Starting /dee2/code/volunteer_pipeline.sh SRR22905636 current disk space = 3088705273856 free memory = 1450157208 SRR22905636 SRAfilesize e65b397cef76703a9ed961683ac95baf SRR22905636.sra SRR22905636.sra file validated SRR22905636 is paired end SRR22905636 is conventional basespace SRR22905636 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22905636_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0545 37.0 36.0 37.0 35.0 38.0 2 35.196 37.0 36.0 37.0 32.0 38.0 3 36.2495 37.0 36.0 37.0 35.0 38.0 4 35.91775 37.0 36.0 37.0 34.0 38.0 5 36.1145 37.0 36.0 37.0 35.0 38.0 6 35.93275 37.0 36.0 37.0 34.0 38.0 7 36.05125 37.0 36.0 37.0 35.0 38.0 8 35.91625 37.0 36.0 37.0 34.0 38.0 9 36.02325 37.0 36.0 37.0 35.0 38.0 10-14 35.9458 37.0 36.0 37.0 34.4 38.0 15-19 35.9089 37.0 36.0 37.0 34.4 38.0 20-24 35.954499999999996 37.0 36.0 37.0 34.6 38.0 25-29 35.9012 37.0 36.0 37.0 34.4 38.0 30-34 35.92125 37.0 36.0 37.0 34.6 38.0 35-39 35.939 37.0 36.0 37.0 34.4 38.0 40-44 35.77625 37.0 36.0 37.0 34.0 38.0 45-49 35.86955 37.0 36.0 37.0 34.2 38.0 50-54 35.726749999999996 37.0 36.0 37.0 34.0 38.0 55-59 35.819900000000004 37.0 36.0 37.0 34.0 38.0 60-64 35.601749999999996 37.0 36.0 37.0 33.6 38.0 65-69 35.56875 37.0 36.0 37.0 33.4 38.0 70-74 35.62145 37.0 36.0 37.0 33.4 38.0 75-79 35.56345 37.0 36.0 37.0 33.2 38.0 80-84 35.411199999999994 37.0 36.0 37.0 32.4 38.0 85-89 35.393 37.0 36.0 37.0 32.4 38.0 90-94 35.40990000000001 37.0 36.0 37.0 32.6 38.0 95-99 35.2239 37.0 36.0 37.0 32.0 38.0 100-104 35.203649999999996 37.0 36.0 37.0 31.8 38.0 105-109 35.1682 37.0 36.0 37.0 31.6 38.0 110-114 35.02975 37.0 35.8 37.0 31.0 38.0 115-119 34.85705 37.0 35.4 37.0 30.6 38.0 120-124 34.931349999999995 37.0 35.6 37.0 30.8 38.0 125-129 34.820949999999996 37.0 35.4 37.0 30.2 38.0 130-134 34.59955 37.0 35.0 37.0 29.0 38.0 135-139 34.5831 37.0 35.0 37.0 29.0 38.0 140-144 34.56745 37.0 35.0 37.0 29.2 38.0 145-149 34.4173 37.0 35.0 37.0 28.4 38.0 150 33.911 37.0 35.0 37.0 26.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 1.0 27 3.0 28 32.0 29 65.0 30 75.0 31 113.0 32 192.0 33 265.0 34 377.0 35 824.0 36 1485.0 37 568.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.225 16.45 10.375 37.95 2 16.55 24.4 45.975 13.075000000000001 3 16.5 26.700000000000003 31.974999999999998 24.825 4 20.200000000000003 36.0 26.200000000000003 17.599999999999998 5 18.7 35.85 27.500000000000004 17.95 6 14.649999999999999 36.65 30.099999999999998 18.6 7 15.8 14.099999999999998 45.25 24.85 8 18.875 21.25 29.45 30.425 9 20.150000000000002 21.525 30.75 27.575 10-14 21.26 29.085 27.145000000000003 22.509999999999998 15-19 21.275 27.950000000000003 28.175 22.6 20-24 21.245 28.535 28.299999999999997 21.92 25-29 21.584999999999997 28.38 28.125 21.91 30-34 21.92 28.970000000000002 27.015 22.095000000000002 35-39 21.21 28.84 28.53 21.42 40-44 21.8 28.37 27.765 22.065 45-49 22.24 28.265 27.555000000000003 21.94 50-54 21.765 28.395 28.1 21.740000000000002 55-59 22.225 28.015 27.575 22.185 60-64 22.33 28.599999999999998 27.650000000000002 21.42 65-69 21.94 28.4 28.1 21.560000000000002 70-74 21.925 