Starting /dee2/code/volunteer_pipeline.sh SRR22954654 current disk space = 3088859885568 free memory = 1499253928 SRR22954654 SRAfilesize 21c3deb7dff9557933b809f053217cf1 SRR22954654.sra SRR22954654.sra file validated SRR22954654 is paired end SRR22954654 is conventional basespace SRR22954654 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22954654_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.76625 37.0 36.0 37.0 34.0 38.0 2 35.568 37.0 36.0 37.0 33.0 38.0 3 36.09325 37.0 36.0 37.0 35.0 38.0 4 36.08475 37.0 36.0 37.0 35.0 38.0 5 35.99175 37.0 36.0 37.0 34.0 38.0 6 35.8855 37.0 36.0 37.0 34.0 38.0 7 35.98825 37.0 36.0 37.0 34.0 38.0 8 36.11825 37.0 36.0 37.0 35.0 38.0 9 36.12175 37.0 36.0 37.0 35.0 38.0 10-14 36.0458 37.0 36.0 37.0 34.8 38.0 15-19 36.05050000000001 37.0 36.0 37.0 34.8 38.0 20-24 36.0322 37.0 36.0 37.0 34.6 38.0 25-29 36.02485 37.0 36.0 37.0 34.4 38.0 30-34 35.9901 37.0 36.0 37.0 34.6 38.0 35-39 35.96505 37.0 36.0 37.0 34.2 38.0 40-44 35.904599999999995 37.0 36.0 37.0 34.0 38.0 45-49 35.9145 37.0 36.0 37.0 34.2 38.0 50-54 35.84515 37.0 36.0 37.0 34.0 38.0 55-59 35.794050000000006 37.0 36.0 37.0 34.0 38.0 60-64 35.729 37.0 36.0 37.0 34.0 38.0 65-69 35.6469 37.0 36.0 37.0 33.8 38.0 70-74 35.69440000000001 37.0 36.0 37.0 33.8 38.0 75-79 35.54185 37.0 36.0 37.0 33.2 38.0 80-84 35.5 37.0 36.0 37.0 33.2 38.0 85-89 35.4302 37.0 36.0 37.0 33.0 38.0 90-94 35.32885 37.0 36.0 37.0 32.2 38.0 95-99 35.27525 37.0 36.0 37.0 32.2 38.0 100-104 35.11055 37.0 36.0 37.0 31.2 38.0 105-109 34.99175 37.0 35.8 37.0 31.0 38.0 110-114 34.85245 37.0 35.4 37.0 30.4 38.0 115-119 34.7766 37.0 35.2 37.0 30.0 38.0 120-124 34.747299999999996 37.0 35.2 37.0 30.0 38.0 125-129 34.51075 37.0 35.0 37.0 28.6 38.0 130-134 34.3501 37.0 35.0 37.0 27.8 38.0 135-139 34.19095 37.0 35.0 37.0 27.2 38.0 140-144 33.986850000000004 37.0 35.0 37.0 26.4 38.0 145-149 33.8296 37.0 34.8 37.0 24.8 38.0 150 33.59375 37.0 34.0 37.0 24.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 1.0 27 8.0 28 32.0 29 65.0 30 111.0 31 126.0 32 150.0 33 267.0 34 409.0 35 830.0 36 1435.0 37 566.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.625 17.375 11.5 37.5 2 17.8 23.724999999999998 45.375 13.100000000000001 3 14.124999999999998 28.325 33.525 24.025 4 19.900000000000002 35.125 27.675 17.299999999999997 5 19.7 36.825 27.250000000000004 16.225 6 14.025000000000002 35.25 31.45 19.275000000000002 7 14.85 14.75 46.6 23.799999999999997 8 18.125 21.525 30.575000000000003 29.775000000000002 9 20.325 23.225 29.425 27.025 10-14 21.0 29.915000000000003 26.810000000000002 22.275 15-19 21.05 28.715000000000003 28.115000000000002 22.12 20-24 21.19 28.744999999999997 28.244999999999997 21.82 25-29 21.175 29.755 27.860000000000003 21.21 30-34 22.035 28.58 28.025 21.36 35-39 22.15 28.98 27.55 21.32 40-44 21.805 28.78 28.499999999999996 20.915 45-49 22.02 28.299999999999997 27.985 21.695 50-54 21.625 28.49 28.044999999999998 21.84 55-59 22.42 29.04 27.229999999999997 21.310000000000002 60-64 21.935 28.51 27.884999999999998 21.67 65-69 22.215 28.470000000000002 27.755000000000003 21.560000000000002 70-74 21.46 28.77 28.21 21.560000000000002 75-79 22.314999999999998 28.395 27.639999999999997 21.65 80-84 22.02 29.095 27.315 21.57 85-89 22.085 28.999999999999996 27.305 21.61 