Starting /dee2/code/volunteer_pipeline.sh SRR22905637 current disk space = 3088681197568 free memory = 1442450328 SRR22905637 SRAfilesize 04f305e56f46c193ec90327698deb37a SRR22905637.sra SRR22905637.sra file validated SRR22905637 is paired end SRR22905637 is conventional basespace SRR22905637 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22905637_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1595 37.0 36.0 37.0 35.0 38.0 2 35.58 37.0 36.0 37.0 33.0 38.0 3 36.29075 37.0 36.0 37.0 35.0 38.0 4 36.096 37.0 36.0 37.0 35.0 38.0 5 36.14975 37.0 36.0 37.0 35.0 38.0 6 36.08275 37.0 36.0 37.0 35.0 38.0 7 36.279 37.0 36.0 37.0 35.0 38.0 8 36.06825 37.0 36.0 37.0 35.0 38.0 9 36.20825 37.0 36.0 37.0 35.0 38.0 10-14 36.1255 37.0 36.0 37.0 35.0 38.0 15-19 36.05695 37.0 36.0 37.0 34.6 38.0 20-24 36.0933 37.0 36.0 37.0 34.6 38.0 25-29 36.0179 37.0 36.0 37.0 34.4 38.0 30-34 36.09714999999999 37.0 36.0 37.0 34.8 38.0 35-39 36.08990000000001 37.0 36.0 37.0 34.8 38.0 40-44 35.83485 37.0 36.0 37.0 34.0 38.0 45-49 36.009100000000004 37.0 36.0 37.0 34.6 38.0 50-54 35.916199999999996 37.0 36.0 37.0 34.4 38.0 55-59 35.97945 37.0 36.0 37.0 34.6 38.0 60-64 35.72525 37.0 36.0 37.0 33.6 38.0 65-69 35.650999999999996 37.0 36.0 37.0 33.4 38.0 70-74 35.791000000000004 37.0 36.0 37.0 33.8 38.0 75-79 35.7511 37.0 36.0 37.0 33.6 38.0 80-84 35.61475 37.0 36.0 37.0 33.2 38.0 85-89 35.56595 37.0 36.0 37.0 33.0 38.0 90-94 35.584799999999994 37.0 36.0 37.0 33.4 38.0 95-99 35.445350000000005 37.0 36.0 37.0 32.6 38.0 100-104 35.298500000000004 37.0 36.0 37.0 32.0 38.0 105-109 35.396100000000004 37.0 36.0 37.0 32.4 38.0 110-114 35.18355 37.0 35.8 37.0 31.6 38.0 115-119 35.1627 37.0 36.0 37.0 31.6 38.0 120-124 35.1514 37.0 36.0 37.0 31.4 38.0 125-129 35.05335 37.0 35.8 37.0 31.0 38.0 130-134 34.7838 37.0 35.4 37.0 29.8 38.0 135-139 34.873650000000005 37.0 35.8 37.0 30.0 38.0 140-144 34.81824999999999 37.0 35.2 37.0 30.0 38.0 145-149 34.68025 37.0 35.4 37.0 29.6 38.0 150 34.21475 37.0 35.0 37.0 27.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 5.0 28 26.0 29 53.0 30 71.0 31 113.0 32 116.0 33 220.0 34 391.0 35 776.0 36 1559.0 37 670.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.175 17.9 9.675 38.25 2 17.474999999999998 25.575 44.6 12.35 3 15.4 27.400000000000002 32.275 24.925 4 19.075 36.375 26.3 18.25 5 18.375 36.775000000000006 27.575 17.275 6 15.65 35.949999999999996 29.325000000000003 19.075 7 14.975 14.05 47.075 23.9 8 19.05 22.15 28.725 30.075000000000003 9 19.75 23.0 30.425 26.825 10-14 21.035 29.265 27.139999999999997 22.56 15-19 21.675 28.16 28.26 21.905 20-24 21.595 28.895 28.165000000000003 21.345 25-29 21.125 29.15 28.035 21.69 30-34 21.275 28.28 28.000000000000004 22.445 35-39 21.67 28.050000000000004 28.4 21.88 40-44 21.87 28.67 27.944999999999997 21.515 45-49 21.990000000000002 28.215 27.955000000000002 21.84 50-54 22.42 28.43 27.800000000000004 21.349999999999998 55-59 21.685 28.715000000000003 27.634999999999998 21.965 60-64 21.91 28.435 28.105000000000004 21.55 65-69 21.765 28.89 27.725 21.62 70-74 21.884999999999998 28.155 28.365000000000002 21.595 75-79 21.985 28.74 28.07 21.205 80-84 22.02 27.96 28.03 21.990000000000002 85-89 