Starting /dee2/code/volunteer_pipeline.sh SRR22905634 current disk space = 3088677634048 free memory = 1429897628 SRR22905634 SRAfilesize 3724384226b915aea1bda221309bcfd3 SRR22905634.sra SRR22905634.sra file validated SRR22905634 is paired end SRR22905634 is conventional basespace SRR22905634 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22905634_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.972 37.0 36.0 37.0 34.0 38.0 2 35.4405 37.0 36.0 37.0 33.0 38.0 3 36.1895 37.0 36.0 37.0 35.0 38.0 4 36.054 37.0 36.0 37.0 35.0 38.0 5 36.10225 37.0 36.0 37.0 35.0 38.0 6 35.8915 37.0 36.0 37.0 34.0 38.0 7 36.09875 37.0 36.0 37.0 35.0 38.0 8 35.99625 37.0 36.0 37.0 34.0 38.0 9 35.97325 37.0 36.0 37.0 34.0 38.0 10-14 35.96915 37.0 36.0 37.0 34.6 38.0 15-19 35.90505 37.0 36.0 37.0 34.4 38.0 20-24 35.914849999999994 37.0 36.0 37.0 34.4 38.0 25-29 35.89495 37.0 36.0 37.0 34.4 38.0 30-34 35.89315 37.0 36.0 37.0 34.2 38.0 35-39 35.8853 37.0 36.0 37.0 34.2 38.0 40-44 35.67145 37.0 36.0 37.0 33.6 38.0 45-49 35.8304 37.0 36.0 37.0 34.0 38.0 50-54 35.68750000000001 37.0 36.0 37.0 33.6 38.0 55-59 35.745400000000004 37.0 36.0 37.0 34.0 38.0 60-64 35.61755000000001 37.0 36.0 37.0 33.4 38.0 65-69 35.53365 37.0 36.0 37.0 33.2 38.0 70-74 35.5685 37.0 36.0 37.0 33.2 38.0 75-79 35.518049999999995 37.0 36.0 37.0 33.2 38.0 80-84 35.4082 37.0 36.0 37.0 32.6 38.0 85-89 35.385400000000004 37.0 36.0 37.0 32.4 38.0 90-94 35.36319999999999 37.0 36.0 37.0 32.4 38.0 95-99 35.2378 37.0 36.0 37.0 31.8 38.0 100-104 35.058049999999994 37.0 35.8 37.0 31.0 38.0 105-109 35.08945 37.0 36.0 37.0 31.2 38.0 110-114 34.9077 37.0 35.8 37.0 30.4 38.0 115-119 34.74079999999999 37.0 35.4 37.0 29.6 38.0 120-124 34.8861 37.0 35.6 37.0 30.0 38.0 125-129 34.83785 37.0 35.4 37.0 29.8 38.0 130-134 34.429 37.0 35.0 37.0 28.0 38.0 135-139 34.43534999999999 37.0 35.0 37.0 28.2 38.0 140-144 34.431200000000004 37.0 35.0 37.0 28.0 38.0 145-149 34.23205 37.0 35.0 37.0 27.0 38.0 150 33.8605 37.0 35.0 37.0 25.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 5.0 28 37.0 29 79.0 30 94.0 31 138.0 32 158.0 33 256.0 34 425.0 35 810.0 36 1400.0 37 598.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.949999999999996 16.575 11.275 37.2 2 18.175 25.25 44.224999999999994 12.35 3 15.275 26.85 32.4 25.474999999999998 4 20.325 35.025 25.974999999999998 18.675 5 19.925 35.65 27.525 16.900000000000002 6 15.325 35.65 29.375 19.650000000000002 7 14.325 14.75 46.75 24.175 8 18.425 22.175 28.4 31.0 9 19.525000000000002 21.825 30.15 28.499999999999996 10-14 20.849999999999998 29.26 27.41 22.48 15-19 21.33 28.585 28.365000000000002 21.72 20-24 21.490000000000002 28.685 27.845 21.98 25-29 21.584999999999997 28.82 27.875 21.72 30-34 21.63 28.810000000000002 28.01 21.55 35-39 22.07 28.51 28.155 21.265 40-44 22.295 28.444999999999997 27.985 21.275 45-49 21.759999999999998 28.494999999999997 27.73 22.015 50-54 22.13 28.1 27.765 22.005 55-59 21.925 28.449999999999996 28.050000000000004 21.575 60-64 21.73 28.265 28.255000000000003 21.75 65-69 22.375 28.465 27.689999999999998 21.47 70-74 21.945 28.475 27.589999999999996 21.990000000000002 75-79 21.395 28.585 28.04 21.98 80-84 21.81 28.48 28.175 21.535 85-89 22.065 28.134999999999998 27.755000000000003 22.045 90-94 22.015 29.085 27.405 21.495 95-99 22.195 28.265 27.99 21.55 100-104 21.705 28.1 27.834999999999997 22.36 105-109 21.665 28.7 27.900000000000002 21.735 110-114 22.495 28.494999999999997 27.625 21.385 115-119 22.48 28.685 27.565 21.27 120-124 22.38 27.889999999999997 28.485 21.245 125-129 21.959999999999997 27.939999999999998 28.255000000000003 21.845 130-134 22.055 27.715 28.355000000000004 21.875 135-139 22.25 27.650000000000002 28.63 21.47 140-144 22.165000000000003 27.705000000000002 28.249999999999996 21.88 145-149 22.5 28.194999999999997 27.87 21.435000000000002 150 22.5 26.85 28.025 22.