Starting /dee2/code/volunteer_pipeline.sh SRR22905635 current disk space = 3088640151552 free memory = 1443395036 SRR22905635 SRAfilesize 060aaeb88ae9ff0189fe53c390bf24ca SRR22905635.sra SRR22905635.sra file validated SRR22905635 is paired end SRR22905635 is conventional basespace SRR22905635 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22905635_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.13275 37.0 36.0 37.0 35.0 38.0 2 35.49775 37.0 36.0 37.0 33.0 38.0 3 36.2395 37.0 36.0 37.0 35.0 38.0 4 36.07625 37.0 36.0 37.0 35.0 38.0 5 36.21675 37.0 36.0 37.0 35.0 38.0 6 35.95 37.0 36.0 37.0 34.0 38.0 7 36.078 37.0 36.0 37.0 35.0 38.0 8 36.08675 37.0 36.0 37.0 35.0 38.0 9 36.25075 37.0 36.0 37.0 35.0 38.0 10-14 36.075 37.0 36.0 37.0 34.6 38.0 15-19 35.98015 37.0 36.0 37.0 34.6 38.0 20-24 35.9992 37.0 36.0 37.0 34.6 38.0 25-29 36.012950000000004 37.0 36.0 37.0 34.4 38.0 30-34 36.0429 37.0 36.0 37.0 34.6 38.0 35-39 35.95399999999999 37.0 36.0 37.0 34.4 38.0 40-44 35.8325 37.0 36.0 37.0 34.2 38.0 45-49 35.93175 37.0 36.0 37.0 34.4 38.0 50-54 35.8067 37.0 36.0 37.0 34.2 38.0 55-59 35.813700000000004 37.0 36.0 37.0 34.0 38.0 60-64 35.711200000000005 37.0 36.0 37.0 33.6 38.0 65-69 35.677749999999996 37.0 36.0 37.0 33.4 38.0 70-74 35.662099999999995 37.0 36.0 37.0 33.6 38.0 75-79 35.67805 37.0 36.0 37.0 33.6 38.0 80-84 35.5471 37.0 36.0 37.0 33.2 38.0 85-89 35.48805 37.0 36.0 37.0 32.8 38.0 90-94 35.40005 37.0 36.0 37.0 32.6 38.0 95-99 35.37225 37.0 36.0 37.0 32.4 38.0 100-104 35.20655000000001 37.0 36.0 37.0 31.8 38.0 105-109 35.28189999999999 37.0 36.0 37.0 32.0 38.0 110-114 35.1301 37.0 36.0 37.0 31.4 38.0 115-119 34.96255 37.0 36.0 37.0 31.0 38.0 120-124 35.08085 37.0 35.8 37.0 31.2 38.0 125-129 34.8319 37.0 35.8 37.0 30.2 38.0 130-134 34.579750000000004 37.0 35.0 37.0 28.8 38.0 135-139 34.6851 37.0 35.2 37.0 29.2 38.0 140-144 34.52275 37.0 35.0 37.0 28.4 38.0 145-149 34.30129999999999 37.0 35.0 37.0 27.0 38.0 150 34.20225 37.0 35.0 37.0 27.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 3.0 28 23.0 29 55.0 30 73.0 31 103.0 32 178.0 33 250.0 34 431.0 35 801.0 36 1460.0 37 623.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.625 16.875 11.625 35.875 2 18.85 24.099999999999998 44.3 12.75 3 15.625 27.250000000000004 32.375 24.75 4 18.725 37.3 26.900000000000002 17.075000000000003 5 19.675 35.075 27.224999999999998 18.025 6 14.6 37.15 29.4 18.85 7 15.299999999999999 15.725 46.2 22.775000000000002 8 19.625 21.275 27.525 31.574999999999996 9 20.349999999999998 23.724999999999998 28.95 26.974999999999998 10-14 20.555 28.585 27.994999999999997 22.865 15-19 21.48 27.925 28.64 21.955 20-24 21.55 28.63 28.265 21.555 25-29 21.38 28.665000000000003 28.485 21.47 30-34 21.205 28.310000000000002 28.904999999999998 21.58 35-39 21.235 28.985 28.084999999999997 21.695 40-44 21.740000000000002 28.895 27.975 21.39 45-49 21.54 28.725 28.244999999999997 21.490000000000002 50-54 21.915000000000003 28.49 28.310000000000002 21.285 55-59 21.845 28.67 28.310000000000002 21.175 60-64 21.525 29.03 28.060000000000002 21.385 65-69 21.775 28.58 28.27 21.375 70-74 22.13 28.910000000000004 27.55 21.41 75-79 21.705 28.775000000000002 27.91 21.61 80-84 21.495 29.225 27.700000000000003 21.58 85-89 22.055 27.860000000000003 28.59 21.495 