Starting /dee2/code/volunteer_pipeline.sh SRR22954653 current disk space = 3088860033024 free memory = 1490625520 SRR22954653 SRAfilesize 1df60e0352b03f92969d464556912261 SRR22954653.sra SRR22954653.sra file validated SRR22954653 is paired end SRR22954653 is conventional basespace SRR22954653 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22954653_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.847 37.0 36.0 37.0 34.0 38.0 2 35.57375 37.0 36.0 37.0 33.0 38.0 3 35.9895 37.0 36.0 37.0 35.0 38.0 4 36.08175 37.0 36.0 37.0 35.0 38.0 5 36.174 37.0 36.0 37.0 35.0 38.0 6 35.93775 37.0 36.0 37.0 34.0 38.0 7 36.03675 37.0 36.0 37.0 35.0 38.0 8 36.11925 37.0 36.0 37.0 35.0 38.0 9 36.0805 37.0 36.0 37.0 34.0 38.0 10-14 36.0497 37.0 36.0 37.0 35.0 38.0 15-19 36.0565 37.0 36.0 37.0 34.8 38.0 20-24 36.00345 37.0 36.0 37.0 34.8 38.0 25-29 35.967 37.0 36.0 37.0 34.4 38.0 30-34 35.9624 37.0 36.0 37.0 34.0 38.0 35-39 35.9625 37.0 36.0 37.0 34.4 38.0 40-44 35.88439999999999 37.0 36.0 37.0 34.0 38.0 45-49 35.96035 37.0 36.0 37.0 34.2 38.0 50-54 35.86685 37.0 36.0 37.0 34.0 38.0 55-59 35.79335 37.0 36.0 37.0 34.0 38.0 60-64 35.77284999999999 37.0 36.0 37.0 34.0 38.0 65-69 35.701499999999996 37.0 36.0 37.0 33.8 38.0 70-74 35.682900000000004 37.0 36.0 37.0 33.8 38.0 75-79 35.66405 37.0 36.0 37.0 33.4 38.0 80-84 35.4877 37.0 36.0 37.0 33.0 38.0 85-89 35.402049999999996 37.0 36.0 37.0 32.6 38.0 90-94 35.3652 37.0 36.0 37.0 32.4 38.0 95-99 35.3332 37.0 36.0 37.0 32.2 38.0 100-104 35.243399999999994 37.0 36.0 37.0 31.8 38.0 105-109 35.06080000000001 37.0 35.8 37.0 31.2 38.0 110-114 34.95195 37.0 35.4 37.0 30.8 38.0 115-119 34.936099999999996 37.0 35.4 37.0 30.8 38.0 120-124 34.76705 37.0 35.2 37.0 30.0 38.0 125-129 34.54809999999999 37.0 35.0 37.0 28.6 38.0 130-134 34.418549999999996 37.0 35.0 37.0 28.0 38.0 135-139 34.27095 37.0 35.0 37.0 27.4 38.0 140-144 34.058299999999996 37.0 35.0 37.0 26.4 38.0 145-149 33.8384 37.0 35.0 37.0 25.4 38.0 150 33.795 37.0 35.0 37.0 25.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 3.0 28 35.0 29 72.0 30 85.0 31 119.0 32 173.0 33 269.0 34 418.0 35 800.0 36 1414.0 37 612.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.65 16.575 13.8 33.975 2 17.5 24.825 43.15 14.524999999999999 3 16.925 28.625 31.674999999999997 22.775000000000002 4 20.925 36.35 25.124999999999996 17.599999999999998 5 19.900000000000002 37.0 25.8 17.299999999999997 6 16.0 35.225 29.75 19.025 7 14.899999999999999 15.85 46.325 22.925 8 19.975 21.25 29.375 29.4 9 20.175 22.425 29.15 28.249999999999996 10-14 21.154999999999998 29.080000000000002 26.815 22.95 15-19 21.015 28.194999999999997 28.389999999999997 22.400000000000002 20-24 22.39 28.665000000000003 27.615000000000002 21.33 25-29 21.39 29.115000000000002 27.74 21.755 30-34 21.345 29.49 27.435 21.73 35-39 21.84 28.62 27.67 21.87 40-44 22.1 29.23 26.795 21.875 45-49 22.145 29.085 27.42 21.349999999999998 50-54 21.759999999999998 28.610000000000003 27.58 22.05 55-59 22.225 28.43 27.944999999999997 21.4 60-64 21.775 28.77 27.644999999999996 21.81 65-69 21.69 28.685 27.72 21.905 70-74 21.8 28.470000000000002 28.110000000000003 21.62 75-79 22.115000000000002 