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 1.0 21 2.5 22 3.0 23 3.0 24 3.5 25 7.5 26 9.0 27 9.5 28 14.0 29 19.5 30 28.0 31 40.5 32 48.0 33 50.5 34 71.5 35 93.5 36 105.5 37 121.0 38 132.5 39 153.0 40 193.0 41 225.5 42 238.0 43 257.0 44 273.5 45 256.5 46 225.0 47 230.0 48 221.0 49 192.0 50 167.0 51 132.5 52 108.5 53 81.0 54 56.0 55 42.5 56 38.5 57 33.0 58 25.0 59 20.5 60 19.0 61 12.5 62 4.5 63 5.0 64 6.0 65 5.5 66 5.0 67 4.0 68 2.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32041278630757 98.65 2 0.6795872136924239 1.35 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR22905634 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22905634_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.87325 37.0 36.0 37.0 34.0 38.0 2 35.08375 37.0 36.0 37.0 31.0 38.0 3 36.193 37.0 36.0 37.0 35.0 38.0 4 36.1485 37.0 36.0 37.0 35.0 38.0 5 35.7145 37.0 36.0 37.0 34.0 38.0 6 35.699 37.0 36.0 37.0 34.0 38.0 7 35.477 37.0 36.0 37.0 33.0 38.0 8 35.69825 37.0 36.0 37.0 34.0 38.0 9 36.02975 37.0 36.0 37.0 34.0 38.0 10-14 35.82015 37.0 36.0 37.0 34.2 38.0 15-19 35.74905 37.0 36.0 37.0 33.8 38.0 20-24 35.62455 37.0 36.0 37.0 33.2 38.0 25-29 35.713849999999994 37.0 36.0 37.0 33.4 38.0 30-34 35.451100000000004 37.0 36.0 37.0 32.8 38.0 35-39 35.5047 37.0 36.0 37.0 33.2 38.0 40-44 35.3942 37.0 36.0 37.0 32.4 38.0 45-49 35.59565 37.0 36.0 37.0 33.2 38.0 50-54 35.306400000000004 37.0 36.0 37.0 32.4 38.0 55-59 35.0863 37.0 36.0 37.0 31.2 38.0 60-64 35.3295 37.0 36.0 37.0 32.2 38.0 65-69 35.146049999999995 37.0 35.8 37.0 31.6 38.0 70-74 34.9754 37.0 35.8 37.0 30.8 38.0 75-79 34.907 37.0 35.4 37.0 30.6 38.0 80-84 35.02935 37.0 35.6 37.0 31.2 38.0 85-89 34.746599999999994 37.0 35.2 37.0 29.6 38.0 90-94 34.418150000000004 37.0 35.2 37.0 28.0 38.0 95-99 34.424150000000004 37.0 35.0 37.0 27.8 38.0 100-104 34.46225 37.0 35.0 37.0 28.4 38.0 105-109 34.255050000000004 37.0 35.0 37.0 27.2 38.0 110-114 34.0111 37.0 34.8 37.0 26.0 38.0 115-119 33.811400000000006 37.0 34.8 37.0 25.2 38.0 120-124 33.77365 36.8 34.6 37.0 25.0 38.0 125-129 33.31935 36.4 34.0 37.0 23.0 38.0 130-134 33.27635 36.0 34.0 37.0 22.8 38.0 135-139 33.187599999999996 36.0 33.8 37.0 22.4 38.0 140-144 32.8157 36.0 33.0 37.0 20.6 38.0 145-149 32.8168 36.0 33.4 37.0 20.6 38.0 150 32.881 36.0 34.0 37.0 21.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 11.0 28 58.0 29 125.0 30 161.0 31 216.0 32 276.0 33 390.0 34 504.0 35 809.0 36 1052.0 37 398.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.95 18.55 11.425 38.074999999999996 2 17.375 24.6 44.35 13.675 3 14.799999999999999 26.450000000000003 33.925 24.825 4 20.45 35.375 26.400000000000002 17.775 5 19.625 36.725 26.400000000000002 17.25 6 14.325 36.35 29.4 19.925 7 14.975 15.525 46.85 22.650000000000002 8 18.575 22.3 28.7 30.425 9 19.45 23.025000000000002 31.125000000000004 26.400000000000002 10-14 20.365 28.999999999999996 27.325 23.31 15-19 20.755000000000003 28.585 28.349999999999998 22.31 20-24 20.72 28.84 28.925 21.515 25-29 20.96 29.005 27.83 22.205 30-34 20.515 29.025000000000002 27.97 22.49 35-39 20.990000000000002 29.110000000000003 27.455000000000002 22.445 40-44 21.029999999999998 28.96 27.595 22.415 45-49 21.490000000000002 28.7 27.575 22.235 50-54 21.665 28.305000000000003 27.92 22.11 55-59 21.505 28.555000000000003 27.779999999999998 22.16 60-64 21.115000000000002 28.735 27.805000000000003 22.345000000000002 65-69 21.19 28.449999999999996 28.165000000000003 22.195 70-74 20.875 28.865000000000002 28.285 21.975 75-79 21.310000000000002 28.599999999999998 27.72 22.37 80-84 21.475 28.32 28.075 22.13 85-89 21.035 28.310000000000002 28.23 22.425 90-94 21.5 27.939999999999998 