Starting /dee2/code/volunteer_pipeline.sh SRR22954651 current disk space = 3088912674816 free memory = 1403446308 SRR22954651 SRAfilesize 8ada2ac8f03ec577b80abe72b1caeadd SRR22954651.sra SRR22954651.sra file validated SRR22954651 is paired end SRR22954651 is conventional basespace SRR22954651 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22954651_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.83975 37.0 36.0 37.0 34.0 38.0 2 35.4115 37.0 36.0 37.0 33.0 38.0 3 36.00025 37.0 36.0 37.0 34.0 38.0 4 36.07625 37.0 36.0 37.0 35.0 38.0 5 36.053 37.0 36.0 37.0 35.0 38.0 6 36.0 37.0 36.0 37.0 35.0 38.0 7 35.932 37.0 36.0 37.0 34.0 38.0 8 36.155 37.0 36.0 37.0 35.0 38.0 9 36.06975 37.0 36.0 37.0 35.0 38.0 10-14 36.04185 37.0 36.0 37.0 34.6 38.0 15-19 36.03155 37.0 36.0 37.0 34.6 38.0 20-24 35.97095 37.0 36.0 37.0 34.2 38.0 25-29 36.050650000000005 37.0 36.0 37.0 34.8 38.0 30-34 35.9675 37.0 36.0 37.0 34.2 38.0 35-39 35.9671 37.0 36.0 37.0 34.0 38.0 40-44 35.8947 37.0 36.0 37.0 34.0 38.0 45-49 35.907849999999996 37.0 36.0 37.0 34.0 38.0 50-54 35.789550000000006 37.0 36.0 37.0 34.0 38.0 55-59 35.79185 37.0 36.0 37.0 34.0 38.0 60-64 35.774649999999994 37.0 36.0 37.0 34.0 38.0 65-69 35.70025 37.0 36.0 37.0 33.8 38.0 70-74 35.674350000000004 37.0 36.0 37.0 33.8 38.0 75-79 35.62145 37.0 36.0 37.0 33.2 38.0 80-84 35.490700000000004 37.0 36.0 37.0 33.0 38.0 85-89 35.44345 37.0 36.0 37.0 33.0 38.0 90-94 35.3548 37.0 36.0 37.0 32.4 38.0 95-99 35.3059 37.0 36.0 37.0 32.2 38.0 100-104 35.16825 37.0 36.0 37.0 31.8 38.0 105-109 35.06105 37.0 35.8 37.0 31.2 38.0 110-114 34.86695 37.0 35.4 37.0 30.2 38.0 115-119 34.82845 37.0 35.0 37.0 30.4 38.0 120-124 34.72805 37.0 35.0 37.0 29.6 38.0 125-129 34.5015 37.0 35.0 37.0 28.4 38.0 130-134 34.373749999999994 37.0 35.0 37.0 28.0 38.0 135-139 34.22555 37.0 35.0 37.0 27.2 38.0 140-144 34.016 37.0 34.8 37.0 26.2 38.0 145-149 33.844500000000004 37.0 35.0 37.0 25.2 38.0 150 33.57775 37.0 34.0 37.0 24.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 7.0 28 40.0 29 64.0 30 97.0 31 136.0 32 183.0 33 260.0 34 404.0 35 770.0 36 1407.0 37 632.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.475 17.025000000000002 12.125 36.375 2 18.35 23.549999999999997 45.2 12.9 3 15.875 26.950000000000003 32.425 24.75 4 20.7 35.625 26.8 16.875 5 18.85 37.35 27.85 15.950000000000001 6 15.825 36.125 28.775000000000002 19.275000000000002 7 14.774999999999999 14.875 47.175 23.175 8 18.675 22.125 29.425 29.775000000000002 9 20.625 22.225 30.099999999999998 27.05 10-14 21.63 29.54 27.045 21.785 15-19 21.62 28.904999999999998 28.185 21.29 20-24 21.6 28.435 28.52 21.445 25-29 21.935 28.970000000000002 27.66 21.435000000000002 30-34 22.02 28.77 27.839999999999996 21.37 35-39 21.93 28.79 27.555000000000003 21.725 40-44 22.189999999999998 28.435 27.79 21.584999999999997 45-49 22.325 28.965000000000003 27.284999999999997 21.425 50-54 22.259999999999998 28.26 27.900000000000002 21.58 55-59 22.040000000000003 28.475 28.57 20.915 60-64 22.1 28.910000000000004 27.205000000000002 21.785 65-69 22.735 28.499999999999996 27.61 21.154999999999998 70-74 22.215 28.89 27.675 21.22 75-79 21.985 28.425 28.375 21.215 80-84 21.865000000000002 28.194999999999997 28.02 21.92 85-89 22.615 28.744999999999997 