28.54 27.634999999999998 21.709999999999997 80-84 22.415 28.915000000000003 27.12 21.55 85-89 22.55 28.265 27.855 21.33 90-94 22.56 28.395 27.54 21.505 95-99 22.005 28.065 28.065 21.865000000000002 100-104 21.67 28.535 27.845 21.95 105-109 22.915 28.384999999999998 27.615000000000002 21.085 110-114 22.48 28.115000000000002 27.779999999999998 21.625 115-119 22.685 28.09 27.72 21.505 120-124 22.869999999999997 28.084999999999997 27.334999999999997 21.709999999999997 125-129 22.705000000000002 28.355000000000004 27.384999999999998 21.555 130-134 22.73 27.79 27.97 21.51 135-139 22.805 28.09 27.515 21.59 140-144 22.79 28.360000000000003 27.175 21.675 145-149 24.0 28.38 26.55 21.07 150 24.05 27.55 27.750000000000004 20.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 1.0 20 1.5 21 1.0 22 2.0 23 2.5 24 4.5 25 10.0 26 12.5 27 11.0 28 15.0 29 23.0 30 27.0 31 38.5 32 48.5 33 57.5 34 73.5 35 85.0 36 95.5 37 112.0 38 134.5 39 150.0 40 177.0 41 209.0 42 228.0 43 253.5 44 259.5 45 256.0 46 249.5 47 236.0 48 221.5 49 204.5 50 177.0 51 136.5 52 109.0 53 83.5 54 66.5 55 51.0 56 37.5 57 34.5 58 29.0 59 20.0 60 15.0 61 11.5 62 6.0 63 5.5 64 4.0 65 2.5 66 3.0 67 2.5 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.8 #Duplication Level Percentage of deduplicated Percentage of total 1 97.7760736196319 95.625 2 2.198364008179959 4.3 3 0.025562372188139063 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAAGAT 10 0.006973645 144.0 1 GTTTTTG 10 0.006973645 144.0 1 GAATTTC 10 0.006973645 144.0 3 >>END_MODULE SRR22954653 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22954653_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.11275 37.0 36.0 37.0 35.0 38.0 2 35.66225 37.0 36.0 37.0 34.0 38.0 3 36.06175 37.0 36.0 37.0 35.0 38.0 4 36.16975 37.0 36.0 37.0 35.0 38.0 5 36.207 37.0 36.0 37.0 35.0 38.0 6 36.05625 37.0 36.0 37.0 35.0 38.0 7 35.86575 37.0 36.0 37.0 34.0 38.0 8 36.21 37.0 36.0 37.0 35.0 38.0 9 36.07875 37.0 36.0 37.0 35.0 38.0 10-14 36.07025 37.0 36.0 37.0 34.6 38.0 15-19 36.02675000000001 37.0 36.0 37.0 34.4 38.0 20-24 35.994299999999996 37.0 36.0 37.0 34.4 38.0 25-29 35.956849999999996 37.0 36.0 37.0 34.2 38.0 30-34 35.914249999999996 37.0 36.0 37.0 34.0 38.0 35-39 35.8248 37.0 36.0 37.0 34.0 38.0 40-44 35.75789999999999 37.0 36.0 37.0 34.0 38.0 45-49 35.743550000000006 37.0 36.0 37.0 34.0 38.0 50-54 35.6597 37.0 36.0 37.0 33.6 38.0 55-59 35.53415 37.0 36.0 37.0 33.0 38.0 60-64 35.50815 37.0 36.0 37.0 33.0 38.0 65-69 35.3399 37.0 36.0 37.0 32.2 38.0 70-74 35.2509 37.0 36.0 37.0 31.8 38.0 75-79 35.231049999999996 37.0 36.0 37.0 32.0 38.0 80-84 34.95309999999999 37.0 35.0 37.0 30.8 38.0 85-89 34.89295 37.0 35.0 37.0 30.2 38.0 90-94 34.514050000000005 37.0 35.0 37.0 28.6 38.0 95-99 34.41125 37.0 35.0 37.0 28.6 38.0 100-104 34.21745 37.0 35.0 37.0 27.4 38.0 105-109 33.9387 36.4 35.0 37.0 26.0 38.0 110-114 33.6908 36.6 34.6 37.0 24.4 38.0 115-119 33.40220000000001 36.0 34.0 37.0 23.2 38.0 120-124 33.26219999999999 36.0 33.8 37.0 22.8 38.0 125-129 32.8395 36.0 33.2 37.0 21.0 37.8 130-134 32.4744 36.0 32.4 37.0 19.6 37.6 135-139 32.15275 36.0 31.8 37.0 17.8 37.6 140-144 31.7431 36.0 30.8 37.0 16.6 37.0 145-149 31.48525 36.0 30.2 37.0 16.0 37.2 150 31.3285 36.0 30.0 37.0 16.