03 28.315 21.785 65-69 22.115000000000002 28.51 27.589999999999996 21.785 70-74 21.560000000000002 28.705000000000002 28.194999999999997 21.54 75-79 21.32 29.015 27.794999999999998 21.87 80-84 22.155 28.999999999999996 27.310000000000002 21.535 85-89 21.915000000000003 28.194999999999997 28.025 21.865000000000002 90-94 21.455 28.835 27.805000000000003 21.905 95-99 22.03 28.315 27.79 21.865000000000002 100-104 22.175 28.17 28.58 21.075 105-109 21.975 28.54 28.215 21.27 110-114 21.895 28.000000000000004 28.13 21.975 115-119 21.790000000000003 28.09 28.24 21.88 120-124 21.86 28.689999999999998 27.99 21.46 125-129 21.75 28.305000000000003 28.165000000000003 21.78 130-134 22.355 27.639999999999997 27.884999999999998 22.12 135-139 22.37 27.889999999999997 27.839999999999996 21.9 140-144 22.36 27.375 28.27 21.995 145-149 23.265 28.055000000000003 27.445000000000004 21.235 150 22.1 28.7 27.650000000000002 21.55 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 1.0 19 1.0 20 2.0 21 2.5 22 3.0 23 6.0 24 6.5 25 6.5 26 10.5 27 18.5 28 26.0 29 26.5 30 31.0 31 44.5 32 50.0 33 59.0 34 74.5 35 83.0 36 101.5 37 122.0 38 131.0 39 155.5 40 183.5 41 212.0 42 236.0 43 251.0 44 262.5 45 257.0 46 252.0 47 230.5 48 200.0 49 178.0 50 154.0 51 138.0 52 118.5 53 91.0 54 68.5 55 51.5 56 40.5 57 26.0 58 19.0 59 17.0 60 9.5 61 9.0 62 6.5 63 3.0 64 3.5 65 4.0 66 2.5 67 1.5 68 2.0 69 3.5 70 2.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16771752837327 98.3 2 0.7818411097099622 1.55 3 0.05044136191677175 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGAAATC 10 0.006716492 145.79747 2 CCGAAAT 10 0.006716492 145.79747 1 TGGGTCG 10 0.0069772652 143.975 7 TCACTGT 10 0.0069772652 143.975 8 TATGGGT 10 0.0069772652 143.975 5 >>END_MODULE SRR22905633 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22905633_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.82625 37.0 36.0 37.0 34.0 38.0 2 35.06525 37.0 36.0 37.0 31.0 38.0 3 36.11125 37.0 36.0 37.0 35.0 38.0 4 36.14525 37.0 36.0 37.0 35.0 38.0 5 35.79475 37.0 36.0 37.0 34.0 38.0 6 35.695 37.0 36.0 37.0 34.0 38.0 7 35.5015 37.0 36.0 37.0 33.0 38.0 8 35.8475 37.0 36.0 37.0 34.0 38.0 9 36.06125 37.0 36.0 37.0 34.0 38.0 10-14 35.869600000000005 37.0 36.0 37.0 34.0 38.0 15-19 35.760450000000006 37.0 36.0 37.0 33.6 38.0 20-24 35.6644 37.0 36.0 37.0 33.6 38.0 25-29 35.669050000000006 37.0 36.0 37.0 33.4 38.0 30-34 35.502449999999996 37.0 36.0 37.0 32.8 38.0 35-39 35.5743 37.0 36.0 37.0 33.2 38.0 40-44 35.385850000000005 37.0 36.0 37.0 32.4 38.0 45-49 35.62465 37.0 36.0 37.0 33.6 38.0 50-54 35.362399999999994 37.0 36.0 37.0 32.4 38.0 55-59 35.13365 37.0 36.0 37.0 31.0 38.0 60-64 35.25575 37.0 36.0 37.0 31.8 38.0 65-69 35.1192 37.0 36.0 37.0 31.6 38.0 70-74 35.06365 37.0 35.8 37.0 31.4 38.0 75-79 34.88925 37.0 35.4 37.0 30.2 38.0 80-84 34.92955 37.0 35.6 37.0 30.4 38.0 85-89 34.72515 37.0 35.2 37.0 29.8 38.0 90-94 34.435950000000005 37.0 35.0 37.0 28.2 38.0 95-99 34.44055 37.0 35.0 37.0 28.4 38.0 100-104 34.48665 37.0 35.0 37.0 28.2 38.0 105-109 34.11165 37.0 35.0 37.0 26.8 38.0 110-114 34.012950000000004 37.0 34.8 37.0 26.4 38.0 115-119 33.8249 37.0 34.6 37.0 25.2 38.0 120-124 33.783 36.8 34.8 37.0 24.8 38.0 125-129 33.3186 36.4 33.8 37.0 23.0 38.0 130-134 33.2549 36.0 34.0 37.0 22.6 38.0 135-139 33.17115 36.0 33.6 37.0 22.0 38.0 140-144 32.79165 36.0 33.0 37.0 20.4 38.0 145-149 32.82645 36.0 33.2 37.0 21.0 38.0 150 32.684 36.0 33.0 37.0 19.