27.435 21.205 90-94 22.395 28.244999999999997 28.275 21.085 95-99 22.305 28.075 27.88 21.740000000000002 100-104 22.365 28.645 27.955000000000002 21.035 105-109 22.405 28.105000000000004 27.889999999999997 21.6 110-114 22.869999999999997 27.255000000000003 28.535 21.34 115-119 21.834999999999997 28.044999999999998 28.494999999999997 21.625 120-124 22.645 28.525 27.105 21.725 125-129 22.79 28.165000000000003 28.144999999999996 20.9 130-134 22.425 28.444999999999997 27.33 21.8 135-139 22.58 28.325 27.63 21.465 140-144 22.611130556527826 27.886394319715986 27.85639281964098 21.646082304115204 145-149 22.89614480724036 28.351417570878546 27.30636531826591 21.44607230361518 150 23.9 28.1 26.650000000000002 21.349999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.5 20 1.0 21 2.5 22 5.0 23 5.5 24 6.0 25 11.0 26 11.0 27 9.0 28 14.5 29 19.5 30 27.0 31 33.0 32 42.5 33 59.5 34 64.0 35 74.5 36 101.5 37 122.5 38 125.5 39 157.0 40 197.0 41 215.0 42 250.5 43 258.5 44 269.0 45 280.5 46 260.0 47 237.0 48 202.0 49 172.5 50 157.0 51 145.0 52 121.5 53 89.5 54 66.0 55 48.0 56 31.0 57 23.5 58 20.0 59 14.5 60 11.5 61 8.5 62 7.5 63 6.0 64 3.5 65 2.5 66 1.5 67 1.0 68 1.0 69 1.0 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.005 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.275 #Duplication Level Percentage of deduplicated Percentage of total 1 98.32103790384126 96.625 2 1.6280844568812007 3.2 3 0.02543881963876876 0.075 4 0.02543881963876876 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGCATG 10 0.006973645 144.0 2 ATATTTG 10 0.006973645 144.0 3 >>END_MODULE SRR22954651 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22954651_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.93975 37.0 36.0 37.0 34.0 38.0 2 35.53625 37.0 36.0 37.0 34.0 38.0 3 36.04675 37.0 36.0 37.0 35.0 38.0 4 36.14575 37.0 36.0 37.0 35.0 38.0 5 36.0455 37.0 36.0 37.0 35.0 38.0 6 35.858 37.0 36.0 37.0 34.0 38.0 7 35.8235 37.0 36.0 37.0 34.0 38.0 8 36.10725 37.0 36.0 37.0 35.0 38.0 9 36.07225 37.0 36.0 37.0 35.0 38.0 10-14 36.05 37.0 36.0 37.0 34.8 38.0 15-19 35.98864999999999 37.0 36.0 37.0 34.4 38.0 20-24 35.97425 37.0 36.0 37.0 34.4 38.0 25-29 35.9517 37.0 36.0 37.0 34.0 38.0 30-34 35.8177 37.0 36.0 37.0 34.0 38.0 35-39 35.794450000000005 37.0 36.0 37.0 34.0 38.0 40-44 35.73585 37.0 36.0 37.0 33.8 38.0 45-49 35.73205 37.0 36.0 37.0 34.0 38.0 50-54 35.581450000000004 37.0 36.0 37.0 33.0 38.0 55-59 35.51055 37.0 36.0 37.0 33.0 38.0 60-64 35.40554999999999 37.0 36.0 37.0 32.6 38.0 65-69 35.3592 37.0 36.0 37.0 32.4 38.0 70-74 35.190599999999996 37.0 35.8 37.0 32.0 38.0 75-79 35.1108 37.0 35.8 37.0 31.4 38.0 80-84 34.862049999999996 37.0 35.0 37.0 30.6 38.0 85-89 34.783300000000004 37.0 35.0 37.0 30.4 38.0 90-94 34.5887 37.0 35.0 37.0 29.4 38.0 95-99 34.31825 37.0 35.0 37.0 27.6 38.0 100-104 34.07895 36.8 35.0 37.0 27.0 37.6 105-109 33.78015 36.2 34.4 37.0 25.2 37.4 110-114 33.619299999999996 36.0 34.4 37.0 24.6 37.0 115-119 33.369949999999996 36.0 34.0 37.0 23.4 37.0 120-124 33.06295 36.0 33.8 37.0 21.8 37.2 125-129 32.62904999999999 36.0 32.8 37.0 20.2 37.0 130-134 32.3829 36.0 32.0 37.0 19.4 37.0 135-139 32.22285 36.0 31.8 37.0 18.4 37.0 140-144 31.78215 36.0 30.8 37.0 16.8 37.0 145-149 31.338750000000005 36.0 29.6 37.0 15.2 37.0 150 31.0115 36.0 29.0 37.0 14.