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 1.0 27 18.0 28 66.0 29 103.0 30 172.0 31 235.0 32 262.0 33 365.0 34 574.0 35 831.0 36 1055.0 37 318.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.0 15.7 13.4 35.9 2 17.0 23.775 43.275000000000006 15.950000000000001 3 16.2 28.599999999999998 30.55 24.65 4 20.775 35.35 25.0 18.875 5 19.75 35.15 26.974999999999998 18.125 6 15.775 35.15 29.2 19.875 7 14.85 15.55 45.525 24.075 8 18.775 21.55 29.125 30.55 9 19.7 23.425 28.249999999999996 28.625 10-14 20.645 28.785 27.389999999999997 23.18 15-19 20.9 28.854999999999997 27.565 22.68 20-24 20.815 28.89 28.23 22.065 25-29 21.705 28.384999999999998 28.005000000000003 21.905 30-34 21.154999999999998 28.199999999999996 28.04 22.605 35-39 21.185000000000002 28.535 28.189999999999998 22.09 40-44 20.895 29.04 27.815 22.25 45-49 21.709999999999997 28.375 27.465 22.45 50-54 21.555 28.265 27.76 22.42 55-59 20.995 28.549999999999997 27.92 22.535 60-64 21.305 28.194999999999997 28.15 22.35 65-69 20.91 28.804999999999996 27.96 22.325 70-74 21.915000000000003 28.325 27.965 21.795 75-79 21.435000000000002 28.125 27.900000000000002 22.54 80-84 21.745 28.249999999999996 27.61 22.395 85-89 20.635 28.665000000000003 27.810000000000002 22.89 90-94 21.435000000000002 28.33 28.21 22.025 95-99 21.990000000000002 27.375 28.235 22.400000000000002 100-104 21.78 27.894999999999996 27.689999999999998 22.634999999999998 105-109 21.85 28.255000000000003 27.689999999999998 22.205 110-114 22.14 27.91 27.555000000000003 22.395 115-119 22.36 27.310000000000002 27.665 22.665 120-124 22.375 27.11 27.839999999999996 22.675 125-129 22.616130806540326 27.156357817890896 27.67638381919096 22.55112755637782 130-134 22.716135806790337 27.011350567528375 27.76638831941597 22.50612530626531 135-139 23.36116805840292 27.27136356817841 27.066353317665882 22.30111505575279 140-144 23.47 27.36 27.0 22.17 145-149 24.16620831041552 27.246362318115906 26.431321566078303 22.156107805390267 150 24.431107776944234 27.206801700425103 25.78144536134033 22.58064516129032 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 1.5 22 2.5 23 4.0 24 5.5 25 4.5 26 7.0 27 11.5 28 15.5 29 20.0 30 27.0 31 34.5 32 43.0 33 56.0 34 64.5 35 79.5 36 90.0 37 110.5 38 138.0 39 159.5 40 189.0 41 214.0 42 238.0 43 259.0 44 262.0 45 249.0 46 254.0 47 241.0 48 217.0 49 195.5 50 171.5 51 163.5 52 134.5 53 94.0 54 64.5 55 45.0 56 32.5 57 27.0 58 19.5 59 12.0 60 12.0 61 8.5 62 4.5 63 3.0 64 2.0 65 3.5 66 2.5 67 1.5 68 2.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.005 135-139 0.005 140-144 0.0 145-149 0.005 150 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.6 #Duplication Level Percentage of deduplicated Percentage of total 1 97.5922131147541 95.25 2 2.3565573770491803 4.6 3 0.05122950819672131 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1640438 spots for SRR22954653.sra Written 1640438 spots for SRR22954653.sra Read 1640438 spots for SRR22954653.sra Written 1640438 spots for SRR22954653.sra Read 1640438 spots for SRR22954653.sra Written 1640438 spots for SRR22954653.sra