Starting /dee2/code/volunteer_pipeline.sh SRR22954655 current disk space = 3088715022336 free memory = 1467191208 SRR22954655 SRAfilesize e62546583d6a0d502069be24b7d530c4 SRR22954655.sra SRR22954655.sra file validated SRR22954655 is paired end SRR22954655 is conventional basespace SRR22954655 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22954655_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.84725 37.0 36.0 37.0 34.0 38.0 2 35.489 37.0 36.0 37.0 33.0 38.0 3 36.02225 37.0 36.0 37.0 35.0 38.0 4 36.1145 37.0 36.0 37.0 35.0 38.0 5 36.06025 37.0 36.0 37.0 35.0 38.0 6 35.99125 37.0 36.0 37.0 34.0 38.0 7 35.992 37.0 36.0 37.0 35.0 38.0 8 36.12875 37.0 36.0 37.0 35.0 38.0 9 36.15525 37.0 36.0 37.0 35.0 38.0 10-14 36.09085 37.0 36.0 37.0 35.0 38.0 15-19 36.06965 37.0 36.0 37.0 34.8 38.0 20-24 36.03425 37.0 36.0 37.0 34.8 38.0 25-29 36.01055 37.0 36.0 37.0 34.4 38.0 30-34 35.96925 37.0 36.0 37.0 34.6 38.0 35-39 35.97165 37.0 36.0 37.0 34.2 38.0 40-44 35.93925 37.0 36.0 37.0 34.2 38.0 45-49 35.92614999999999 37.0 36.0 37.0 34.0 38.0 50-54 35.84495 37.0 36.0 37.0 34.0 38.0 55-59 35.83819999999999 37.0 36.0 37.0 34.0 38.0 60-64 35.773450000000004 37.0 36.0 37.0 34.0 38.0 65-69 35.7376 37.0 36.0 37.0 33.8 38.0 70-74 35.6785 37.0 36.0 37.0 33.8 38.0 75-79 35.56395 37.0 36.0 37.0 33.0 38.0 80-84 35.55460000000001 37.0 36.0 37.0 33.2 38.0 85-89 35.416399999999996 37.0 36.0 37.0 32.8 38.0 90-94 35.33045 37.0 36.0 37.0 32.4 38.0 95-99 35.325300000000006 37.0 36.0 37.0 32.2 38.0 100-104 35.17999999999999 37.0 36.0 37.0 31.6 38.0 105-109 35.11325 37.0 36.0 37.0 31.2 38.0 110-114 34.945100000000004 37.0 35.6 37.0 30.6 38.0 115-119 34.9074 37.0 35.4 37.0 30.4 38.0 120-124 34.7281 37.0 35.0 37.0 29.4 38.0 125-129 34.565749999999994 37.0 35.0 37.0 29.0 38.0 130-134 34.54065000000001 37.0 35.0 37.0 28.6 38.0 135-139 34.15505 37.0 35.0 37.0 26.6 38.0 140-144 34.0197 37.0 35.0 37.0 26.4 38.0 145-149 33.758599999999994 37.0 34.8 37.0 24.6 38.0 150 33.7715 37.0 35.0 37.0 25.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 6.0 28 30.0 29 49.0 30 110.0 31 116.0 32 174.0 33 284.0 34 435.0 35 740.0 36 1451.0 37 605.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.75 17.75 11.125 36.375 2 18.325 24.525 44.05 13.100000000000001 3 14.575 28.199999999999996 32.275 24.95 4 21.025 36.3 25.45 17.224999999999998 5 19.8 36.475 26.950000000000003 16.775000000000002 6 17.0 34.949999999999996 29.175 18.875 7 15.5 15.5 45.95 23.05 8 18.925 21.825 29.125 30.125 9 20.575 22.425 31.95 25.05 10-14 21.595 28.625 27.229999999999997 22.55 15-19 21.865000000000002 28.475 28.265 21.395 20-24 22.065 28.265 28.015 21.654999999999998 25-29 21.759999999999998 28.799999999999997 27.57 21.87 30-34 21.755 28.32 28.335 21.59 35-39 22.115000000000002 28.645 27.465 21.775 40-44 21.4 28.985 28.349999999999998 21.265 45-49 22.470000000000002 28.410000000000004 27.88 21.240000000000002 50-54 21.9 28.505000000000003 27.915 21.68 55-59 22.025 29.080000000000002 27.810000000000002 21.085 60-64 21.845 28.810000000000002 27.6 21.745 65-69 21.66 28.235 27.794999999999998 22.31 70-74 22.405 