90-94 21.965 28.455000000000002 27.815 21.765 95-99 21.995 28.23 28.360000000000003 21.415 100-104 22.21 28.12 28.000000000000004 21.67 105-109 21.735 27.985 28.849999999999998 21.43 110-114 21.955 27.99 28.199999999999996 21.855 115-119 22.575 27.845 28.315 21.265 120-124 21.990000000000002 27.865000000000002 28.54 21.605 125-129 22.235 27.765 28.785 21.215 130-134 22.53 28.115000000000002 28.215 21.14 135-139 22.235 28.04 28.09 21.634999999999998 140-144 22.28 28.4 27.97 21.349999999999998 145-149 22.381119055952798 28.8114405720286 27.406370318515926 21.401070053502675 150 23.1 28.7 26.724999999999998 21.475 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 3.0 22 5.0 23 4.5 24 6.0 25 10.5 26 13.0 27 13.5 28 12.0 29 17.5 30 34.0 31 42.0 32 56.5 33 68.5 34 74.0 35 81.0 36 91.5 37 111.5 38 136.0 39 177.0 40 206.5 41 224.5 42 252.0 43 259.0 44 262.0 45 270.0 46 245.0 47 230.5 48 223.5 49 184.5 50 145.0 51 115.5 52 91.0 53 76.0 54 61.5 55 44.0 56 29.0 57 25.0 58 24.5 59 19.5 60 15.0 61 11.0 62 8.0 63 6.5 64 6.0 65 3.5 66 1.0 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.005 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19354838709677 98.4 2 0.8064516129032258 1.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.025 0.0 0.0 54-55 0.0 0.0 0.025 0.0 0.0 56-57 0.0 0.0 0.025 0.0 0.0 58-59 0.0 0.0 0.025 0.0 0.0 60-61 0.0 0.0 0.025 0.0 0.0 62-63 0.0 0.0 0.025 0.0 0.0 64-65 0.0 0.0 0.025 0.0 0.0 66-67 0.0 0.0 0.025 0.0 0.0 68-69 0.0 0.0 0.025 0.0 0.0 70-71 0.0 0.0 0.025 0.0 0.0 72-73 0.0 0.0 0.025 0.0 0.0 74-75 0.0 0.0 0.025 0.0 0.0 76-77 0.0 0.0 0.025 0.0 0.0 78-79 0.0 0.0 0.025 0.0 0.0 80-81 0.0 0.0 0.025 0.0 0.0 82-83 0.0 0.0 0.025 0.0 0.0 84-85 0.0 0.0 0.025 0.0 0.0 86-87 0.0 0.0 0.025 0.0 0.0 88-89 0.0 0.0 0.025 0.0 0.0 90-91 0.0 0.0 0.025 0.0 0.0 92-93 0.0 0.0 0.025 0.0 0.0 94-95 0.0 0.0 0.025 0.0 0.0 96-97 0.0 0.0 0.025 0.0 0.0 98-99 0.0 0.0 0.025 0.0 0.0 100-101 0.0 0.0 0.025 0.0 0.0 102-103 0.0 0.0 0.025 0.0 0.0 104-105 0.0 0.0 0.025 0.0 0.0 106-107 0.0 0.0 0.025 0.0 0.0 108-109 0.0 0.0 0.025 0.0 0.0 110-111 0.0 0.0 0.025 0.0 0.0 112-113 0.0 0.0 0.025 0.0 0.0 114-115 0.0 0.0 0.025 0.0 0.0 116-117 0.0 0.0 0.025 0.0 0.0 118-119 0.0 0.0 0.025 0.0 0.0 120-121 0.0 0.0 0.025 0.0 0.0 122-123 0.0 0.0 0.025 0.0 0.0 124-125 0.0 0.0 0.025 0.0 0.0 126-127 0.0 0.0 0.025 0.0 0.0 128-129 0.0 0.0 0.025 0.0 0.0 130-131 0.0 0.0 0.025 0.0 0.0 132-133 0.0 0.0 0.025 0.0 0.0 134-135 0.0 0.0 0.025 0.0 0.0 136-137 0.0 0.0 0.025 0.0 0.0 138 0.0 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTGATG 10 0.006973645 144.0 8 >>END_MODULE SRR22905635 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22905635_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.58325 37.0 36.0 37.0 33.0 38.0 2 34.89725 37.0 36.0 37.0 31.0 38.0 3 35.981 37.0 36.0 37.0 34.0 38.0 4 36.0885 37.0 36.0 37.0 35.0 38.0 5 35.61875 37.0 36.0 37.0 33.0 38.0 6 35.513 37.0 36.0 37.0 33.0 38.0 7 35.408 37.0 36.0 37.0 33.0 38.0 8 35.607 37.0 36.0 37.0 33.0 38.0 9 35.93 37.0 36.0 37.0 34.0 38.0 10-14 35.70995 37.0 36.0 37.0 33.6 38.0 15-19 35.62125 37.0 36.0 37.0 33.2 38.0 20-24 35.42845 37.0 36.0 37.0 32.6 38.0 25-29 35.50930000000001 37.0 36.0 37.0 33.2 38.0 30-34 35.3549 37.0 36.0 37.0 32.6 38.0 35-39 35.2767 37.0 36.0 37.0 32.0 38.0 40-44 