Read 1640438 spots for SRR22954653.sra Written 1640438 spots for SRR22954653.sra Read 1640451 spots for SRR22954653.sra Written 1640451 spots for SRR22954653.sra Read 1640438 spots for SRR22954653.sra Written 1640438 spots for SRR22954653.sra Read 1640438 spots for SRR22954653.sra Written 1640438 spots for SRR22954653.sra Read 1640438 spots for SRR22954653.sra Written 1640438 spots for SRR22954653.sra Read 1640438 spots for SRR22954653.sra Written 1640438 spots for SRR22954653.sra Read 1640438 spots for SRR22954653.sra Written 1640438 spots for SRR22954653.sra Read 1640438 spots for SRR22954653.sra Written 1640438 spots for SRR22954653.sra Read 1640438 spots for SRR22954653.sra Written 1640438 spots for SRR22954653.sra Read 1640438 spots for SRR22954653.sra Written 1640438 spots for SRR22954653.sra Read 1640438 spots for SRR22954653.sra Written 1640438 spots for SRR22954653.sra Read 1640438 spots for SRR22954653.sra Written 1640438 spots for SRR22954653.sra Read 1640438 spots for SRR22954653.sra Written 1640438 spots for SRR22954653.sra Read 1640438 spots for SRR22954653.sra Written 1640438 spots for SRR22954653.sra Read 1640438 spots for SRR22954653.sra Written 1640438 spots for SRR22954653.sra Read 1640438 spots for SRR22954653.sra Written 1640438 spots for SRR22954653.sra Read 1640438 spots for SRR22954653.sra Written 1640438 spots for SRR22954653.sra SRR ids: ['SRR22954653.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cz9a80oq SRR22954653.sra spots: 32808773 blocks: [[1, 1640438], [1640439, 3280876], [3280877, 4921314], [4921315, 6561752], [6561753, 8202190], [8202191, 9842628], [9842629, 11483066], [11483067, 13123504], [13123505, 14763942], [14763943, 16404380], [16404381, 18044818], [18044819, 19685256], [19685257, 21325694], [21325695, 22966132], [22966133, 24606570], [24606571, 26247008], [26247009, 27887446], [27887447, 29527884], [29527885, 31168322], [31168323, 32808773]] SRR22954653 file size 11683683 SRR22954653 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22954653 SRR22954653_1.fastq SRR22954653_2.fastq Input file: SRR22954653_1.fastq Paired file: SRR22954653_2.fastq trimmed: SRR22954653-trimmed-pair1.fastq, SRR22954653-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:56:52 2025 >> started Thu Feb 13 16:57:31 2025 >> done (39.436s) 32808773 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 32808773 (100.00%) read pairs available; of these: 3160998 ( 9.63%) trimmed read pairs available after processing 29647775 (90.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 135 1 0.00% 136 0 0.00% 137 0 0.00% 138 0 0.00% 139 1 0.00% 140 3 0.00% 141 27 0.00% 142 180 0.00% 143 153 0.00% 144 157 0.00% 145 133 0.00% 146 131 0.00% 147 975 0.00% 148 46572 0.14% 149 3112665 9.49% 150 29647775 90.37% 32808773 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=71.17 fanout-score-rank=1 prefix-density=1.21 prefix-fanout=31.5 sequence=AAGTCGGAGGCCAAGG criterion=fanout-score sequence-density=0.54 sequence-density-rank=1 fanout-score=71.17 fanout-score-rank=1 prefix-density=1.21 prefix-fanout=31.5 sequence=AAGTCGGAGGCCAAGG criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=70.48 