27.865000000000002 22.695 95-99 21.68108405420271 28.25141257062853 27.791389569478476 22.276113805690283 100-104 21.105 28.275 28.42 22.2 105-109 21.915000000000003 27.79 28.255000000000003 22.040000000000003 110-114 21.6 28.349999999999998 27.785 22.264999999999997 115-119 21.5 27.794999999999998 28.449999999999996 22.255 120-124 22.24 27.060000000000002 28.255000000000003 22.445 125-129 21.279999999999998 28.389999999999997 28.07 22.259999999999998 130-134 21.685 28.199999999999996 28.110000000000003 22.005 135-139 22.27222722272227 26.96769676967697 28.272827282728276 22.487248724872487 140-144 22.82 27.685 27.805000000000003 21.69 145-149 23.085 27.215 28.01 21.69 150 22.025 27.275 27.775 22.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.5 16 1.0 17 0.0 18 1.0 19 1.5 20 4.5 21 4.5 22 2.0 23 4.5 24 7.0 25 11.0 26 11.5 27 14.0 28 14.0 29 14.0 30 28.5 31 37.5 32 41.0 33 53.0 34 67.5 35 87.0 36 107.5 37 129.5 38 161.0 39 168.0 40 187.0 41 230.0 42 232.5 43 250.0 44 253.5 45 242.5 46 248.0 47 235.0 48 207.5 49 178.0 50 156.0 51 133.5 52 114.5 53 87.0 54 62.0 55 49.0 56 37.5 57 31.5 58 24.0 59 14.0 60 10.5 61 7.5 62 9.0 63 7.5 64 5.5 65 4.0 66 3.5 67 3.0 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.005 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.01 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24414210128496 98.475 2 0.7306626354245402 1.4500000000000002 3 0.02519526329050139 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1936963 spots for SRR22905634.sra Written 1936963 spots for SRR22905634.sra Read 1936949 spots for SRR22905634.sra Written 1936949 spots for SRR22905634.sra Read 1936949 spots for SRR22905634.sra Written 1936949 spots for SRR22905634.sra Read 1936949 spots for SRR22905634.sra Written 1936949 spots for SRR22905634.sra Read 1936949 spots for SRR22905634.sra Written 1936949 spots for SRR22905634.sra Read 1936949 spots for SRR22905634.sra Written 1936949 spots for SRR22905634.sra Read 1936949 spots for SRR22905634.sra Written 1936949 spots for SRR22905634.sra Read 1936949 spots for SRR22905634.sra Written 1936949 spots for SRR22905634.sra Read 1936949 spots for SRR22905634.sra Written 1936949 spots for SRR22905634.sra Read 1936949 spots for SRR22905634.sra Written 1936949 spots for SRR22905634.sra Read 1936949 spots for SRR22905634.sra Written 1936949 spots for SRR22905634.sra Read 1936949 spots for SRR22905634.sra Written 1936949 spots for SRR22905634.sra Read 1936949 spots for SRR22905634.sra Written 1936949 spots for SRR22905634.sra Read 1936949 spots for SRR22905634.sra Written 1936949 spots for SRR22905634.sra Read 1936949 spots for SRR22905634.sra Written 1936949 spots for SRR22905634.sra Read 1936949 spots for SRR22905634.sra Written 1936949 spots for SRR22905634.sra Read 1936949 spots for SRR22905634.sra Written 1936949 spots for SRR22905634.sra Read 1936949 spots for SRR22905634.sra Written 1936949 spots for SRR22905634.sra Read 1936949 spots for SRR22905634.sra Written 1936949 spots for SRR22905634.sra Read 1936949 spots for SRR22905634.sra Written 1936949 spots for SRR22905634.sra SRR ids: ['SRR22905634.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e8yg76_t SRR22905634.sra spots: 38738994 blocks: [[1, 1936949], [1936950, 3873898], [3873899, 5810847], [5810848, 7747796], [7747797, 9684745], [9684746, 11621694], [11621695, 13558643], [13558644, 15495592], [15495593, 17432541], [17432542, 19369490], [19369491, 21306439], [21306440, 23243388], [23243389, 25180337], [25180338, 27117286], [27117287, 29054235], [29054236, 30991184], [30991185, 32928133], [32928134, 34865082], [34865083, 36802031], [36802032, 38738994]] SRR22905634 file size 13797483 SRR22905634 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22905634 SRR22905634_1.fastq SRR22905634_2.fastq Input file: SRR22905634_1.fastq Paired file: SRR22905634_2.fastq trimmed: SRR22905634-trimmed-pair1.fastq, SRR22905634-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:19:45 2025 >> started Thu Feb 13 17:20:27 2025 >> done (42.018s) 36431070 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 36431070 (100.00%) read pairs available; of these: 1861809 ( 5.11%) trimmed read pairs available after processing 34569261 (94.