90-94 21.455 28.610000000000003 28.310000000000002 21.625 95-99 22.105 28.92 27.839999999999996 21.135 100-104 22.400000000000002 27.905 28.375 21.32 105-109 22.515 28.389999999999997 27.73 21.365000000000002 110-114 22.5 28.4 27.625 21.475 115-119 22.509999999999998 28.475 27.29 21.725 120-124 22.314999999999998 28.360000000000003 27.700000000000003 21.625 125-129 22.405 28.175 28.16 21.26 130-134 23.01 27.779999999999998 27.944999999999997 21.265 135-139 22.314999999999998 28.24 28.199999999999996 21.245 140-144 22.61 28.04 27.644999999999996 21.705 145-149 23.106155307765388 28.07640382019101 27.251362568128407 21.566078303915194 150 23.175 28.325 27.800000000000004 20.7 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 3.5 23 6.0 24 8.5 25 12.0 26 14.0 27 13.0 28 13.0 29 20.0 30 33.0 31 43.0 32 49.0 33 59.0 34 72.0 35 86.5 36 96.0 37 117.5 38 157.0 39 183.5 40 186.5 41 203.5 42 214.0 43 234.0 44 260.0 45 263.0 46 264.0 47 258.5 48 229.0 49 181.0 50 153.0 51 132.5 52 109.5 53 82.5 54 59.0 55 48.5 56 33.0 57 18.0 58 19.5 59 19.0 60 12.5 61 7.5 62 7.0 63 6.0 64 4.5 65 2.5 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.005 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.1 #Duplication Level Percentage of deduplicated Percentage of total 1 98.06320081549438 96.2 2 1.9367991845056065 3.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTGCC 10 0.006973645 144.0 7 >>END_MODULE SRR22954654 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22954654_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.00225 37.0 36.0 37.0 35.0 38.0 2 35.41825 37.0 36.0 37.0 33.0 38.0 3 36.09025 37.0 36.0 37.0 35.0 38.0 4 36.07975 37.0 36.0 37.0 35.0 38.0 5 36.00175 37.0 36.0 37.0 35.0 38.0 6 36.0065 37.0 36.0 37.0 34.0 38.0 7 35.79625 37.0 36.0 37.0 34.0 38.0 8 36.1755 37.0 36.0 37.0 35.0 38.0 9 36.03325 37.0 36.0 37.0 35.0 38.0 10-14 35.97095 37.0 36.0 37.0 34.4 38.0 15-19 35.956500000000005 37.0 36.0 37.0 34.0 38.0 20-24 35.93155 37.0 36.0 37.0 34.0 38.0 25-29 35.928399999999996 37.0 36.0 37.0 34.0 38.0 30-34 35.807550000000006 37.0 36.0 37.0 34.0 38.0 35-39 35.76755000000001 37.0 36.0 37.0 34.0 38.0 40-44 35.6822 37.0 36.0 37.0 33.6 38.0 45-49 35.657599999999995 37.0 36.0 37.0 33.6 38.0 50-54 35.591249999999995 37.0 36.0 37.0 33.4 38.0 55-59 35.42710000000001 37.0 36.0 37.0 32.6 38.0 60-64 35.41455 37.0 36.0 37.0 32.8 38.0 65-69 35.260799999999996 37.0 36.0 37.0 31.8 38.0 70-74 35.081100000000006 37.0 35.6 37.0 31.4 38.0 75-79 35.05335 37.0 35.2 37.0 31.2 38.0 80-84 34.783699999999996 37.0 35.0 37.0 30.4 38.0 85-89 34.75485 37.0 35.0 37.0 30.0 38.0 90-94 34.4095 37.0 35.0 37.0 28.4 38.0 95-99 34.1981 37.0 35.0 37.0 27.4 38.0 100-104 34.0247 36.8 35.0 37.0 26.4 38.0 105-109 33.84160000000001 36.0 34.8 37.0 25.8 37.4 110-114 33.60545 36.0 34.0 37.0 24.4 37.6 115-119 33.2174 36.0 34.0 37.0 22.6 37.2 120-124 33.040949999999995 36.0 33.4 37.0 22.0 37.0 125-129 32.609899999999996 36.0 32.6 37.0 20.2 37.2 130-134 32.33205 36.0 32.2 37.0 19.0 37.0 135-139 31.997200000000003 36.0 31.2 37.0 17.6 37.0 140-144 31.649400000000004 36.0 30.4 37.0 16.2 37.0 145-149 31.31055 36.0 29.4 37.0 15.4 37.0 150 31.05675 36.0 29.0 37.0 14.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 1.0 27 24.0 28 73.0 29 131.0 30 170.0 31 224.0 32 295.0 33 396.0 34 590.0 35 831.0 36 984.0 37 281.