35.1419 37.0 35.8 37.0 31.6 38.0 45-49 35.42885 37.0 36.0 37.0 32.6 38.0 50-54 35.1687 37.0 36.0 37.0 31.6 38.0 55-59 34.9118 37.0 35.2 37.0 30.8 38.0 60-64 35.04415 37.0 35.6 37.0 31.0 38.0 65-69 34.9389 37.0 35.6 37.0 30.8 38.0 70-74 34.8165 37.0 35.2 37.0 30.2 38.0 75-79 34.670300000000005 37.0 35.2 37.0 29.4 38.0 80-84 34.7164 37.0 35.2 37.0 29.6 38.0 85-89 34.5274 37.0 35.0 37.0 28.6 38.0 90-94 34.168899999999994 37.0 35.0 37.0 27.2 38.0 95-99 34.188050000000004 37.0 35.0 37.0 27.0 38.0 100-104 34.2448 37.0 35.0 37.0 27.0 38.0 105-109 33.857600000000005 36.6 34.8 37.0 25.6 38.0 110-114 33.659800000000004 36.8 34.6 37.0 24.6 38.0 115-119 33.5335 36.6 34.2 37.0 24.0 37.8 120-124 33.5283 36.4 34.0 37.0 23.8 37.8 125-129 33.03025 36.0 33.4 37.0 21.8 37.4 130-134 33.0753 36.0 33.8 37.0 21.8 37.8 135-139 32.77485 36.0 33.0 37.0 20.4 37.4 140-144 32.48389999999999 36.0 32.2 37.0 19.6 37.0 145-149 32.640699999999995 36.0 32.6 37.0 20.0 37.4 150 32.3055 36.0 32.0 37.0 19.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 8.0 28 63.0 29 142.0 30 193.0 31 244.0 32 294.0 33 421.0 34 609.0 35 800.0 36 909.0 37 317.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.324999999999996 17.724999999999998 11.275 37.675 2 17.724999999999998 25.55 44.2 12.525 3 14.299999999999999 27.900000000000002 32.574999999999996 25.224999999999998 4 19.5 35.05 27.474999999999998 17.974999999999998 5 20.45 35.85 26.775 16.925 6 14.2 35.9 30.425 19.475 7 15.5 15.024999999999999 46.125 23.35 8 18.45 22.75 29.375 29.425 9 19.75 22.825 30.85 26.575 10-14 20.435 29.310000000000002 26.77 23.485 15-19 20.57 28.865000000000002 28.310000000000002 22.255 20-24 20.91 28.555000000000003 28.205000000000002 22.33 25-29 20.990000000000002 28.95 27.99 22.07 30-34 21.0 29.345 27.744999999999997 21.91 35-39 20.96 29.845 27.915 21.279999999999998 40-44 21.135 29.015 28.03 21.82 45-49 20.555 28.675 28.410000000000004 22.36 50-54 21.224999999999998 28.59 28.15 22.035 55-59 21.240000000000002 28.89 27.93 21.94 60-64 21.065 28.860000000000003 27.925 22.15 65-69 20.865000000000002 28.26 28.705000000000002 22.17 70-74 21.32 28.93 27.88 21.87 75-79 21.285 28.744999999999997 28.075 21.895 80-84 21.85 28.165000000000003 28.13 21.855 85-89 21.285 28.49 28.025 22.2 90-94 21.595 28.744999999999997 27.785 21.875 95-99 21.83609180459023 27.966398319915996 28.266413320666032 21.931096554827743 100-104 21.645 27.815 28.175 22.365 105-109 21.436071803590178 28.941447072353615 27.1863593179659 22.436121806090302 110-114 21.41 28.075 28.625 21.89 115-119 21.42 28.205000000000002 28.505000000000003 21.87 120-124 22.035 28.035 27.389999999999997 22.54 125-129 21.5810790539527 28.271413570678533 27.84639231961598 22.30111505575279 130-134 22.07 27.994999999999997 27.700000000000003 22.235 135-139 21.956097804890245 28.366418320916047 28.206410320516024 21.471073553677684 140-144 22.3861193059653 28.356417820891046 27.35636781839092 21.901095054752737 145-149 22.62 27.63 27.47 22.28 150 23.125 27.224999999999998 27.0 22.650000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 2.0 23 3.0 24 8.0 25 11.5 26 10.0 27 11.5 28 14.5 29 17.0 30 33.0 31 45.0 32 54.0 33 66.0 34 72.5 35 92.5 36 108.0 37 124.5 38 155.0 39 173.0 40 205.0 41 241.0 42 249.5 43 242.0 44 241.0 45 242.5 46 