22.46 28.744999999999997 27.42 21.375 90-94 21.905 28.939999999999998 27.29 21.865000000000002 95-99 22.134999999999998 28.58 27.625 21.66 100-104 21.75608780439022 28.24641232061603 27.946397319865994 22.051102555127756 105-109 21.95 28.694999999999997 27.565 21.790000000000003 110-114 21.89 28.735 27.815 21.560000000000002 115-119 22.56 28.000000000000004 27.925 21.515 120-124 22.15 28.875 27.57 21.404999999999998 125-129 22.175 28.675 27.534999999999997 21.615000000000002 130-134 21.485000000000003 28.62 28.17 21.725 135-139 22.575 28.689999999999998 27.889999999999997 20.845 140-144 22.285 28.02 28.365000000000002 21.33 145-149 22.38 28.76 27.35 21.51 150 22.5 26.424999999999997 28.675 22.400000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 1.5 21 2.0 22 2.5 23 2.5 24 3.0 25 5.0 26 8.0 27 11.0 28 15.5 29 20.5 30 29.0 31 36.0 32 51.0 33 61.5 34 69.5 35 85.5 36 96.0 37 111.5 38 133.5 39 155.5 40 185.5 41 229.0 42 252.0 43 257.5 44 267.0 45 277.5 46 258.5 47 229.0 48 208.0 49 182.0 50 159.0 51 138.0 52 114.0 53 80.5 54 54.5 55 44.0 56 38.0 57 32.0 58 23.0 59 14.0 60 13.0 61 11.5 62 7.0 63 6.0 64 4.5 65 3.0 66 3.0 67 2.0 68 2.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGGCC 10 0.006973645 144.0 1 TTTGGCA 10 0.006973645 144.0 2 CTTTGGC 10 0.006973645 144.0 1 TTTTTTT 145 1.5742033E-4 9.931035 120-124 >>END_MODULE SRR22905637 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22905637_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.78025 37.0 36.0 37.0 34.0 38.0 2 35.044 37.0 36.0 37.0 31.0 38.0 3 36.19325 37.0 36.0 37.0 35.0 38.0 4 36.18675 37.0 36.0 37.0 35.0 38.0 5 35.771 37.0 36.0 37.0 34.0 38.0 6 35.70725 37.0 36.0 37.0 34.0 38.0 7 35.3885 37.0 36.0 37.0 33.0 38.0 8 35.818 37.0 36.0 37.0 34.0 38.0 9 36.109 37.0 36.0 37.0 35.0 38.0 10-14 35.90565 37.0 36.0 37.0 34.2 38.0 15-19 35.74865 37.0 36.0 37.0 33.8 38.0 20-24 35.66435 37.0 36.0 37.0 33.4 38.0 25-29 35.76785 37.0 36.0 37.0 33.8 38.0 30-34 35.45035 37.0 36.0 37.0 32.8 38.0 35-39 35.5563 37.0 36.0 37.0 33.0 38.0 40-44 35.3565 37.0 36.0 37.0 32.4 38.0 45-49 35.665150000000004 37.0 36.0 37.0 33.6 38.0 50-54 35.3596 37.0 36.0 37.0 32.6 38.0 55-59 35.110299999999995 37.0 35.6 37.0 31.2 38.0 60-64 35.34595 37.0 36.0 37.0 32.4 38.0 65-69 35.19945 37.0 35.8 37.0 32.0 38.0 70-74 35.1221 37.0 35.8 37.0 31.6 38.0 75-79 34.9919 37.0 35.6 37.0 30.8 38.0 80-84 35.08305 37.0 35.8 37.0 31.6 38.0 85-89 34.862350000000006 37.0 35.4 37.0 30.6 38.0 90-94 34.636649999999996 37.0 35.2 37.0 29.2 38.0 95-99 34.530100000000004 37.0 35.0 37.0 29.0 38.0 100-104 34.63415 37.0 35.0 37.0 29.2 38.0 105-109 34.21435 37.0 35.0 37.0 27.4 38.0 110-114 34.21185 37.0 35.0 37.0 27.2 38.0 115-119 33.9339 36.6 34.6 37.0 26.0 38.0 120-124 33.89685 36.6 34.8 37.0 26.2 37.8 125-129 33.545849999999994 36.2 34.4 37.0 24.0 38.0 130-134 33.5747 36.4 34.6 37.0 24.2 37.8 135-139 33.4056 36.2 33.6 37.0 23.6 37.2 140-144 33.1168 36.0 33.6 37.0 22.2 37.2 145-149 33.012600000000006 36.0 33.4 37.0 21.8 37.4 150 33.013 36.0 34.0 37.0 22.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 9.0 28 62.0 29 119.0 30 143.0 31 184.0 32 256.0 33 368.0 34 511.0 35 845.0 36 1112.0 37 391.