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.824999999999996 17.349999999999998 12.15 37.675 2 17.4 23.3 45.5 13.8 3 14.299999999999999 26.575 32.425 26.700000000000003 4 19.5 36.0 27.275 17.224999999999998 5 19.275000000000002 36.375 26.674999999999997 17.675 6 14.725 35.25 30.125 19.900000000000002 7 14.499999999999998 14.674999999999999 47.625 23.200000000000003 8 18.275 21.375 30.15 30.2 9 20.175 22.05 29.825000000000003 27.950000000000003 10-14 20.635 29.335 27.650000000000002 22.38 15-19 20.51 28.215 28.51 22.765 20-24 20.580000000000002 28.465 28.79 22.165000000000003 25-29 21.145 28.73 28.28 21.845 30-34 20.855 28.285 28.000000000000004 22.86 35-39 21.015 28.685 28.185 22.115000000000002 40-44 21.285 28.65 28.115000000000002 21.95 45-49 20.49 29.060000000000002 27.68 22.770000000000003 50-54 21.425 28.055000000000003 28.194999999999997 22.325 55-59 21.41 28.405 28.17 22.015 60-64 20.979999999999997 29.115000000000002 28.08 21.825 65-69 21.43 28.294999999999998 28.110000000000003 22.165000000000003 70-74 21.205 28.349999999999998 28.405 22.040000000000003 75-79 20.94 28.71 27.889999999999997 22.46 80-84 21.705 28.185 27.92 22.189999999999998 85-89 21.38 28.165000000000003 28.08 22.375 90-94 21.490000000000002 27.74 28.18 22.59 95-99 21.665 28.07 27.355 22.91 100-104 21.176058802940148 28.151407570378517 28.0314015700785 22.64113205660283 105-109 22.09 27.755000000000003 27.61 22.545 110-114 21.6060803040152 28.23141157057853 27.996399819990998 22.16610830541527 115-119 22.7 27.36 27.97 21.97 120-124 22.0 27.894999999999996 27.450000000000003 22.655 125-129 22.606130306515325 28.086404320216012 27.29136456822841 22.01610080504025 130-134 22.125 27.98 27.245 22.650000000000002 135-139 22.79113955697785 27.796389819490976 27.05635281764088 22.356117805890293 140-144 23.667366736673667 27.37273727372737 26.84768476847685 22.112211221122113 145-149 23.225 27.125 27.1 22.55 150 24.0 27.175 27.55 21.275 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 1.5 20 2.5 21 3.5 22 5.5 23 5.0 24 4.5 25 4.5 26 9.0 27 13.5 28 17.5 29 28.0 30 30.5 31 40.0 32 49.5 33 50.0 34 61.0 35 79.0 36 107.5 37 127.5 38 147.0 39 168.0 40 193.0 41 203.5 42 214.5 43 254.5 44 269.0 45 253.5 46 242.5 47 233.5 48 216.0 49 197.5 50 173.0 51 142.5 52 112.5 53 86.5 54 67.0 55 50.0 56 36.5 57 26.5 58 18.5 59 12.5 60 8.5 61 8.5 62 6.5 63 7.5 64 5.0 65 0.0 66 0.0 67 1.5 68 2.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.0 110-114 0.005 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.005 140-144 0.01 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.0 #Duplication Level Percentage of deduplicated Percentage of total 1 97.95918367346938 96.0 2 2.0408163265306123 4.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.0 0.0 0.0 0.025 0.0 84-85 0.0 0.0 0.0 0.025 0.0 86-87 0.0 0.0 0.0 0.025 0.0 88-89 0.0 0.0 0.0 0.025 0.0 90-91 0.0 0.0 0.0 0.025 0.0 92-93 0.0 0.0 0.0 0.025 0.0 94-95 0.0 0.0 0.0 0.025 0.0 96-97 0.0 0.0 0.0 0.025 0.0 98-99 0.0 0.0 0.0 0.025 0.0 100-101 0.0 0.0 0.0 0.025 0.0 102-103 0.0 0.0 0.0 0.025 0.0 104-105 0.0 0.0 0.0 0.025 0.0 106-107 0.0 0.0 0.0 0.025 0.0 108-109 0.0 0.0 0.0 0.025 0.0 110-111 0.0 0.0 0.0 0.025 0.0 112-113 0.0 0.0 0.0 0.025 0.0 114-115 0.0 0.0 0.0 0.025 0.0 