28.505000000000003 28.355000000000004 21.215 75-79 22.025 28.365000000000002 28.525 21.085 80-84 22.685 28.095 27.72 21.5 85-89 22.12 28.804999999999996 27.810000000000002 21.265 90-94 22.43 28.27 27.83 21.47 95-99 21.97 28.595 27.584999999999997 21.85 100-104 22.220000000000002 28.044999999999998 27.675 22.06 105-109 22.02 28.345 28.194999999999997 21.44 110-114 23.24 27.650000000000002 27.805000000000003 21.305 115-119 22.41 28.335 27.85 21.404999999999998 120-124 22.220000000000002 28.555000000000003 27.875 21.349999999999998 125-129 22.525000000000002 27.415 28.525 21.535 130-134 22.39 27.139999999999997 28.134999999999998 22.335 135-139 22.8 28.175 27.605 21.42 140-144 21.985 28.945 27.455000000000002 21.615000000000002 145-149 22.505 28.185 27.515 21.795 150 22.605651412853213 27.631907976994246 28.35708927231808 21.405351337834457 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.5 19 2.0 20 1.0 21 1.0 22 2.0 23 4.5 24 4.0 25 5.0 26 11.5 27 19.5 28 23.5 29 23.5 30 22.5 31 34.0 32 50.5 33 56.0 34 57.5 35 70.0 36 91.0 37 107.5 38 139.0 39 167.5 40 191.0 41 215.0 42 233.0 43 252.0 44 272.0 45 270.5 46 240.0 47 229.5 48 226.5 49 198.5 50 158.5 51 127.5 52 113.5 53 92.0 54 68.5 55 53.5 56 38.0 57 28.5 58 25.5 59 20.5 60 12.5 61 8.0 62 5.5 63 5.5 64 5.0 65 5.0 66 4.0 67 1.5 68 1.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3709109209864 98.725 2 0.6039255158530448 1.2 3 0.025163563160543533 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR22905636 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22905636_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.6185 37.0 36.0 37.0 34.0 38.0 2 34.84825 37.0 35.0 37.0 30.0 38.0 3 36.04125 37.0 36.0 37.0 34.0 38.0 4 35.933 37.0 36.0 37.0 34.0 38.0 5 35.5245 37.0 36.0 37.0 33.0 38.0 6 35.453 37.0 36.0 37.0 33.0 38.0 7 35.442 37.0 36.0 37.0 33.0 38.0 8 35.6255 37.0 36.0 37.0 33.0 38.0 9 35.88975 37.0 36.0 37.0 34.0 38.0 10-14 35.70655000000001 37.0 36.0 37.0 33.6 38.0 15-19 35.5418 37.0 36.0 37.0 33.0 38.0 20-24 35.40255 37.0 36.0 37.0 32.8 38.0 25-29 35.528 37.0 36.0 37.0 33.2 38.0 30-34 35.3369 37.0 36.0 37.0 32.4 38.0 35-39 35.335300000000004 37.0 36.0 37.0 32.2 38.0 40-44 35.17905 37.0 35.8 37.0 31.8 38.0 45-49 35.4908 37.0 36.0 37.0 33.0 38.0 50-54 35.145050000000005 37.0 35.4 37.0 31.6 38.0 55-59 34.9545 37.0 35.2 37.0 30.8 38.0 60-64 35.0964 37.0 35.8 37.0 31.4 38.0 65-69 34.94690000000001 37.0 35.6 37.0 30.6 38.0 70-74 34.80525 37.0 35.2 37.0 30.4 38.0 75-79 34.59445 37.0 35.0 37.0 29.4 38.0 80-84 34.767900000000004 37.0 35.0 37.0 30.0 37.8 85-89 34.39745 37.0 35.0 37.0 28.4 37.8 90-94 34.213300000000004 36.8 35.0 37.0 27.0 38.0 95-99 34.1903 37.0 35.0 37.0 27.4 37.8 100-104 34.12115 37.0 35.0 37.0 27.0 37.4 105-109 33.904650000000004 36.6 34.8 37.0 26.0 37.2 110-114 33.7071 36.4 34.4 37.0 24.8 37.2 115-119 33.61805 36.0 34.2 37.0 24.2 37.2 120-124 33.36535 36.0 33.8 37.0 23.4 37.2 125-129 33.083000000000006 36.0 33.4 37.0 22.2 37.0 130-134 33.013099999999994 36.0 33.6 37.0 21.8 37.0 135-139 32.853300000000004 36.0 33.2 37.0 21.2 37.0 140-144 32.5807 36.0 32.4 37.0 20.0 37.0 145-149 32.47065 36.0 32.4 37.0 19.6 37.0 150 32.31875 36.0 32.0 37.0 19.