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.675000000000004 16.75 10.65 36.925000000000004 2 17.849999999999998 23.549999999999997 45.4 13.200000000000001 3 14.725 26.974999999999998 32.800000000000004 25.5 4 19.7 35.6 26.924999999999997 17.775 5 18.875 35.0 28.349999999999998 17.775 6 14.45 34.4 30.45 20.7 7 14.575 15.725 47.025 22.675 8 17.9 22.025 29.975 30.099999999999998 9 20.275000000000002 22.225 30.95 26.55 10-14 20.87 29.409999999999997 27.250000000000004 22.470000000000002 15-19 20.985 28.275 28.549999999999997 22.189999999999998 20-24 21.115000000000002 28.89 28.02 21.975 25-29 21.37 28.76 28.12 21.75 30-34 20.855 28.605000000000004 28.205000000000002 22.335 35-39 21.235 28.325 28.455000000000002 21.985 40-44 20.830000000000002 28.815 28.49 21.865000000000002 45-49 21.01 28.07 28.335 22.585 50-54 21.91 27.650000000000002 27.779999999999998 22.66 55-59 20.815 28.315 28.110000000000003 22.759999999999998 60-64 21.185000000000002 28.655 27.73 22.43 65-69 21.215 28.52 28.285 21.98 70-74 21.11 27.975 28.63 22.285 75-79 21.709999999999997 28.285 27.794999999999998 22.21 80-84 21.060000000000002 28.675 27.82 22.445 85-89 21.41 27.815 28.305000000000003 22.470000000000002 90-94 21.435000000000002 27.975 28.185 22.405 95-99 21.7 27.634999999999998 28.49 22.175 100-104 22.17 27.944999999999997 27.634999999999998 22.25 105-109 21.625 28.04 27.905 22.43 110-114 21.995 27.655 27.87 22.48 115-119 21.95 27.810000000000002 28.095 22.145 120-124 22.025 27.57 28.065 22.34 125-129 22.41 27.405 27.689999999999998 22.495 130-134 22.12 27.97 27.639999999999997 22.27 135-139 22.216110805540275 28.006400320016 27.83639181959098 21.941097054852744 140-144 22.15 27.700000000000003 28.01 22.14 145-149 22.965 27.589999999999996 27.37 22.075 150 22.725 27.800000000000004 26.8 22.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 1.0 20 1.0 21 1.0 22 3.0 23 4.0 24 5.5 25 7.0 26 8.5 27 11.5 28 20.0 29 22.5 30 21.0 31 31.0 32 42.5 33 58.5 34 73.0 35 73.5 36 85.0 37 121.5 38 150.5 39 173.5 40 199.0 41 218.5 42 242.5 43 259.5 44 265.5 45 260.5 46 255.5 47 243.0 48 219.0 49 189.5 50 161.0 51 134.0 52 105.5 53 79.0 54 57.0 55 41.5 56 32.5 57 31.0 58 25.5 59 17.5 60 12.5 61 9.0 62 5.0 63 7.0 64 6.5 65 2.5 66 1.0 67 0.5 68 0.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34574735782587 98.7 2 0.6542526421741319 1.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.025 0.0 86-87 0.0 0.0 0.0 0.025 0.0 88-89 0.0 0.0 0.0 0.025 0.0 90-91 0.0 0.0 0.0 0.025 0.0 92-93 0.0 0.0 0.0 0.025 0.0 94-95 0.0 0.0 0.0 0.025 0.0 96-97 0.0 0.0 0.0 0.025 0.0 98-99 0.0 0.0 0.0 0.025 0.0 100-101 0.0 0.0 0.0 0.025 0.0 102-103 0.0 0.0 0.0 0.025 0.0 104-105 0.0 0.0 0.0 0.025 0.0 106-107 0.0 0.0 0.0 0.025 0.0 108-109 0.0 0.0 0.0 0.025 0.0 110-111 0.0 0.0 0.0 0.025 0.0 112-113 0.0 0.0 0.0 0.025 0.0 114-115 0.0 0.0 0.0 0.025 0.0 116-117 0.0 0.0 0.0 0.025 0.0 118-119 0.0 0.0 0.0 0.025 0.0 120-121 0.0 0.0 0.0 0.025 0.0 122-123 0.0 0.0 0.0 0.025 0.0 124-125 0.0 0.0 0.0 0.025 0.0 126-127 0.0 0.0 0.0 0.025 0.0 128-129 0.0 0.0 0.0 0.025 0.0 130-131 0.0 0.0 0.0 0.025 0.0 132-133 0.0 0.0 0.0 0.025 0.0 134-135 0.0 0.0 0.0 0.025 0.0 136-137 0.0 0.0 0.0 0.025 0.0 138 0.0 