28.544999999999998 27.12 21.93 75-79 22.56 28.99 26.895000000000003 21.555 80-84 22.34611730586529 28.531426571328566 27.561378068903448 21.561078053902698 85-89 22.86 28.505000000000003 27.685 20.95 90-94 22.45 28.605000000000004 27.375 21.57 95-99 21.995 28.23 27.595 22.18 100-104 22.06 28.475 27.73 21.735 105-109 22.535 28.29 27.72 21.455 110-114 22.400000000000002 28.060000000000002 28.144999999999996 21.395 115-119 22.015 28.225 27.555000000000003 22.205 120-124 22.495 28.02 27.92 21.565 125-129 22.305 28.194999999999997 27.505000000000003 21.995 130-134 22.245 28.275 27.91 21.57 135-139 23.155 28.185 27.725 20.935000000000002 140-144 22.8 28.194999999999997 27.61 21.395 145-149 23.98 28.63 26.41 20.979999999999997 150 23.75 27.675 27.05 21.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 1.0 19 0.5 20 0.5 21 2.0 22 1.5 23 0.5 24 2.5 25 6.5 26 8.5 27 8.0 28 15.0 29 24.0 30 31.5 31 33.0 32 38.0 33 50.5 34 62.0 35 81.0 36 97.0 37 107.5 38 133.0 39 167.5 40 196.5 41 220.5 42 243.5 43 255.5 44 248.0 45 261.5 46 269.0 47 245.5 48 220.5 49 200.5 50 170.5 51 137.5 52 114.5 53 86.5 54 61.0 55 41.0 56 31.0 57 26.5 58 22.5 59 21.5 60 18.5 61 11.0 62 5.5 63 5.0 64 4.5 65 3.5 66 2.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.5 #Duplication Level Percentage of deduplicated Percentage of total 1 98.47715736040608 97.0 2 1.5228426395939088 3.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATATCCA 10 0.006973645 144.0 4 AAAAAAA 45 6.8636134E-4 19.2 90-94 >>END_MODULE SRR22954655 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22954655_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9925 37.0 36.0 37.0 34.0 38.0 2 35.61125 37.0 36.0 37.0 34.0 38.0 3 36.133 37.0 36.0 37.0 35.0 38.0 4 36.1355 37.0 36.0 37.0 35.0 38.0 5 36.1485 37.0 36.0 37.0 35.0 38.0 6 35.99425 37.0 36.0 37.0 35.0 38.0 7 36.00825 37.0 36.0 37.0 35.0 38.0 8 36.166 37.0 36.0 37.0 35.0 38.0 9 36.0345 37.0 36.0 37.0 35.0 38.0 10-14 36.03725000000001 37.0 36.0 37.0 34.8 38.0 15-19 36.0096 37.0 36.0 37.0 34.0 38.0 20-24 35.93294999999999 37.0 36.0 37.0 34.0 38.0 25-29 35.93065 37.0 36.0 37.0 34.0 38.0 30-34 35.82405000000001 37.0 36.0 37.0 34.0 38.0 35-39 35.7709 37.0 36.0 37.0 34.0 38.0 40-44 35.7456 37.0 36.0 37.0 34.0 38.0 45-49 35.691500000000005 37.0 36.0 37.0 33.8 38.0 50-54 35.55255 37.0 36.0 37.0 33.4 38.0 55-59 35.4639 37.0 36.0 37.0 32.8 38.0 60-64 35.4168 37.0 36.0 37.0 32.6 38.0 65-69 35.26005 37.0 35.8 37.0 32.2 38.0 70-74 35.16185 37.0 35.6 37.0 31.8 38.0 75-79 35.0758 37.0 35.4 37.0 31.4 38.0 80-84 34.865300000000005 37.0 35.0 37.0 30.4 38.0 85-89 34.8663 37.0 35.0 37.0 30.6 38.0 90-94 34.5153 37.0 35.0 37.0 29.0 38.0 95-99 34.2872 37.0 35.0 37.0 28.2 38.0 100-104 34.17105 37.0 35.0 37.0 27.4 37.6 105-109 33.94135 36.4 34.6 37.0 26.4 37.4 110-114 33.612649999999995 36.0 34.4 37.0 24.4 37.8 115-119 33.33165 36.0 34.0 37.0 23.4 37.2 120-124 33.0588 36.0 33.4 37.0 22.2 37.2 125-129 32.73495 36.0 32.8 37.0 20.4 37.0 130-134 32.4099 36.0 32.4 37.0 19.4 37.0 135-139 32.0477 36.0 31.6 37.0 17.8 37.0 140-144 31.6993 36.0 30.8 37.0 16.6 37.0 145-149 31.351250000000004 36.0 29.4 37.0 15.6 37.0 150 30.8265 36.0 28.0 37.0 14.