Starting /dee2/code/volunteer_pipeline.sh SRR22954652 current disk space = 3088715599872 free memory = 1452997700 SRR22954652 SRAfilesize e3b27b9a4261cb08adf0f641229ac07c SRR22954652.sra SRR22954652.sra file validated SRR22954652 is paired end SRR22954652 is conventional basespace SRR22954652 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22954652_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.99025 37.0 36.0 37.0 34.0 38.0 2 35.5455 37.0 36.0 37.0 34.0 38.0 3 36.1515 37.0 36.0 37.0 35.0 38.0 4 36.19425 37.0 36.0 37.0 35.0 38.0 5 36.301 37.0 36.0 37.0 35.0 38.0 6 36.10825 37.0 36.0 37.0 35.0 38.0 7 36.09475 37.0 36.0 37.0 35.0 38.0 8 36.26525 37.0 36.0 37.0 35.0 38.0 9 36.187 37.0 36.0 37.0 35.0 38.0 10-14 36.19035 37.0 36.0 37.0 35.0 38.0 15-19 36.161950000000004 37.0 36.0 37.0 35.0 38.0 20-24 36.10845 37.0 36.0 37.0 35.0 38.0 25-29 36.107899999999994 37.0 36.0 37.0 35.0 38.0 30-34 36.0891 37.0 36.0 37.0 35.0 38.0 35-39 36.08115 37.0 36.0 37.0 35.0 38.0 40-44 36.03625 37.0 36.0 37.0 35.0 38.0 45-49 36.029199999999996 37.0 36.0 37.0 34.6 38.0 50-54 35.9973 37.0 36.0 37.0 34.6 38.0 55-59 35.9695 37.0 36.0 37.0 34.4 38.0 60-64 35.910000000000004 37.0 36.0 37.0 34.0 38.0 65-69 35.8229 37.0 36.0 37.0 34.0 38.0 70-74 35.8066 37.0 36.0 37.0 34.0 38.0 75-79 35.75225 37.0 36.0 37.0 34.0 38.0 80-84 35.6183 37.0 36.0 37.0 33.6 38.0 85-89 35.55615 37.0 36.0 37.0 33.0 38.0 90-94 35.4711 37.0 36.0 37.0 33.0 38.0 95-99 35.413650000000004 37.0 36.0 37.0 32.8 38.0 100-104 35.32 37.0 36.0 37.0 32.4 38.0 105-109 35.253 37.0 36.0 37.0 32.0 38.0 110-114 34.9932 37.0 35.8 37.0 30.8 38.0 115-119 35.014849999999996 37.0 36.0 37.0 30.8 38.0 120-124 34.875 37.0 35.4 37.0 30.4 38.0 125-129 34.7215 37.0 35.4 37.0 29.8 38.0 130-134 34.6668 37.0 35.0 37.0 29.0 38.0 135-139 34.405 37.0 35.0 37.0 28.2 38.0 140-144 34.23625 37.0 35.0 37.0 27.0 38.0 145-149 33.98785 37.0 35.0 37.0 25.6 38.0 150 33.78575 37.0 35.0 37.0 25.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 4.0 28 33.0 29 53.0 30 67.0 31 111.0 32 168.0 33 261.0 34 371.0 35 766.0 36 1492.0 37 674.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.15 16.3 11.4 37.15 2 17.35433858464616 25.28132033008252 43.86096524131033 13.50337584396099 3 15.55 28.375 31.5 24.575 4 20.150000000000002 37.4 23.825 18.625 5 19.05 38.074999999999996 26.75 16.125 6 16.175 37.125 27.500000000000004 19.2 7 14.35 14.924999999999999 47.949999999999996 22.775000000000002 8 18.75 22.425 29.175 29.65 9 20.474999999999998 23.125 28.549999999999997 27.85 10-14 21.12 29.110000000000003 27.08 22.689999999999998 15-19 21.33 28.494999999999997 28.435 21.740000000000002 20-24 22.335 28.785 27.529999999999998 21.349999999999998 25-29 21.959999999999997 29.48 27.175 21.385 30-34 22.08 28.815 27.474999999999998 21.63 35-39 22.17 29.535 27.145000000000003 21.15 40-44 21.935 29.345 27.175 21.545 45-49 21.75 28.754999999999995 27.66 21.834999999999997 50-54 22.08 28.285 28.13 21.505 55-59 22.105 29.115000000000002 27.42 21.36 60-64 22.24 28.96 27.334999999999997 21.465 65-69 21.995 28.689999999999998 28.035 21.279999999999998 70-74 22.095000000000002 28.610000000000003 27.685 21.61 75-79 21.68 28.175 28.849999999999998 21.295 80-84 22.335 27.68 28.1 21.884999999999998 85-89 21.935 28.355000000000004 28.075 