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 1.0 27 15.0 28 84.0 29 157.0 30 178.0 31 232.0 32 289.0 33 369.0 34 559.0 35 892.0 36 928.0 37 296.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.125 16.275000000000002 11.4 39.2 2 17.775 24.275 44.5 13.450000000000001 3 14.45 28.125 31.825 25.6 4 18.95 36.0 26.6 18.45 5 20.599999999999998 35.85 25.650000000000002 17.9 6 15.299999999999999 35.675000000000004 28.275 20.75 7 14.299999999999999 15.950000000000001 46.6 23.150000000000002 8 18.15 20.275000000000002 29.95 31.624999999999996 9 19.900000000000002 22.1 29.95 28.050000000000004 10-14 20.330000000000002 29.17 27.334999999999997 23.165 15-19 20.32 28.199999999999996 28.77 22.71 20-24 21.015 28.055000000000003 28.035 22.895 25-29 20.95 28.21 29.125 21.715 30-34 20.69 28.685 28.485 22.14 35-39 21.34 28.299999999999997 28.04 22.32 40-44 20.835 28.720000000000002 28.325 22.12 45-49 20.985 28.505000000000003 27.950000000000003 22.56 50-54 20.915 28.804999999999996 28.505000000000003 21.775 55-59 20.560000000000002 28.470000000000002 28.845 22.125 60-64 21.61 28.21 27.894999999999996 22.285 65-69 21.796089804490222 27.91639581979099 28.31641582079104 21.971098554927746 70-74 21.475 27.779999999999998 28.439999999999998 22.305 75-79 21.565 28.68 27.805000000000003 21.95 80-84 21.62 28.084999999999997 27.779999999999998 22.515 85-89 21.825 27.575 28.749999999999996 21.85 90-94 21.490000000000002 28.134999999999998 28.199999999999996 22.175 95-99 21.64 28.355000000000004 27.389999999999997 22.615 100-104 21.985 28.485 27.52 22.009999999999998 105-109 21.38 27.62 27.975 23.025000000000002 110-114 21.6160808040402 27.896394819740987 28.10140507025351 22.3861193059653 115-119 21.481074053702685 27.49137456872844 27.931396569828493 23.096154807740387 120-124 21.535 28.1 28.110000000000003 22.255 125-129 21.805 27.689999999999998 27.98 22.525000000000002 130-134 22.59 27.955000000000002 26.950000000000003 22.505 135-139 21.86218621862186 27.552755275527552 27.867786778677868 22.717271727172715 140-144 22.825 27.52 26.915 22.74 145-149 22.175 27.725 27.49 22.61 150 24.175 25.025 28.225 22.575 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.5 19 2.0 20 1.5 21 0.5 22 1.5 23 2.5 24 5.0 25 9.0 26 11.0 27 11.0 28 14.5 29 18.0 30 28.0 31 37.5 32 45.0 33 54.0 34 64.0 35 76.5 36 94.5 37 114.5 38 141.5 39 171.0 40 189.5 41 220.5 42 236.5 43 242.5 44 266.5 45 271.0 46 253.0 47 252.0 48 232.5 49 191.5 50 165.0 51 138.5 52 107.0 53 85.0 54 65.0 55 43.0 56 36.5 57 33.0 58 24.5 59 14.5 60 7.5 61 5.0 62 5.0 63 3.0 64 2.0 65 1.5 66 0.5 67 0.