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 1.0 27 11.0 28 76.0 29 132.0 30 173.0 31 210.0 32 282.0 33 379.0 34 586.0 35 842.0 36 1029.0 37 279.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.075 16.575 10.95 38.4 2 17.7 23.599999999999998 44.4 14.299999999999999 3 15.8 26.85 31.55 25.8 4 19.85 35.6 25.575 18.975 5 19.900000000000002 35.949999999999996 26.224999999999998 17.925 6 14.774999999999999 35.9 28.549999999999997 20.775 7 14.674999999999999 14.524999999999999 47.375 23.425 8 19.025 21.55 29.849999999999998 29.575000000000003 9 19.975 21.925 29.849999999999998 28.249999999999996 10-14 20.635 28.689999999999998 27.37 23.305 15-19 20.735 28.275 28.57 22.42 20-24 20.330000000000002 28.255000000000003 29.03 22.384999999999998 25-29 20.97 28.505000000000003 27.925 22.6 30-34 20.505000000000003 28.575 28.49 22.43 35-39 20.97 28.945 27.96 22.125 40-44 22.095000000000002 28.01 27.250000000000004 22.645 45-49 21.775 28.139999999999997 27.884999999999998 22.2 50-54 21.3 28.64 27.095000000000002 22.965 55-59 21.3 27.875 28.255000000000003 22.57 60-64 20.935000000000002 28.15 27.97 22.945 65-69 21.235 28.21 27.644999999999996 22.91 70-74 21.48 28.825 27.67 22.025 75-79 21.485000000000003 28.194999999999997 28.1 22.220000000000002 80-84 21.976098804940246 28.281414070703537 27.736386819340968 22.00610030501525 85-89 21.365000000000002 27.474999999999998 28.92 22.24 90-94 21.725 27.889999999999997 28.465 21.92 95-99 21.631081554077706 28.441422071103556 28.0314015700785 21.896094804740237 100-104 21.485000000000003 28.535 27.589999999999996 22.39 105-109 21.884999999999998 27.560000000000002 27.875 22.68 110-114 22.27 27.76 27.99 21.98 115-119 22.535 27.655 27.55 22.259999999999998 120-124 22.689999999999998 27.955000000000002 27.639999999999997 21.715 125-129 22.022202220222024 27.482748274827486 28.302830283028303 22.19221922192219 130-134 22.28 27.37 27.589999999999996 22.759999999999998 135-139 22.69840476071411 27.73916087413112 27.51412711906786 22.048307246086914 140-144 23.287328732873288 27.467746774677465 27.23272327232723 22.012201220122012 145-149 23.90119505975299 26.70133506675334 27.071353567678386 22.32611630581529 150 23.986993496748372 27.51375687843922 26.663331665832917 21.83591795897949 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 1.0 18 2.0 19 1.0 20 0.5 21 2.0 22 2.5 23 2.0 24 3.0 25 5.5 26 11.5 27 14.0 28 13.0 29 22.5 30 30.5 31 35.5 32 40.0 33 48.5 34 63.0 35 75.5 36 93.5 37 108.5 38 127.5 39 161.0 40 190.5 41 209.0 42 224.0 43 242.5 44 276.0 45 281.0 46 276.5 47 253.0 48 216.5 49 204.0 50 177.0 51 137.0 52 93.0 53 77.5 54 70.0 55 51.5 56 40.5 57 29.5 58 19.5 59 16.5 60 14.5 61 9.5 62 6.5 63 6.5 64 4.5 65 2.5 66 2.0 67 1.0 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.005 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.01 130-134 0.0 135-139 0.015 140-144 0.01 145-149 0.005 150 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.475 #Duplication Level Percentage of deduplicated Percentage of total 1 98.47677075399848 96.975 2 