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 16.0 28 62.0 29 128.0 30 171.0 31 182.0 32 272.0 33 387.0 34 546.0 35 786.0 36 1034.0 37 416.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.375 17.549999999999997 10.25 38.824999999999996 2 16.275000000000002 23.375 46.650000000000006 13.700000000000001 3 13.600000000000001 24.775 34.725 26.900000000000002 4 18.575 35.675000000000004 27.525 18.224999999999998 5 19.5 35.825 27.1 17.575 6 15.024999999999999 34.375 30.75 19.85 7 14.374999999999998 15.2 47.199999999999996 23.225 8 18.325 21.45 29.575000000000003 30.65 9 20.025000000000002 22.525000000000002 29.475 27.975 10-14 21.21 30.025000000000002 26.345000000000002 22.42 15-19 21.935 28.48 27.555000000000003 22.03 20-24 21.125 29.099999999999998 27.495000000000005 22.28 25-29 20.705000000000002 28.655 28.249999999999996 22.39 30-34 21.310000000000002 28.675 27.555000000000003 22.46 35-39 20.96 28.845 28.475 21.72 40-44 21.52 29.235 27.3 21.945 45-49 21.43 29.020000000000003 27.395000000000003 22.155 50-54 21.48 28.904999999999998 27.905 21.709999999999997 55-59 21.85 28.555000000000003 27.139999999999997 22.455 60-64 21.759999999999998 28.065 27.675 22.5 65-69 21.845 28.515 27.66 21.98 70-74 21.23 28.555000000000003 27.860000000000003 22.355 75-79 21.404999999999998 27.935 28.34 22.32 80-84 21.695 28.645 27.894999999999996 21.765 85-89 21.775 27.975 27.905 22.345000000000002 90-94 21.025 28.249999999999996 27.93 22.795 95-99 21.490000000000002 28.075 28.01 22.425 100-104 22.009999999999998 27.435 28.17 22.384999999999998 105-109 22.02 28.67 27.785 21.525 110-114 21.91219121912191 28.05780578057806 27.9027902790279 22.127212721272127 115-119 22.134999999999998 28.044999999999998 27.779999999999998 22.040000000000003 120-124 22.155 27.79 27.639999999999997 22.415 125-129 22.665 27.93 27.73 21.675 130-134 22.259999999999998 28.1 28.110000000000003 21.529999999999998 135-139 21.805 28.035 27.51 22.650000000000002 140-144 22.617261726172615 27.9027902790279 27.277727772777276 22.202220222022202 145-149 22.372237223722372 27.997799779978 27.677767776777678 21.952195219521954 150 23.1807951987997 27.731932983245812 26.906726681670417 22.18054513628407 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 1.5 22 3.0 23 5.0 24 5.0 25 6.0 26 9.5 27 15.0 28 24.0 29 28.0 30 31.0 31 37.5 32 49.5 33 60.0 34 64.0 35 74.5 36 93.0 37 129.5 38 149.5 39 155.0 40 172.0 41 198.0 42 224.5 43 234.5 44 253.5 45 273.0 46 268.5 47 235.5 48 209.5 49 194.0 50 164.5 51 136.0 52 115.5 53 96.0 54 65.5 55 43.0 56 35.5 57 31.5 58 23.5 59 15.5 60 16.5 61 14.5 62 10.0 63 6.5 64 8.5 65 7.0 66 1.