230.5 47 223.5 48 204.5 49 179.0 50 163.0 51 142.5 52 113.5 53 82.0 54 56.0 55 37.5 56 30.0 57 22.5 58 18.5 59 18.5 60 13.5 61 7.5 62 7.0 63 7.5 64 4.5 65 3.5 66 2.5 67 2.0 68 0.5 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.005 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.005 140-144 0.005 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44681921046015 98.875 2 0.5280362081971335 1.05 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTACATA 10 0.006973645 144.0 2 >>END_MODULE Read 1931340 spots for SRR22905635.sra Written 1931340 spots for SRR22905635.sra Read 1931340 spots for SRR22905635.sra Written 1931340 spots for SRR22905635.sra Read 1931340 spots for SRR22905635.sra Written 1931340 spots for SRR22905635.sra Read 1931340 spots for SRR22905635.sra Written 1931340 spots for SRR22905635.sra Read 1931340 spots for SRR22905635.sra Written 1931340 spots for SRR22905635.sra Read 1931340 spots for SRR22905635.sra Written 1931340 spots for SRR22905635.sra Read 1931340 spots for SRR22905635.sra Written 1931340 spots for SRR22905635.sra Read 1931340 spots for SRR22905635.sra Written 1931340 spots for SRR22905635.sra Read 1931340 spots for SRR22905635.sra Written 1931340 spots for SRR22905635.sra Read 1931340 spots for SRR22905635.sra Written 1931340 spots for SRR22905635.sra Read 1931340 spots for SRR22905635.sra Written 1931340 spots for SRR22905635.sra Read 1931340 spots for SRR22905635.sra Written 1931340 spots for SRR22905635.sra Read 1931342 spots for SRR22905635.sra Written 1931342 spots for SRR22905635.sra Read 1931340 spots for SRR22905635.sra Written 1931340 spots for SRR22905635.sra Read 1931340 spots for SRR22905635.sra Written 1931340 spots for SRR22905635.sra Read 1931340 spots for SRR22905635.sra Written 1931340 spots for SRR22905635.sra Read 1931340 spots for SRR22905635.sra Written 1931340 spots for SRR22905635.sra Read 1931340 spots for SRR22905635.sra Written 1931340 spots for SRR22905635.sra Read 1931340 spots for SRR22905635.sra Written 1931340 spots for SRR22905635.sra Read 1931340 spots for SRR22905635.sra Written 1931340 spots for SRR22905635.sra SRR ids: ['SRR22905635.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v3uxlyg9 SRR22905635.sra spots: 38626802 blocks: [[1, 1931340], [1931341, 3862680], [3862681, 5794020], [5794021, 7725360], [7725361, 9656700], [9656701, 11588040], [11588041, 13519380], [13519381, 15450720], [15450721, 17382060], [17382061, 19313400], [19313401, 21244740], [21244741, 23176080], [23176081, 25107420], [25107421, 27038760], [27038761, 28970100], [28970101, 30901440], [30901441, 32832780], [32832781, 34764120], [34764121, 36695460], [36695461, 38626802]] SRR22905635 file size 13757492 SRR22905635 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22905635 SRR22905635_1.fastq SRR22905635_2.fastq Input file: SRR22905635_1.fastq Paired file: SRR22905635_2.fastq trimmed: SRR22905635-trimmed-pair1.fastq, SRR22905635-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:52:24 2025 >> started Thu Feb 13 17:53:28 2025 >> done (64.461s) 38626802 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 38626802 (100.00%) read pairs available; of these: 2051987 ( 5.31%) trimmed read pairs available after processing 36574815 (94.