fanout-score-rank=2 prefix-density=1.16 prefix-fanout=31.3 sequence=AAGTCGGATCGTAGCCATGTCG criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=128.02 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=9.3 sequence=GGTGCTGGTGTAGTGAAGGGTCTCCAAGGAAGCCACAACTACGAGCTTCAGGGTGGCGGAGCTAATGTTGTGAATCATGGATACACCAAGGGTGATGGCCTTGGTGCGGAGATAGTCGGTACCTTTGTTCTTGTCTACACTGTCTTCTCTGCTACTGATGCCAAGAGAAACGCTAGAGACTCTCATGTCCCTATTTTGGCTCCCCTTCCCATTGGATTTGCAGTCTTCTTGGTTCATTTGGCTACCATCCCCATAACTGGAACTGGCATTAACCCGGCAAGGAGTCTTGGAGCCGCCATCATCTTCAACAAAGACCATGCATGGGATGACCACTGGATCTTCTGGGTTGGCCCATTCATTGGAGCTGCTCTTGCCGCTGTCTACCACCAGATAGTCATTAGAGCCATTCCTTTCAAGAGCAGAGCTTAATTTCGTTCGCCCTTTCAAGAATCACACCATCTCACAAC SRR22954653 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:58:20 Started mapping on | Feb 13 16:58:20 Finished on | Feb 13 17:01:50 Mapping speed, Million of reads per hour | 562.44 Number of input reads | 32808773 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 31234837 Uniquely mapped reads % | 95.20% Average mapped length | 296.66 Number of splices: Total | 24826316 Number of splices: Annotated (sjdb) | 24367101 Number of splices: GT/AG | 24455911 Number of splices: GC/AG | 279895 Number of splices: AT/AC | 25593 Number of splices: Non-canonical | 64917 Mismatch rate per base, % | 0.93% Deletion rate per base | 0.02% Deletion average length | 2.34 Insertion rate per base | 0.02% Insertion average length | 1.90 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 659990 % of reads mapped to multiple loci | 2.01% Number of reads mapped to too many loci | 1138 % of reads mapped to too many loci | 0.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.77% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 913946 913946 913946 N_multimapping 659990 659990 659990 N_noFeature 923510 15188645 16595367 N_ambiguous 534050 85238 76083 UnstrandedReadsAssigned:29777277 PositiveStrandReadsAssigned:15960954 NegativeStrandReadsAssigned:14563387 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR22954653 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22954653-trimmed-pair1.fastq SRR22954653-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,808,773 reads, 31,008,066 reads pseudoaligned [quant] estimated average fragment length: 236.212 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,142 rounds 52401 SRR22954653.ke.tsv 34699 SRR22954653.se.tsv 87100 total ==> SRR22954653.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.79 1498 25.6403 Potri.005G024800.1.v4.1 1035 799.788 397 15.147 Potri.004G059700.1.v4.1 961 725.802 42 1.7658 Potri.007G009000.2.v4.1 1416 1180.79 0 0 Potri.003G141000.2.v4.1 2943 2707.79 577.465 6.50761 Potri.016G087400.1.v4.1 270 70.5581 1989 860.197 Potri.015G069301.1.v4.1 564 329.292 0 0 Potri.010G195200.1.v4.1 1773 1537.79 126 2.50026 Potri.012G127500.1.v4.1 977 741.788 3806 156.567 ==> SRR22954653.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4855 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 1556 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 90 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR22954653 completed mapping pipeline successfully