1.4978420919014979 2.9499999999999997 3 0.02538715410002539 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1664233 spots for SRR22954655.sra Written 1664233 spots for SRR22954655.sra Read 1664233 spots for SRR22954655.sra Written 1664233 spots for SRR22954655.sra Read 1664233 spots for SRR22954655.sra Written 1664233 spots for SRR22954655.sra Read 1664233 spots for SRR22954655.sra Written 1664233 spots for SRR22954655.sra Read 1664233 spots for SRR22954655.sra Written 1664233 spots for SRR22954655.sra Read 1664233 spots for SRR22954655.sra Written 1664233 spots for SRR22954655.sra Read 1664233 spots for SRR22954655.sra Written 1664233 spots for SRR22954655.sra Read 1664233 spots for SRR22954655.sra Written 1664233 spots for SRR22954655.sra Read 1664233 spots for SRR22954655.sra Written 1664233 spots for SRR22954655.sra Read 1664233 spots for SRR22954655.sra Written 1664233 spots for SRR22954655.sra Read 1664233 spots for SRR22954655.sra Written 1664233 spots for SRR22954655.sra Read 1664233 spots for SRR22954655.sra Written 1664233 spots for SRR22954655.sra Read 1664233 spots for SRR22954655.sra Written 1664233 spots for SRR22954655.sra Read 1664233 spots for SRR22954655.sra Written 1664233 spots for SRR22954655.sra Read 1664233 spots for SRR22954655.sra Written 1664233 spots for SRR22954655.sra Read 1664234 spots for SRR22954655.sra Written 1664234 spots for SRR22954655.sra Read 1664233 spots for SRR22954655.sra Written 1664233 spots for SRR22954655.sra Read 1664233 spots for SRR22954655.sra Written 1664233 spots for SRR22954655.sra Read 1664233 spots for SRR22954655.sra Written 1664233 spots for SRR22954655.sra Read 1664233 spots for SRR22954655.sra Written 1664233 spots for SRR22954655.sra SRR ids: ['SRR22954655.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e3hfkf93 SRR22954655.sra spots: 33284661 blocks: [[1, 1664233], [1664234, 3328466], [3328467, 4992699], [4992700, 6656932], [6656933, 8321165], [8321166, 9985398], [9985399, 11649631], [11649632, 13313864], [13313865, 14978097], [14978098, 16642330], [16642331, 18306563], [18306564, 19970796], [19970797, 21635029], [21635030, 23299262], [23299263, 24963495], [24963496, 26627728], [26627729, 28291961], [28291962, 29956194], [29956195, 31620427], [31620428, 33284661]] SRR22954655 file size 11853311 SRR22954655 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22954655 SRR22954655_1.fastq SRR22954655_2.fastq Input file: SRR22954655_1.fastq Paired file: SRR22954655_2.fastq trimmed: SRR22954655-trimmed-pair1.fastq, SRR22954655-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:32:50 2025 >> started Thu Feb 13 16:33:27 2025 >> done (36.857s) 33284661 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 33284661 (100.00%) read pairs available; of these: 3290759 ( 9.89%) trimmed read pairs available after processing 29993902 (90.