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.005 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.01 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14271306101867 98.3 2 0.8572869389813415 1.7000000000000002 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACCAAT 10 0.0069863307 143.91249 6 >>END_MODULE Read 1568963 spots for SRR22905636.sra Written 1568963 spots for SRR22905636.sra Read 1568963 spots for SRR22905636.sra Written 1568963 spots for SRR22905636.sra Read 1568963 spots for SRR22905636.sra Written 1568963 spots for SRR22905636.sra Read 1568963 spots for SRR22905636.sra Written 1568963 spots for SRR22905636.sra Read 1568963 spots for SRR22905636.sra Written 1568963 spots for SRR22905636.sra Read 1568963 spots for SRR22905636.sra Written 1568963 spots for SRR22905636.sra Read 1568963 spots for SRR22905636.sra Written 1568963 spots for SRR22905636.sra Read 1568963 spots for SRR22905636.sra Written 1568963 spots for SRR22905636.sra Read 1568963 spots for SRR22905636.sra Written 1568963 spots for SRR22905636.sra Read 1568963 spots for SRR22905636.sra Written 1568963 spots for SRR22905636.sra Read 1568963 spots for SRR22905636.sra Written 1568963 spots for SRR22905636.sra Read 1568963 spots for SRR22905636.sra Written 1568963 spots for SRR22905636.sra Read 1568963 spots for SRR22905636.sra Written 1568963 spots for SRR22905636.sra Read 1568963 spots for SRR22905636.sra Written 1568963 spots for SRR22905636.sra Read 1568963 spots for SRR22905636.sra Written 1568963 spots for SRR22905636.sra Read 1568963 spots for SRR22905636.sra Written 1568963 spots for SRR22905636.sra Read 1568963 spots for SRR22905636.sra Written 1568963 spots for SRR22905636.sra Read 1568963 spots for SRR22905636.sra Written 1568963 spots for SRR22905636.sra Read 1568963 spots for SRR22905636.sra Written 1568963 spots for SRR22905636.sra Read 1568963 spots for SRR22905636.sra Written 1568963 spots for SRR22905636.sra SRR ids: ['SRR22905636.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0_y5yy6c SRR22905636.sra spots: 31379260 blocks: [[1, 1568963], [1568964, 3137926], [3137927, 4706889], [4706890, 6275852], [6275853, 7844815], [7844816, 9413778], [9413779, 10982741], [10982742, 12551704], [12551705, 14120667], [14120668, 15689630], [15689631, 17258593], [17258594, 18827556], [18827557, 20396519], [20396520, 21965482], [21965483, 23534445], [23534446, 25103408], [25103409, 26672371], [26672372, 28241334], [28241335, 29810297], [29810298, 31379260]] SRR22905636 file size 11174140 SRR22905636 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22905636 SRR22905636_1.fastq SRR22905636_2.fastq Input file: SRR22905636_1.fastq Paired file: SRR22905636_2.fastq trimmed: SRR22905636-trimmed-pair1.fastq, SRR22905636-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:42:57 2025 >> started Thu Feb 13 17:43:32 2025 >> done (35.031s) 31379260 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 31379260 (100.00%) read pairs available; of these: 1750479 ( 5.58%) trimmed read pairs available after processing 29628781 (94.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 141 3 0.00% 142 23 0.00% 143 19 0.00% 144 19 0.00% 145 16 0.00% 146 24 0.00% 147 299 0.00% 148 15383 0.05% 149 1734693 5.53% 150 29628781 94.42% 31379260 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.74 fanout-score-rank=34 prefix-density=0.27 prefix-fanout=2.4 sequence=TGGCTCCTTGTGCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=35 fanout-score=81.66 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=9.5 