21.634999999999998 90-94 21.645 28.444999999999997 27.955000000000002 21.955 95-99 22.445 28.645 27.58 21.33 100-104 22.3 28.435 28.199999999999996 21.065 105-109 21.565 28.29 28.42 21.725 110-114 22.66 27.79 28.294999999999998 21.255 115-119 22.05 28.315 28.1 21.535 120-124 22.275 27.800000000000004 28.605000000000004 21.32 125-129 22.63 27.839999999999996 27.939999999999998 21.59 130-134 22.37 28.64 27.76 21.23 135-139 22.509999999999998 28.105000000000004 28.02 21.365000000000002 140-144 22.935 28.32 27.29 21.455 145-149 23.674999999999997 28.060000000000002 26.715 21.55 150 22.525000000000002 27.900000000000002 27.474999999999998 22.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 1.0 21 1.5 22 2.0 23 2.5 24 3.5 25 3.0 26 8.0 27 12.5 28 11.0 29 15.0 30 22.0 31 37.5 32 50.0 33 62.0 34 73.5 35 88.5 36 102.5 37 114.0 38 138.0 39 165.5 40 185.0 41 212.0 42 238.0 43 245.5 44 264.0 45 280.5 46 267.5 47 246.0 48 228.5 49 190.5 50 156.5 51 137.5 52 107.0 53 79.0 54 66.0 55 48.5 56 31.5 57 26.5 58 19.5 59 14.5 60 12.0 61 8.5 62 6.5 63 3.5 64 2.0 65 3.0 66 2.5 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.32231825114387 96.7 2 1.677681748856126 3.3000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAGGCT 10 0.006973645 144.0 1 >>END_MODULE SRR22954652 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22954652_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0535 37.0 36.0 37.0 35.0 38.0 2 35.49625 37.0 36.0 37.0 34.0 38.0 3 36.16625 37.0 36.0 37.0 35.0 38.0 4 36.18575 37.0 36.0 37.0 35.0 38.0 5 36.125 37.0 36.0 37.0 35.0 38.0 6 36.16125 37.0 36.0 37.0 35.0 38.0 7 35.85575 37.0 36.0 37.0 34.0 38.0 8 36.29825 37.0 36.0 37.0 35.0 38.0 9 36.144 37.0 36.0 37.0 35.0 38.0 10-14 36.0653 37.0 36.0 37.0 34.6 38.0 15-19 36.0347 37.0 36.0 37.0 34.8 38.0 20-24 36.02655 37.0 36.0 37.0 34.4 38.0 25-29 35.969 37.0 36.0 37.0 34.4 38.0 30-34 35.814949999999996 37.0 36.0 37.0 34.0 38.0 35-39 35.8053 37.0 36.0 37.0 34.0 38.0 40-44 35.7435 37.0 36.0 37.0 33.8 38.0 45-49 35.728449999999995 37.0 36.0 37.0 34.0 38.0 50-54 35.5409 37.0 36.0 37.0 33.2 38.0 55-59 35.50599999999999 37.0 36.0 37.0 32.8 38.0 60-64 35.46040000000001 37.0 36.0 37.0 32.8 38.0 65-69 35.21235 37.0 35.8 37.0 31.8 38.0 70-74 35.08885 37.0 35.6 37.0 31.2 38.0 75-79 35.11815 37.0 35.8 37.0 31.4 38.0 80-84 34.7909 37.0 35.0 37.0 29.8 38.0 85-89 34.728699999999996 37.0 35.0 37.0 30.0 38.0 90-94 34.41735 37.0 35.0 37.0 28.2 38.0 95-99 34.24974999999999 37.0 35.0 37.0 27.4 38.0 100-104 33.8646 36.6 35.0 37.0 25.8 38.0 105-109 33.72455 36.4 34.4 37.0 24.8 38.0 110-114 33.5604 36.0 34.2 37.0 24.2 38.0 115-119 33.3389 36.0 34.0 37.0 23.2 37.8 120-124 32.8763 36.0 33.2 37.0 21.0 37.4 125-129 32.49515 36.0 32.4 37.0 19.8 37.0 130-134 31.930049999999994 36.0 31.2 37.0 17.2 37.0 135-139 31.899900000000002 36.0 31.2 37.0 17.4 37.0 140-144 31.5279 36.0 30.2 37.0 15.8 37.0 145-149 31.05575 36.0 28.8 37.0 14.6 37.0 150 30.947 36.0 29.0 37.0 14.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 23.0 28 65.0 29 122.0 30 149.0 31 243.0 32 296.0 33 443.0 34 600.0 35 875.0 36 935.0 37 249.