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1793834 spots for SRR22905637.sra Written 1793834 spots for SRR22905637.sra Read 1793834 spots for SRR22905637.sra Written 1793834 spots for SRR22905637.sra Read 1793834 spots for SRR22905637.sra Written 1793834 spots for SRR22905637.sra Read 1793834 spots for SRR22905637.sra Written 1793834 spots for SRR22905637.sra Read 1793834 spots for SRR22905637.sra Written 1793834 spots for SRR22905637.sra Read 1793834 spots for SRR22905637.sra Written 1793834 spots for SRR22905637.sra Read 1793834 spots for SRR22905637.sra Written 1793834 spots for SRR22905637.sra Read 1793834 spots for SRR22905637.sra Written 1793834 spots for SRR22905637.sra Read 1793848 spots for SRR22905637.sra Written 1793848 spots for SRR22905637.sra Read 1793834 spots for SRR22905637.sra Written 1793834 spots for SRR22905637.sra Read 1793834 spots for SRR22905637.sra Written 1793834 spots for SRR22905637.sra Read 1793834 spots for SRR22905637.sra Written 1793834 spots for SRR22905637.sra Read 1793834 spots for SRR22905637.sra Written 1793834 spots for SRR22905637.sra Read 1793834 spots for SRR22905637.sra Written 1793834 spots for SRR22905637.sra Read 1793834 spots for SRR22905637.sra Written 1793834 spots for SRR22905637.sra Read 1793834 spots for SRR22905637.sra Written 1793834 spots for SRR22905637.sra Read 1793834 spots for SRR22905637.sra Written 1793834 spots for SRR22905637.sra Read 1793834 spots for SRR22905637.sra Written 1793834 spots for SRR22905637.sra Read 1793834 spots for SRR22905637.sra Written 1793834 spots for SRR22905637.sra Read 1793834 spots for SRR22905637.sra Written 1793834 spots for SRR22905637.sra SRR ids: ['SRR22905637.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8mwshx0y SRR22905637.sra spots: 35876694 blocks: [[1, 1793834], [1793835, 3587668], [3587669, 5381502], [5381503, 7175336], [7175337, 8969170], [8969171, 10763004], [10763005, 12556838], [12556839, 14350672], [14350673, 16144506], [16144507, 17938340], [17938341, 19732174], [19732175, 21526008], [21526009, 23319842], [23319843, 25113676], [25113677, 26907510], [26907511, 28701344], [28701345, 30495178], [30495179, 32289012], [32289013, 34082846], [34082847, 35876694]] SRR22905637 file size 12777229 SRR22905637 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22905637 SRR22905637_1.fastq SRR22905637_2.fastq Input file: SRR22905637_1.fastq Paired file: SRR22905637_2.fastq trimmed: SRR22905637-trimmed-pair1.fastq, SRR22905637-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:37:36 2025 >> started Thu Feb 13 17:38:20 2025 >> done (43.393s) 35876694 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 1 ( 0.00%) empty read pairs filtered out after trimming by size control 35876693 (100.00%) read pairs available; of these: 1909904 ( 5.32%) trimmed read pairs available after processing 33966789 (94.