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 140 2 0.00% 141 3 0.00% 142 35 0.00% 143 43 0.00% 144 32 0.00% 145 30 0.00% 146 40 0.00% 147 334 0.00% 148 18272 0.05% 149 2033196 5.26% 150 36574815 94.69% 38626802 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=60.82 fanout-score-rank=2 prefix-density=0.63 prefix-fanout=28.2 sequence=AAGTCGGAGGCCAAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=29 fanout-score=69.50 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=14.4 sequence=ATCATCTTCAACAA criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=56.91 fanout-score-rank=3 prefix-density=0.60 prefix-fanout=26.5 sequence=AAGTCGGATCGTAGCCATGT criterion=fanout-score sequence-density=0.03 sequence-density-rank=39 fanout-score=102.34 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=13.8 sequence=CAAGAACAAAGATCATGCCACCAAAGGCCCA SRR22905635 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:54:12 Started mapping on | Feb 13 17:54:13 Finished on | Feb 13 17:58:10 Mapping speed, Million of reads per hour | 586.74 Number of input reads | 38626802 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 36931119 Uniquely mapped reads % | 95.61% Average mapped length | 298.14 Number of splices: Total | 31436782 Number of splices: Annotated (sjdb) | 30788718 Number of splices: GT/AG | 30950708 Number of splices: GC/AG | 376327 Number of splices: AT/AC | 28134 Number of splices: Non-canonical | 81613 Mismatch rate per base, % | 0.55% Deletion rate per base | 0.02% Deletion average length | 2.42 Insertion rate per base | 0.02% Insertion average length | 1.87 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 892977 % of reads mapped to multiple loci | 2.31% Number of reads mapped to too many loci | 2019 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.05% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 802706 802706 802706 N_multimapping 892977 892977 892977 N_noFeature 1296173 18418366 19531583 N_ambiguous 509971 121765 112700 UnstrandedReadsAssigned:35124975 PositiveStrandReadsAssigned:18390988 NegativeStrandReadsAssigned:17286836 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR22905635 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22905635-trimmed-pair1.fastq SRR22905635-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,626,802 reads, 36,111,443 reads pseudoaligned [quant] estimated average fragment length: 247.204 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,115 rounds 52401 SRR22905635.ke.tsv 34699 SRR22905635.se.tsv 87100 total ==> SRR22905635.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1771.8 9273 130.436 Potri.005G024800.1.v4.1 1035 788.796 7446 235.261 Potri.004G059700.1.v4.1 961 714.805 28 0.976252 Potri.007G009000.2.v4.1 1416 1169.8 0 0 Potri.003G141000.2.v4.1 2943 2696.8 1676.55 15.4939 Potri.016G087400.1.v4.1 270 65.2651 1308.59 499.704 Potri.015G069301.1.v4.1 564 318.561 0 0 Potri.010G195200.1.v4.1 1773 1526.8 167.54 2.73483 Potri.012G127500.1.v4.1 977 730.796 1841 62.7841 ==> SRR22905635.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 462 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 1263 Potri.001G212900.v4.1 12 Potri.001G182400.v4.1 25 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 10 SRR22905635 completed mapping pipeline successfully