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.825 15.950000000000001 12.2 38.025 2 17.275 23.525 45.425 13.775 3 15.875 26.325 32.824999999999996 24.975 4 18.875 35.8 27.3 18.025 5 19.325 35.425000000000004 27.675 17.575 6 15.4 35.675000000000004 29.15 19.775000000000002 7 14.399999999999999 15.1 47.0 23.5 8 18.675 21.725 29.275000000000002 30.325000000000003 9 19.8 23.825 28.499999999999996 27.875 10-14 20.275000000000002 28.96 27.700000000000003 23.064999999999998 15-19 20.45 28.79 28.349999999999998 22.41 20-24 20.685000000000002 28.355000000000004 28.349999999999998 22.61 25-29 20.830000000000002 28.605000000000004 28.134999999999998 22.43 30-34 20.905 28.555000000000003 27.889999999999997 22.650000000000002 35-39 21.065 28.595 27.72 22.62 40-44 21.044999999999998 28.71 27.834999999999997 22.41 45-49 21.345 29.065 27.415 22.175 50-54 21.279999999999998 28.854999999999997 27.79 22.075 55-59 21.26 28.384999999999998 28.01 22.345000000000002 60-64 20.875 28.705000000000002 28.060000000000002 22.36 65-69 21.21 28.599999999999998 27.555000000000003 22.634999999999998 70-74 21.27 28.915000000000003 27.48 22.335 75-79 20.86 28.799999999999997 28.18 22.16 80-84 21.465 28.799999999999997 27.725 22.009999999999998 85-89 21.505 28.265 27.865000000000002 22.365 90-94 21.82 27.694999999999997 28.065 22.42 95-99 21.765 27.845 27.785 22.605 100-104 22.34 27.71 28.235 21.715 105-109 21.93 28.08 27.889999999999997 22.1 110-114 22.134999999999998 28.24 27.834999999999997 21.790000000000003 115-119 21.759999999999998 27.43 28.065 22.745 120-124 22.48612430621531 27.27636381819091 27.68638431921596 22.55112755637782 125-129 23.05 27.29 27.625 22.035 130-134 23.336166808340415 27.466373318665934 27.001350067503378 22.196109805490273 135-139 22.97614880744037 27.04135206760338 27.78638931946597 22.196109805490273 140-144 24.223633545031756 27.064059608941342 26.77901685252788 21.933289993499024 145-149 24.021201060053002 27.001350067503378 27.096354817740888 21.881094054702736 150 22.83070767691923 28.107026756689173 26.60665166291573 22.455613903475868 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 4.5 23 4.5 24 5.0 25 5.5 26 4.5 27 10.0 28 15.0 29 17.0 30 26.0 31 41.5 32 55.0 33 66.0 34 80.0 35 90.5 36 106.0 37 116.5 38 118.5 39 150.5 40 185.0 41 205.5 42 233.5 43 247.0 44 248.0 45 260.0 46 277.0 47 260.5 48 225.0 49 190.5 50 155.5 51 133.5 52 108.0 53 83.5 54 67.5 55 50.5 56 37.5 57 30.5 58 21.5 59 13.5 60 11.5 61 9.5 62 7.5 63 7.5 64 5.0 65 2.5 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.005 125-129 0.0 130-134 0.005 135-139 0.005 140-144 0.015 145-149 0.005 150 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.175 #Duplication Level Percentage of deduplicated Percentage of total 1 98.14107461166284 96.35000000000001 2 1.8589253883371528 3.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0125 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.0 0.0 0.0 0.025 0.0 84-85 0.0 0.0 0.0 0.025 0.0 86-87 0.0 0.0 0.0 0.025 0.0 88-89 0.0 0.0 0.0 0.025 0.0 90-91 0.0 0.0 0.0 0.025 0.0 92-93 0.0 0.0 0.0 0.025 0.0 94-95 0.0 0.0 0.0 0.025 0.0 96-97 0.0 0.0 0.0 0.025 0.0 98-99 0.0 0.0 0.0 0.025 0.0 100-101 0.0 0.0 0.0 0.025 0.0 102-103 0.0 0.0 0.0 0.025 0.0 104-105 0.0 0.0 0.0 0.025 0.0 106-107 0.0 0.0 0.0 0.025 0.0 108-109 0.0 0.0 0.0 0.025 0.0 110-111 0.0 0.0 0.0 0.025 0.0 112-113 0.0 0.0 0.0 0.025 0.0 114-115 0.0 0.0 0.0 0.025 0.0 116-117 0.0 0.0 0.0 0.025 0.0 118-119 0.0 0.0 0.0 