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 14.0 28 71.0 29 142.0 30 148.0 31 226.0 32 284.0 33 399.0 34 548.0 35 890.0 36 976.0 37 302.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.225 17.150000000000002 10.975 39.65 2 16.925 22.275 46.725 14.075 3 14.825 26.275 32.550000000000004 26.35 4 18.55 35.85 27.500000000000004 18.099999999999998 5 19.1 35.3 27.85 17.75 6 14.625 35.949999999999996 29.825000000000003 19.6 7 13.850000000000001 15.049999999999999 47.175 23.925 8 18.425 20.75 30.2 30.625000000000004 9 19.45 22.675 30.775000000000002 27.1 10-14 20.44 28.875 27.915 22.770000000000003 15-19 21.01 28.685 27.865000000000002 22.439999999999998 20-24 21.195 29.244999999999997 27.42 22.14 25-29 20.979999999999997 28.854999999999997 28.29 21.875 30-34 21.26 28.535 28.110000000000003 22.095000000000002 35-39 20.78 28.38 28.34 22.5 40-44 21.285 28.720000000000002 27.845 22.15 45-49 20.79 28.384999999999998 28.425 22.400000000000002 50-54 21.154999999999998 28.54 28.415000000000003 21.89 55-59 21.75 28.46 27.665 22.125 60-64 21.57 28.555000000000003 28.21 21.665 65-69 21.584999999999997 28.349999999999998 28.29 21.775 70-74 21.075 28.939999999999998 27.79 22.195 75-79 21.404999999999998 28.675 27.639999999999997 22.28 80-84 21.12 28.025 27.474999999999998 23.380000000000003 85-89 21.25 27.92 28.144999999999996 22.685 90-94 21.18 28.58 27.73 22.509999999999998 95-99 21.545 27.944999999999997 28.044999999999998 22.465 100-104 21.855 27.744999999999997 28.33 22.07 105-109 21.95 28.09 27.575 22.384999999999998 110-114 21.92609630481524 27.976398819940997 27.771388569428474 22.32611630581529 115-119 22.18 27.48 27.884999999999998 22.455 120-124 22.45 28.175 27.38 21.995 125-129 22.25111255562778 27.57637881894095 28.21141057052853 21.961098054902745 130-134 22.56612830641532 27.896394819740987 26.93134656732837 22.606130306515325 135-139 22.758413762064308 27.959193879081862 27.2590888633295 22.02330349552433 140-144 23.226161308065404 27.67138356917846 27.076353817690883 22.026101305065254 145-149 23.27732773277328 27.772777277727773 26.737673767376734 22.21222122212221 150 22.83070767691923 27.506876719179797 25.806451612903224 23.85596399099775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 1.0 20 2.0 21 2.0 22 2.5 23 4.0 24 5.5 25 6.5 26 10.0 27 15.5 28 17.5 29 19.0 30 28.0 31 41.5 32 54.0 33 55.5 34 56.5 35 72.0 36 93.5 37 116.5 38 142.0 39 167.5 40 193.0 41 215.0 42 239.5 43 256.0 44 275.5 45 276.5 46 259.0 47 237.5 48 216.0 49 191.5 50 151.0 51 137.5 52 120.5 53 81.0 54 50.0 55 38.5 56 32.0 57 26.5 58 24.0 59 16.5 60 11.0 61 10.0 62 7.5 63 4.5 64 4.0 65 5.0 66 3.0 67 1.0 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.005 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.005 135-139 0.015 140-144 0.005 145-149 0.01 150 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.1 #Duplication Level Percentage of deduplicated Percentage of total 1 98.11416921508665 96.25 2 1.834862385321101 3.5999999999999996 3 0.05096839959225281 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCACTA 10 0.006973645 144.0 2 TCCTCCT 30 0.0018473949 72.0 4 >>END_MODULE Read 1627578 spots for SRR22954651.sra Written 1627578 spots for SRR22954651.sra