sequence=CACCACCATGGGCTCCCCAGCCACCATAGGTGTCAATAATGATCTTGCGTCCAGTGAGACCTGCATCACCATGAGGACCACCAATAACAAAACGGCCAGATGGGTTGAGGTGAAAGATAGTTTTCTCATCAAGGTACTTCTCCGGGATAACAGGCTTGATGACATACTCCTTTAGATCAGCGGCAATTTCATCATTTGTGACAGTCTCATCATGCTGAGTAGAGATGAGAACAGTGTGGACACGAACAGGGACCATTGCACCATTGTCATTGAAGTACTCAACAGTAACTTGAGTCTTGCCATCAGGTCTTAACCAAGGGCAGGTTCCATTCTTCCT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.88 fanout-score-rank=37 prefix-density=0.24 prefix-fanout=2.5 sequence=TGGCTCCTTGTGCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=13 fanout-score=84.33 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=20.0 sequence=TCATCTTCAACAA SRR22905636 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:44:20 Started mapping on | Feb 13 17:44:21 Finished on | Feb 13 17:47:10 Mapping speed, Million of reads per hour | 668.43 Number of input reads | 31379260 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 30233167 Uniquely mapped reads % | 96.35% Average mapped length | 298.22 Number of splices: Total | 25624253 Number of splices: Annotated (sjdb) | 25060682 Number of splices: GT/AG | 25239989 Number of splices: GC/AG | 294409 Number of splices: AT/AC | 26791 Number of splices: Non-canonical | 63064 Mismatch rate per base, % | 0.58% Deletion rate per base | 0.02% Deletion average length | 2.47 Insertion rate per base | 0.02% Insertion average length | 1.86 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 570140 % of reads mapped to multiple loci | 1.82% Number of reads mapped to too many loci | 940 % of reads mapped to too many loci | 0.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.82% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 575953 575953 575953 N_multimapping 570140 570140 570140 N_noFeature 1148920 15107424 15998519 N_ambiguous 439250 85217 79189 UnstrandedReadsAssigned:28644997 PositiveStrandReadsAssigned:15040526 NegativeStrandReadsAssigned:14155459 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR22905636 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22905636-trimmed-pair1.fastq SRR22905636-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,379,260 reads, 29,340,236 reads pseudoaligned [quant] estimated average fragment length: 259.662 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,036 rounds 52401 SRR22905636.ke.tsv 34699 SRR22905636.se.tsv 87100 total ==> SRR22905636.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.34 3073 60.5331 Potri.005G024800.1.v4.1 1035 776.338 1143 51.0241 Potri.004G059700.1.v4.1 961 702.353 24 1.18423 Potri.007G009000.2.v4.1 1416 1157.34 0 0 Potri.003G141000.2.v4.1 2943 2684.34 706.309 9.11879 Potri.016G087400.1.v4.1 270 61.309 1199 677.758 Potri.015G069301.1.v4.1 564 306.364 0 0 Potri.010G195200.1.v4.1 1773 1514.34 45 1.02984 Potri.012G127500.1.v4.1 977 718.348 586 28.2711 ==> SRR22905636.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4074 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 1027 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 105 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR22905636 completed mapping pipeline successfully