0.025 0.0 120-121 0.0 0.0 0.0 0.025 0.0 122-123 0.0 0.0 0.0 0.025 0.0 124-125 0.0 0.0 0.0 0.025 0.0 126-127 0.0 0.0 0.0 0.025 0.0 128-129 0.0 0.0 0.0 0.025 0.0 130-131 0.0 0.0 0.0 0.025 0.0 132-133 0.0 0.0 0.0 0.025 0.0 134-135 0.0 0.0 0.0 0.025 0.0 136-137 0.0 0.0 0.0 0.025 0.0 138 0.0 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1753738 spots for SRR22954652.sra Written 1753738 spots for SRR22954652.sra Read 1753738 spots for SRR22954652.sra Written 1753738 spots for SRR22954652.sra Read 1753738 spots for SRR22954652.sra Written 1753738 spots for SRR22954652.sra Read 1753753 spots for SRR22954652.sra Written 1753753 spots for SRR22954652.sra Read 1753738 spots for SRR22954652.sra Written 1753738 spots for SRR22954652.sra Read 1753738 spots for SRR22954652.sra Written 1753738 spots for SRR22954652.sra Read 1753738 spots for SRR22954652.sra Written 1753738 spots for SRR22954652.sra Read 1753738 spots for SRR22954652.sra Written 1753738 spots for SRR22954652.sra Read 1753738 spots for SRR22954652.sra Written 1753738 spots for SRR22954652.sra Read 1753738 spots for SRR22954652.sra Written 1753738 spots for SRR22954652.sra Read 1753738 spots for SRR22954652.sra Written 1753738 spots for SRR22954652.sra Read 1753738 spots for SRR22954652.sra Written 1753738 spots for SRR22954652.sra Read 1753738 spots for SRR22954652.sra Written 1753738 spots for SRR22954652.sra Read 1753738 spots for SRR22954652.sra Written 1753738 spots for SRR22954652.sra Read 1753738 spots for SRR22954652.sra Written 1753738 spots for SRR22954652.sra Read 1753738 spots for SRR22954652.sra Written 1753738 spots for SRR22954652.sra Read 1753738 spots for SRR22954652.sra Written 1753738 spots for SRR22954652.sra Read 1753738 spots for SRR22954652.sra Written 1753738 spots for SRR22954652.sra Read 1753738 spots for SRR22954652.sra Written 1753738 spots for SRR22954652.sra Read 1753738 spots for SRR22954652.sra Written 1753738 spots for SRR22954652.sra SRR ids: ['SRR22954652.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4mc8f5o3 SRR22954652.sra spots: 35074775 blocks: [[1, 1753738], [1753739, 3507476], [3507477, 5261214], [5261215, 7014952], [7014953, 8768690], [8768691, 10522428], [10522429, 12276166], [12276167, 14029904], [14029905, 15783642], [15783643, 17537380], [17537381, 19291118], [19291119, 21044856], [21044857, 22798594], [22798595, 24552332], [24552333, 26306070], [26306071, 28059808], [28059809, 29813546], [29813547, 31567284], [31567285, 33321022], [33321023, 35074775]] SRR22954652 file size 12491389 SRR22954652 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22954652 SRR22954652_1.fastq SRR22954652_2.fastq Input file: SRR22954652_1.fastq Paired file: SRR22954652_2.fastq trimmed: SRR22954652-trimmed-pair1.fastq, SRR22954652-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:42:17 2025 >> started Thu Feb 13 16:43:00 2025 >> done (42.620s) 35074775 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 35074775 (100.00%) read pairs available; of these: 3415510 ( 9.74%) trimmed read pairs available after processing 31659265 (90.