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.01 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.01 145-149 0.01 150 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01515151515152 98.02499999999999 2 0.9595959595959596 1.9 3 0.025252525252525252 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACTCA 10 0.006973645 144.0 4 TTTTTTA 10 0.006973645 144.0 3 TCATCCC 10 0.006973645 144.0 4 >>END_MODULE Read 1900569 spots for SRR22905633.sra Written 1900569 spots for SRR22905633.sra Read 1900569 spots for SRR22905633.sra Written 1900569 spots for SRR22905633.sra Read 1900569 spots for SRR22905633.sra Written 1900569 spots for SRR22905633.sra Read 1900569 spots for SRR22905633.sra Written 1900569 spots for SRR22905633.sra Read 1900569 spots for SRR22905633.sra Written 1900569 spots for SRR22905633.sra Read 1900569 spots for SRR22905633.sra Written 1900569 spots for SRR22905633.sra Read 1900569 spots for SRR22905633.sra Written 1900569 spots for SRR22905633.sra Read 1900569 spots for SRR22905633.sra Written 1900569 spots for SRR22905633.sra Read 1900569 spots for SRR22905633.sra Written 1900569 spots for SRR22905633.sra Read 1900569 spots for SRR22905633.sra Written 1900569 spots for SRR22905633.sra Read 1900569 spots for SRR22905633.sra Written 1900569 spots for SRR22905633.sra Read 1900569 spots for SRR22905633.sra Written 1900569 spots for SRR22905633.sra Read 1900586 spots for SRR22905633.sra Written 1900586 spots for SRR22905633.sra Read 1900569 spots for SRR22905633.sra Written 1900569 spots for SRR22905633.sra Read 1900569 spots for SRR22905633.sra Written 1900569 spots for SRR22905633.sra Read 1900569 spots for SRR22905633.sra Written 1900569 spots for SRR22905633.sra Read 1900569 spots for SRR22905633.sra Written 1900569 spots for SRR22905633.sra Read 1900569 spots for SRR22905633.sra Written 1900569 spots for SRR22905633.sra Read 1900569 spots for SRR22905633.sra Written 1900569 spots for SRR22905633.sra Read 1900569 spots for SRR22905633.sra Written 1900569 spots for SRR22905633.sra SRR ids: ['SRR22905633.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3s4q8svu SRR22905633.sra spots: 38011397 blocks: [[1, 1900569], [1900570, 3801138], [3801139, 5701707], [5701708, 7602276], [7602277, 9502845], [9502846, 11403414], [11403415, 13303983], [13303984, 15204552], [15204553, 17105121], [17105122, 19005690], [19005691, 20906259], [20906260, 22806828], [22806829, 24707397], [24707398, 26607966], [26607967, 28508535], [28508536, 30409104], [30409105, 32309673], [32309674, 34210242], [34210243, 36110811], [36110812, 38011397]] SRR22905633 file size 13538134 SRR22905633 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22905633 SRR22905633_1.fastq SRR22905633_2.fastq Input file: SRR22905633_1.fastq Paired file: SRR22905633_2.fastq trimmed: SRR22905633-trimmed-pair1.fastq, SRR22905633-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:24:43 2025 >> started Thu Feb 13 17:25:30 2025 >> done (46.546s) 38011397 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 38011397 (100.00%) read pairs available; of these: 1961247 ( 5.16%) trimmed read pairs available after processing 36050150 (94.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 141 5 0.00% 142 55 0.00% 143 33 0.00% 144 47 0.00% 145 30 0.00% 146 31 0.00% 147 325 0.00% 148 17068 0.04% 149 1943653 5.11% 150 36050150 94.84% 38011397 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=58.79 fanout-score-rank=3 prefix-density=0.81 prefix-fanout=26.6 sequence=AAGTCGGAGGCCAAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=33 fanout-score=135.11 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=15.4 