116-117 0.0 0.0 0.0 0.025 0.0 118-119 0.0 0.0 0.0 0.025 0.0 120-121 0.0 0.0 0.0 0.025 0.0 122-123 0.0 0.0 0.0 0.025 0.0 124-125 0.0 0.0 0.0 0.025 0.0 126-127 0.0 0.0 0.0 0.025 0.0 128-129 0.0 0.0 0.0 0.025 0.0 130-131 0.0 0.0 0.0 0.025 0.0 132-133 0.0 0.0 0.0 0.025 0.0 134-135 0.0 0.0 0.0 0.025 0.0 136-137 0.0 0.0 0.0 0.025 0.0 138 0.0 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGCATC 10 0.006973645 144.0 6 GGCTCAA 10 0.006973645 144.0 4 GCTCAAC 10 0.006973645 144.0 5 >>END_MODULE Read 1688353 spots for SRR22954654.sra Written 1688353 spots for SRR22954654.sra Read 1688353 spots for SRR22954654.sra Written 1688353 spots for SRR22954654.sra Read 1688353 spots for SRR22954654.sra Written 1688353 spots for SRR22954654.sra Read 1688353 spots for SRR22954654.sra Written 1688353 spots for SRR22954654.sra Read 1688353 spots for SRR22954654.sra Written 1688353 spots for SRR22954654.sra Read 1688353 spots for SRR22954654.sra Written 1688353 spots for SRR22954654.sra Read 1688353 spots for SRR22954654.sra Written 1688353 spots for SRR22954654.sra Read 1688353 spots for SRR22954654.sra Written 1688353 spots for SRR22954654.sra Read 1688353 spots for SRR22954654.sra Written 1688353 spots for SRR22954654.sra Read 1688353 spots for SRR22954654.sra Written 1688353 spots for SRR22954654.sra Read 1688366 spots for SRR22954654.sra Written 1688366 spots for SRR22954654.sra Read 1688353 spots for SRR22954654.sra Written 1688353 spots for SRR22954654.sra Read 1688353 spots for SRR22954654.sra Written 1688353 spots for SRR22954654.sra Read 1688353 spots for SRR22954654.sra Written 1688353 spots for SRR22954654.sra Read 1688353 spots for SRR22954654.sra Written 1688353 spots for SRR22954654.sra Read 1688353 spots for SRR22954654.sra Written 1688353 spots for SRR22954654.sra Read 1688353 spots for SRR22954654.sra Written 1688353 spots for SRR22954654.sra Read 1688353 spots for SRR22954654.sra Written 1688353 spots for SRR22954654.sra Read 1688353 spots for SRR22954654.sra Written 1688353 spots for SRR22954654.sra Read 1688353 spots for SRR22954654.sra Written 1688353 spots for SRR22954654.sra SRR ids: ['SRR22954654.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xamd51sp SRR22954654.sra spots: 33767073 blocks: [[1, 1688353], [1688354, 3376706], [3376707, 5065059], [5065060, 6753412], [6753413, 8441765], [8441766, 10130118], [10130119, 11818471], [11818472, 13506824], [13506825, 15195177], [15195178, 16883530], [16883531, 18571883], [18571884, 20260236], [20260237, 21948589], [21948590, 23636942], [23636943, 25325295], [25325296, 27013648], [27013649, 28702001], [28702002, 30390354], [30390355, 32078707], [32078708, 33767073]] SRR22954654 file size 12025265 SRR22954654 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22954654 SRR22954654_1.fastq SRR22954654_2.fastq Input file: SRR22954654_1.fastq Paired file: SRR22954654_2.fastq trimmed: SRR22954654-trimmed-pair1.fastq, SRR22954654-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:53:14 2025 >> started Thu Feb 13 16:54:11 2025 >> done (56.890s) 33767073 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 33767073 (100.00%) read pairs available; of these: 3273862 ( 9.70%) trimmed read pairs available after processing 30493211 (90.30%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 