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 140 1 0.00% 141 5 0.00% 142 37 0.00% 143 16 0.00% 144 33 0.00% 145 25 0.00% 146 32 0.00% 147 299 0.00% 148 16602 0.05% 149 1892854 5.28% 150 33966789 94.68% 35876693 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=60.30 fanout-score-rank=2 prefix-density=0.58 prefix-fanout=27.1 sequence=AAGTCGGAGGCCAAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=403.57 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=23.8 sequence=TGAAGAAAAACATTACGATTATTACATTACATGCGCAATTGGGATAAAAAGGCCCTTGAAGAAATACACGTCACTGTTATAGCACGCGCTTACTTATAGGTACAAATGCACAAAAGGCCAACACGGAGAAAATGGAACAAACTGGGCTTGATTTTCATCTTTAATACATCATCAAATGGCCAAAAGTAAAGCATCACAATCATCACTTCTTGAAAGGAATGGCTCTGATCACAACCTGGTGGTAAAGAGCTGCAAGTGCTGCTCCAATGAAGGGGCCAACCCAGAAAATCCAGTGATCATCCCAGGCGCTGTCCTTGTTGAAGAT criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=58.80 fanout-score-rank=3 prefix-density=0.57 prefix-fanout=27.5 sequence=AAGTCGGATCGTAGCCATGT criterion=fanout-score sequence-density=0.05 sequence-density-rank=16 fanout-score=395.88 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=36.3 sequence=TTCTTCTTCTTT SRR22905637 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:39:07 Started mapping on | Feb 13 17:39:07 Finished on | Feb 13 17:42:17 Mapping speed, Million of reads per hour | 679.77 Number of input reads | 35876693 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 34246235 Uniquely mapped reads % | 95.46% Average mapped length | 298.14 Number of splices: Total | 29995421 Number of splices: Annotated (sjdb) | 29350474 Number of splices: GT/AG | 29524390 Number of splices: GC/AG | 369651 Number of splices: AT/AC | 25185 Number of splices: Non-canonical | 76195 Mismatch rate per base, % | 0.55% Deletion rate per base | 0.02% Deletion average length | 2.42 Insertion rate per base | 0.02% Insertion average length | 1.88 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 855287 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 2826 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.14% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 775171 775171 775171 N_multimapping 855287 855287 855287 N_noFeature 1143306 17120130 18032276 N_ambiguous 444572 107860 100815 UnstrandedReadsAssigned:32658357 PositiveStrandReadsAssigned:17018245 NegativeStrandReadsAssigned:16113144 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR22905637 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22905637-trimmed-pair1.fastq SRR22905637-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,876,693 reads, 33,535,935 reads pseudoaligned [quant] estimated average fragment length: 252.45 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,204 rounds 52401 SRR22905637.ke.tsv 34699 SRR22905637.se.tsv 87100 total ==> SRR22905637.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.55 5027 72.7307 Potri.005G024800.1.v4.1 1035 783.55 11954 389.926 Potri.004G059700.1.v4.1 961 709.555 11 0.396225 Potri.007G009000.2.v4.1 1416 1164.55 0 0 Potri.003G141000.2.v4.1 2943 2691.55 1575.86 14.9641 Potri.016G087400.1.v4.1 270 63.6056 1924 773.116 Potri.015G069301.1.v4.1 564 313.408 0 0 Potri.010G195200.1.v4.1 1773 1521.55 418 7.02142 Potri.012G127500.1.v4.1 977 725.555 1221 43.0111 ==> SRR22905637.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 325 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 932 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 17 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR22905637 completed mapping pipeline successfully