sequence=TGGTGCTGGTGTAGTGAAGGGTCTCCAAGGAAGCCACAACTACGAGCTTCAGGGTGGCGGAGCTAATGTTGTGAATCATGGATACACCAAGGGTGATGGCCTTGGTGCGGAGATAGTCGGTACCTTTGTTCTTGTCTACACTGTCTTCTCTGCTACTGATGCCAAGAGAAACGCTAGAGACTCTCATGTCCCTATTTTGGCTCCCCTTCCCATTGGATTTGCAGTCTTCTTGGTTCATTTGGCTACCATCCCCATAACTGGAACTGGCATTAACCCGGCAAGGAGTCTTGGAGCCGCCATCATCTTCAACAA criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=56.00 fanout-score-rank=3 prefix-density=0.77 prefix-fanout=26.2 sequence=AAGTCGGATCGTAGCCATGT criterion=fanout-score sequence-density=0.03 sequence-density-rank=34 fanout-score=138.10 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=15.6 sequence=TGGTGCTGGTGTAGTGAAGGGTCTCCAAGGAAGCCACAACTACGAGCTTCAGGGTGGCGGAGCTAATGTTGTGAATCATGGATACACCAAGGGTGATGGCCTTGGTGCGGAGATAGTCGGTACCTTTGTTCTTGTCTACACTGTCTTCTCTGCTACTGATGCCAAGAGAAACGCTAGAGACTCTCATGTCCCTATTTTGGCTCCCCTTCCCATTGGATTTGCAGTCTTCTTGGTTCATTTGGCTACCATCCCCATAACTGGAACTGGCATTAACCCGGCAAGGAGTCTTGGAGCCGCCATCATCTTCAACAA SRR22905633 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:26:12 Started mapping on | Feb 13 17:26:13 Finished on | Feb 13 17:29:21 Mapping speed, Million of reads per hour | 727.88 Number of input reads | 38011397 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 36451519 Uniquely mapped reads % | 95.90% Average mapped length | 298.02 Number of splices: Total | 27829140 Number of splices: Annotated (sjdb) | 27251190 Number of splices: GT/AG | 27410737 Number of splices: GC/AG | 310755 Number of splices: AT/AC | 30360 Number of splices: Non-canonical | 77288 Mismatch rate per base, % | 0.54% Deletion rate per base | 0.03% Deletion average length | 2.48 Insertion rate per base | 0.02% Insertion average length | 1.89 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 736986 % of reads mapped to multiple loci | 1.94% Number of reads mapped to too many loci | 2081 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.15% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 822892 822892 822892 N_multimapping 736986 736986 736986 N_noFeature 1246972 18228562 19078011 N_ambiguous 586736 101198 95431 UnstrandedReadsAssigned:34617811 PositiveStrandReadsAssigned:18121759 NegativeStrandReadsAssigned:17278077 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR22905633 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22905633-trimmed-pair1.fastq SRR22905633-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,011,397 reads, 35,677,483 reads pseudoaligned [quant] estimated average fragment length: 241.225 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,119 rounds 52401 SRR22905633.ke.tsv 34699 SRR22905633.se.tsv 87100 total ==> SRR22905633.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.78 5992 80.2536 Potri.005G024800.1.v4.1 1035 794.775 3377 101.171 Potri.004G059700.1.v4.1 961 720.775 115 3.79898 Potri.007G009000.2.v4.1 1416 1175.78 0 0 Potri.003G141000.2.v4.1 2943 2702.78 1065.94 9.3906 Potri.016G087400.1.v4.1 270 66.464 1728.52 619.238 Potri.015G069301.1.v4.1 564 324.463 0 0 Potri.010G195200.1.v4.1 1773 1532.78 63 0.978659 Potri.012G127500.1.v4.1 977 736.775 1495 48.3143 ==> SRR22905633.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2715 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 1580 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 240 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR22905633 completed mapping pipeline successfully