Read 1627578 spots for SRR22954651.sra Written 1627578 spots for SRR22954651.sra Read 1627578 spots for SRR22954651.sra Written 1627578 spots for SRR22954651.sra Read 1627578 spots for SRR22954651.sra Written 1627578 spots for SRR22954651.sra Read 1627578 spots for SRR22954651.sra Written 1627578 spots for SRR22954651.sra Read 1627578 spots for SRR22954651.sra Written 1627578 spots for SRR22954651.sra Read 1627578 spots for SRR22954651.sra Written 1627578 spots for SRR22954651.sra Read 1627578 spots for SRR22954651.sra Written 1627578 spots for SRR22954651.sra Read 1627578 spots for SRR22954651.sra Written 1627578 spots for SRR22954651.sra Read 1627578 spots for SRR22954651.sra Written 1627578 spots for SRR22954651.sra Read 1627578 spots for SRR22954651.sra Written 1627578 spots for SRR22954651.sra Read 1627578 spots for SRR22954651.sra Written 1627578 spots for SRR22954651.sra Read 1627578 spots for SRR22954651.sra Written 1627578 spots for SRR22954651.sra Read 1627578 spots for SRR22954651.sra Written 1627578 spots for SRR22954651.sra Read 1627578 spots for SRR22954651.sra Written 1627578 spots for SRR22954651.sra Read 1627578 spots for SRR22954651.sra Written 1627578 spots for SRR22954651.sra Read 1627578 spots for SRR22954651.sra Written 1627578 spots for SRR22954651.sra Read 1627578 spots for SRR22954651.sra Written 1627578 spots for SRR22954651.sra Read 1627578 spots for SRR22954651.sra Written 1627578 spots for SRR22954651.sra Read 1627581 spots for SRR22954651.sra Written 1627581 spots for SRR22954651.sra SRR ids: ['SRR22954651.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a2klc7a7 SRR22954651.sra spots: 32551563 blocks: [[1, 1627578], [1627579, 3255156], [3255157, 4882734], [4882735, 6510312], [6510313, 8137890], [8137891, 9765468], [9765469, 11393046], [11393047, 13020624], [13020625, 14648202], [14648203, 16275780], [16275781, 17903358], [17903359, 19530936], [19530937, 21158514], [21158515, 22786092], [22786093, 24413670], [24413671, 26041248], [26041249, 27668826], [27668827, 29296404], [29296405, 30923982], [30923983, 32551563]] SRR22954651 file size 11592002 SRR22954651 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22954651 SRR22954651_1.fastq SRR22954651_2.fastq Input file: SRR22954651_1.fastq Paired file: SRR22954651_2.fastq trimmed: SRR22954651-trimmed-pair1.fastq, SRR22954651-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:22:37 2025 >> started Thu Feb 13 16:23:22 2025 >> done (44.766s) 32551563 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 32551563 (100.00%) read pairs available; of these: 3249254 ( 9.98%) trimmed read pairs available after processing 29302309 (90.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 138 1 0.00% 139 0 0.00% 140 7 0.00% 141 37 0.00% 142 229 0.00% 143 206 0.00% 144 184 0.00% 145 162 0.00% 146 156 0.00% 147 1148 0.00% 148 51411 0.16% 149 3195713 9.82% 150 29302309 90.02% 32551563 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=67.67 fanout-score-rank=1 prefix-density=1.21 prefix-fanout=29.3 sequence=AAGTCGGAGGCCAAGGGG criterion=fanout-score sequence-density=0.52 sequence-density-rank=1 fanout-score=67.67 fanout-score-rank=1 prefix-density=1.21 prefix-fanout=29.3 sequence=AAGTCGGAGGCCAAGGGG criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=71.31 fanout-score-rank=3 prefix-density=1.01 prefix-fanout=30.3 sequence=AAGTCGGATCGTAGCCATGTCGT criterion=fanout-score sequence-density=0.03 sequence-density-rank=37 fanout-score=156.37 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=13.7 sequence=TGGTGCTGGTGTAGTGAAGGGTCTCCAAGGAAGCCACAACTACGAGCTTCAGGGTGGCGGAGCTAATGTTGTGAATCATGGATACACCAAGGGTGATGGCCTTGGTGCGGAGATAGTCGGTACCTTTGTTCTTGTCTACACTGTCTTCTCTGCTACTGATGCCAAGAGAAACGCTAGAGACTCTCATGTCCCTATTTTGGCTCCCCTTCCCATTGGATTTGCAGTCTTCTTGGTTCATTTGGCTACCATCCCCATAACTGGAACTGGCATTAACCCGGCAAGGAGTCTTGGAGCCGCCATCATCTTCAACAAAGACCATGCATGGGATGACCACTGGATCTTCTGGGTTGGCCCATTCATTGGAGCTGCTCTTGCCGCTGTCTACCACCAGATAGTCATTAGAGCCATTCCTTTCAAGAGCAGAGCTTAATTTCGTTCGCCCTTTCAAGAATCACACCATCTCACAACTTCTTCTATCCTTGTTTGAACTTTGGCTT SRR22954651 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:24:12 Started mapping on | Feb 13 16:24:12 Finished on | Feb 13 16:28:02 Mapping speed, Million of reads per hour | 509.50 Number of input reads | 32551563 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 31044067 Uniquely mapped reads % | 95.37% Average mapped length | 296.74 Number of splices: Total | 24898432 Number of splices: Annotated (sjdb) | 24428726 Number of splices: GT/AG | 24533739 Number of splices: GC/AG | 275946 Number of splices: AT/AC | 25493 Number of splices: Non-canonical | 63254 Mismatch rate per base, % | 0.94% Deletion rate per base | 0.02% Deletion average length | 2.39 Insertion rate per base | 0.01% Insertion average length | 1.89 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 601366 % of reads mapped to multiple loci | 1.85% Number of reads mapped to too many loci | 945 % of reads mapped to too many loci | 0.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.77% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 906130 906130 906130 N_multimapping 601366 601366 601366 N_noFeature 1001543 15227791 16431516 N_ambiguous 544493 84438 75351 UnstrandedReadsAssigned:29498031 PositiveStrandReadsAssigned:15731838 NegativeStrandReadsAssigned:14537200 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR22954651 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22954651-trimmed-pair1.fastq SRR22954651-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,551,563 reads, 30,669,191 reads pseudoaligned [quant] estimated average fragment length: 230.925 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,147 rounds 52401 SRR22954651.ke.tsv 34699 SRR22954651.se.tsv 87100 total ==> SRR22954651.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.08 1714 30.9101 Potri.005G024800.1.v4.1 1035 805.075 223 8.93189 Potri.004G059700.1.v4.1 961 731.075 43 1.89662 Potri.007G009000.2.v4.1 1416 1186.08 0 0 Potri.003G141000.2.v4.1 2943 2713.08 512.371 6.08973 Potri.016G087400.1.v4.1 270 71.8526 1555 697.851 Potri.015G069301.1.v4.1 564 334.462 0 0 Potri.010G195200.1.v4.1 1773 1543.08 94.4356 1.97344 Potri.012G127500.1.v4.1 977 747.075 2715 117.187 ==> SRR22954651.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5064 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 1483 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 111 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR22954651 completed mapping pipeline successfully