140 4 0.00% 141 25 0.00% 142 99 0.00% 143 115 0.00% 144 111 0.00% 145 89 0.00% 146 107 0.00% 147 1002 0.00% 148 47571 0.14% 149 3224739 9.55% 150 30493211 90.30% 33767073 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=67.66 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=27.9 sequence=AAGTCGGAGGCCAAG criterion=fanout-score sequence-density=0.35 sequence-density-rank=1 fanout-score=67.66 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=27.9 sequence=AAGTCGGAGGCCAAG criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=65.07 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=27.8 sequence=AAGTCGGATCGTAGCCATGT criterion=fanout-score sequence-density=0.32 sequence-density-rank=1 fanout-score=65.07 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=27.8 sequence=AAGTCGGATCGTAGCCATGT SRR22954654 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:54:55 Started mapping on | Feb 13 16:54:55 Finished on | Feb 13 16:58:50 Mapping speed, Million of reads per hour | 517.28 Number of input reads | 33767073 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 32359590 Uniquely mapped reads % | 95.83% Average mapped length | 296.85 Number of splices: Total | 25784338 Number of splices: Annotated (sjdb) | 25308241 Number of splices: GT/AG | 25403843 Number of splices: GC/AG | 288378 Number of splices: AT/AC | 26578 Number of splices: Non-canonical | 65539 Mismatch rate per base, % | 0.93% Deletion rate per base | 0.02% Deletion average length | 2.34 Insertion rate per base | 0.01% Insertion average length | 1.87 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 614713 % of reads mapped to multiple loci | 1.82% Number of reads mapped to too many loci | 995 % of reads mapped to too many loci | 0.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.34% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 792770 792770 792770 N_multimapping 614713 614713 614713 N_noFeature 940203 15799770 17087293 N_ambiguous 569653 83498 74841 UnstrandedReadsAssigned:30849734 PositiveStrandReadsAssigned:16476322 NegativeStrandReadsAssigned:15197456 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR22954654 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22954654-trimmed-pair1.fastq SRR22954654-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,767,073 reads, 31,941,416 reads pseudoaligned [quant] estimated average fragment length: 237.295 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,146 rounds 52401 SRR22954654.ke.tsv 34699 SRR22954654.se.tsv 87100 total ==> SRR22954654.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.71 1407 23.6777 Potri.005G024800.1.v4.1 1035 798.705 174 6.53196 Potri.004G059700.1.v4.1 961 724.705 69 2.85475 Potri.007G009000.2.v4.1 1416 1179.71 0 0 Potri.003G141000.2.v4.1 2943 2706.71 488.127 5.40721 Potri.016G087400.1.v4.1 270 67.384 1960.02 872.136 Potri.015G069301.1.v4.1 564 328.096 0 0 Potri.010G195200.1.v4.1 1773 1536.71 79 1.54141 Potri.012G127500.1.v4.1 977 740.705 2678 108.404 ==> SRR22954654.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 5234 Potri.001G233950.v4.1 6 Potri.001G122700.v4.1 1527 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 146 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 15 SRR22954654 completed mapping pipeline successfully