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 141 5 0.00% 142 34 0.00% 143 29 0.00% 144 30 0.00% 145 23 0.00% 146 23 0.00% 147 285 0.00% 148 15899 0.04% 149 1845481 5.07% 150 34569261 94.89% 36431070 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=33 prefix-density=0.34 prefix-fanout=2.3 sequence=TGGCTCCTTGTGCA criterion=fanout-score sequence-density=0.31 sequence-density-rank=2 fanout-score=62.83 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=27.9 sequence=AAGTCGGAGGCCAAG criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=56.19 fanout-score-rank=2 prefix-density=0.70 prefix-fanout=26.8 sequence=AAGTCGGATCGTAGCCATGT criterion=fanout-score sequence-density=0.09 sequence-density-rank=16 fanout-score=83.11 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=20.4 sequence=TCATCTTCAACAA SRR22905634 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:21:13 Started mapping on | Feb 13 17:21:14 Finished on | Feb 13 17:24:18 Mapping speed, Million of reads per hour | 712.78 Number of input reads | 36431070 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 34962493 Uniquely mapped reads % | 95.97% Average mapped length | 298.18 Number of splices: Total | 27629426 Number of splices: Annotated (sjdb) | 27029001 Number of splices: GT/AG | 27209606 Number of splices: GC/AG | 313374 Number of splices: AT/AC | 31603 Number of splices: Non-canonical | 74843 Mismatch rate per base, % | 0.53% Deletion rate per base | 0.02% Deletion average length | 2.45 Insertion rate per base | 0.02% Insertion average length | 1.87 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 711188 % of reads mapped to multiple loci | 1.95% Number of reads mapped to too many loci | 1715 % of reads mapped to too many loci | 0.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.06% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 757389 757389 757389 N_multimapping 711188 711188 711188 N_noFeature 1288317 17497498 18426607 N_ambiguous 525942 104042 96815 UnstrandedReadsAssigned:33148234 PositiveStrandReadsAssigned:17360953 NegativeStrandReadsAssigned:16439071 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR22905634 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22905634-trimmed-pair1.fastq SRR22905634-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,431,070 reads, 34,085,691 reads pseudoaligned [quant] estimated average fragment length: 247.712 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,101 rounds 52401 SRR22905634.ke.tsv 34699 SRR22905634.se.tsv 87100 total ==> SRR22905634.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1771.29 8880 136.01 Potri.005G024800.1.v4.1 1035 788.288 8009 275.639 Potri.004G059700.1.v4.1 961 714.298 98 3.72214 Potri.007G009000.2.v4.1 1416 1169.29 0 0 Potri.003G141000.2.v4.1 2943 2696.29 999.203 10.0539 Potri.016G087400.1.v4.1 270 65.4379 1631.57 676.43 Potri.015G069301.1.v4.1 564 318.085 0 0 Potri.010G195200.1.v4.1 1773 1526.29 42 0.746551 Potri.012G127500.1.v4.1 977 730.298 1242 46.139 ==> SRR22905634.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2280 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 1238 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 107 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR22905634 completed mapping pipeline successfully