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 139 1 0.00% 140 6 0.00% 141 19 0.00% 142 161 0.00% 143 157 0.00% 144 137 0.00% 145 137 0.00% 146 148 0.00% 147 1098 0.00% 148 49812 0.14% 149 3363834 9.59% 150 31659265 90.26% 35074775 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=65.37 fanout-score-rank=1 prefix-density=1.12 prefix-fanout=28.7 sequence=AAGTCGGAGGCCAAGG criterion=fanout-score sequence-density=0.49 sequence-density-rank=1 fanout-score=65.37 fanout-score-rank=1 prefix-density=1.12 prefix-fanout=28.7 sequence=AAGTCGGAGGCCAAGG criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=67.76 fanout-score-rank=3 prefix-density=0.99 prefix-fanout=29.8 sequence=AAGTCGGATCGTAGCCATGTCG criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=195.36 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=14.9 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCGCAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGAAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC SRR22954652 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:43:44 Started mapping on | Feb 13 16:43:44 Finished on | Feb 13 16:47:23 Mapping speed, Million of reads per hour | 576.57 Number of input reads | 35074775 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 33428680 Uniquely mapped reads % | 95.31% Average mapped length | 296.80 Number of splices: Total | 25243725 Number of splices: Annotated (sjdb) | 24774648 Number of splices: GT/AG | 24862776 Number of splices: GC/AG | 286617 Number of splices: AT/AC | 27380 Number of splices: Non-canonical | 66952 Mismatch rate per base, % | 0.93% Deletion rate per base | 0.02% Deletion average length | 2.39 Insertion rate per base | 0.02% Insertion average length | 1.88 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 674693 % of reads mapped to multiple loci | 1.92% Number of reads mapped to too many loci | 1123 % of reads mapped to too many loci | 0.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.76% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 971402 971402 971402 N_multimapping 674693 674693 674693 N_noFeature 959249 16312970 17620990 N_ambiguous 624463 91433 81001 UnstrandedReadsAssigned:31844968 PositiveStrandReadsAssigned:17024277 NegativeStrandReadsAssigned:15726689 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR22954652 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22954652-trimmed-pair1.fastq SRR22954652-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,074,775 reads, 33,177,259 reads pseudoaligned [quant] estimated average fragment length: 230.159 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,320 rounds 52401 SRR22954652.ke.tsv 34699 SRR22954652.se.tsv 87100 total ==> SRR22954652.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.84 1456 22.7685 Potri.005G024800.1.v4.1 1035 805.841 273 9.47672 Potri.004G059700.1.v4.1 961 731.857 42 1.60534 Potri.007G009000.2.v4.1 1416 1186.84 0 0 Potri.003G141000.2.v4.1 2943 2713.84 529.08 5.45358 Potri.016G087400.1.v4.1 270 71.0315 2204.01 867.974 Potri.015G069301.1.v4.1 564 335.185 0 0 Potri.010G195200.1.v4.1 1773 1543.84 137.518 2.49174 Potri.012G127500.1.v4.1 977 747.852 3500 130.917 ==> SRR22954652.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6185 Potri.001G233950.v4.1 9 Potri.001G122700.v4.1 2127 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 122 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 11 SRR22954652 completed mapping pipeline successfully