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 139 1 0.00% 140 9 0.00% 141 25 0.00% 142 215 0.00% 143 154 0.00% 144 166 0.00% 145 150 0.00% 146 150 0.00% 147 1087 0.00% 148 50028 0.15% 149 3238774 9.73% 150 29993902 90.11% 33284661 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=68.66 fanout-score-rank=1 prefix-density=1.04 prefix-fanout=29.1 sequence=AAGTCGGAGGCCAAGGGG criterion=fanout-score sequence-density=0.44 sequence-density-rank=1 fanout-score=68.66 fanout-score-rank=1 prefix-density=1.04 prefix-fanout=29.1 sequence=AAGTCGGAGGCCAAGGGG criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=69.59 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=29.4 sequence=AAGTCGGATCGTAGCCATGTCG criterion=fanout-score sequence-density=0.37 sequence-density-rank=1 fanout-score=69.59 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=29.4 sequence=AAGTCGGATCGTAGCCATGTCG SRR22954655 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:34:11 Started mapping on | Feb 13 16:34:11 Finished on | Feb 13 16:37:48 Mapping speed, Million of reads per hour | 552.19 Number of input reads | 33284661 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 31825488 Uniquely mapped reads % | 95.62% Average mapped length | 296.85 Number of splices: Total | 26388594 Number of splices: Annotated (sjdb) | 25902493 Number of splices: GT/AG | 26009914 Number of splices: GC/AG | 289226 Number of splices: AT/AC | 26394 Number of splices: Non-canonical | 63060 Mismatch rate per base, % | 0.94% Deletion rate per base | 0.02% Deletion average length | 2.37 Insertion rate per base | 0.01% Insertion average length | 1.87 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 591342 % of reads mapped to multiple loci | 1.78% Number of reads mapped to too many loci | 850 % of reads mapped to too many loci | 0.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.60% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 867831 867831 867831 N_multimapping 591342 591342 591342 N_noFeature 961048 15566920 16835896 N_ambiguous 536759 81322 72909 UnstrandedReadsAssigned:30327681 PositiveStrandReadsAssigned:16177246 NegativeStrandReadsAssigned:14916683 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR22954655 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22954655-trimmed-pair1.fastq SRR22954655-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,284,661 reads, 31,411,216 reads pseudoaligned [quant] estimated average fragment length: 235.429 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,336 rounds 52401 SRR22954655.ke.tsv 34699 SRR22954655.se.tsv 87100 total ==> SRR22954655.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.57 1501 27.3672 Potri.005G024800.1.v4.1 1035 800.571 163 6.62107 Potri.004G059700.1.v4.1 961 726.575 62 2.77492 Potri.007G009000.2.v4.1 1416 1181.57 0 0 Potri.003G141000.2.v4.1 2943 2708.57 456.23 5.47752 Potri.016G087400.1.v4.1 270 69.168 1681 790.319 Potri.015G069301.1.v4.1 564 329.957 0 0 Potri.010G195200.1.v4.1 1773 1538.57 86 1.81769 Potri.012G127500.1.v4.1 977 742.571 1739 76.1556 ==> SRR22954655.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 5624 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 1461 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 130 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR22954655 completed mapping pipeline successfully