Starting /dee2/code/volunteer_pipeline.sh SRR22954656 current disk space = 3088726237184 free memory = 1496238192 SRR22954656 SRAfilesize 1651276cbf26264ee4a8e33366fbc3a4 SRR22954656.sra SRR22954656.sra file validated SRR22954656 is paired end SRR22954656 is conventional basespace SRR22954656 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22954656_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.68475 37.0 36.0 37.0 33.0 38.0 2 35.42975 37.0 36.0 37.0 33.0 38.0 3 35.96925 37.0 36.0 37.0 34.0 38.0 4 36.038 37.0 36.0 37.0 34.0 38.0 5 35.996 37.0 36.0 37.0 34.0 38.0 6 35.89175 37.0 36.0 37.0 34.0 38.0 7 35.96275 37.0 36.0 37.0 34.0 38.0 8 35.92 37.0 36.0 37.0 34.0 38.0 9 35.92425 37.0 36.0 37.0 34.0 38.0 10-14 35.9407 37.0 36.0 37.0 34.2 38.0 15-19 35.964800000000004 37.0 36.0 37.0 34.0 38.0 20-24 35.90645000000001 37.0 36.0 37.0 34.0 38.0 25-29 35.84335 37.0 36.0 37.0 34.0 38.0 30-34 35.821000000000005 37.0 36.0 37.0 34.0 38.0 35-39 35.90575 37.0 36.0 37.0 34.2 38.0 40-44 35.83345 37.0 36.0 37.0 34.0 38.0 45-49 35.8098 37.0 36.0 37.0 34.0 38.0 50-54 35.7555 37.0 36.0 37.0 34.0 38.0 55-59 35.70355000000001 37.0 36.0 37.0 34.0 38.0 60-64 35.6663 37.0 36.0 37.0 34.0 38.0 65-69 35.6474 37.0 36.0 37.0 33.8 38.0 70-74 35.5032 37.0 36.0 37.0 32.8 38.0 75-79 35.5461 37.0 36.0 37.0 33.2 38.0 80-84 35.416000000000004 37.0 36.0 37.0 32.4 38.0 85-89 35.34935 37.0 36.0 37.0 32.6 38.0 90-94 35.28225 37.0 36.0 37.0 32.0 38.0 95-99 35.2303 37.0 36.0 37.0 31.8 38.0 100-104 35.150850000000005 37.0 36.0 37.0 31.4 38.0 105-109 35.05245000000001 37.0 35.6 37.0 31.0 38.0 110-114 34.8908 37.0 35.0 37.0 30.6 38.0 115-119 34.7755 37.0 35.0 37.0 30.2 38.0 120-124 34.702999999999996 37.0 35.0 37.0 29.8 38.0 125-129 34.54835 37.0 35.0 37.0 28.6 38.0 130-134 34.373949999999994 37.0 35.0 37.0 27.8 38.0 135-139 34.213249999999995 37.0 35.0 37.0 27.2 38.0 140-144 34.029650000000004 37.0 35.0 37.0 26.4 38.0 145-149 33.74565 37.0 34.8 37.0 24.8 38.0 150 33.791 37.0 35.0 37.0 25.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 2.0 27 8.0 28 47.0 29 75.0 30 83.0 31 152.0 32 165.0 33 246.0 34 451.0 35 785.0 36 1420.0 37 566.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.25 17.5 10.35 38.9 2 18.6 23.45 46.650000000000006 11.3 3 15.1 26.625 32.75 25.525 4 19.525000000000002 35.75 27.55 17.175 5 19.8 35.475 26.724999999999998 18.0 6 15.024999999999999 34.225 30.225 20.525 7 14.000000000000002 15.1 48.05 22.85 8 18.35 22.825 28.999999999999996 29.825000000000003 9 18.575 21.625 30.975 28.825 10-14 21.349999999999998 29.354999999999997 26.775 22.52 15-19 21.48 28.15 28.185 22.185 20-24 21.695 28.485 28.199999999999996 21.62 25-29 21.445 29.28 28.04 21.235 30-34 21.52 29.220000000000002 27.339999999999996 21.92 35-39 21.9 28.705000000000002 27.77 21.625 40-44 21.959999999999997 28.505000000000003 28.139999999999997 21.395 45-49 21.395 27.815 28.835 21.955 50-54 21.69 29.195 27.455000000000002 21.66 55-59 21.709999999999997 29.225 27.389999999999997 21.675 60-64 21.89 29.349999999999998 27.435 21.325 65-69 22.12 28.735 27.63 21.515 70-74 21.895 28.7 27.650000000000002 21.755 75-79 21.795 28.610000000000003 28.000000000000004 21.595 80-84 22.455 28.835 27.339999999999996 21.37 85-89 22.445 28.92 27.145000000000003 21.490000000000002 90-94 21.985 28.544999999999998 27.6 21.87 95-99 21.86 28.58 27.595 21.965 100-104 21.6 29.18 27.615000000000002 21.605 105-109 22.115000000000002 27.91 28.315 21.66 110-114 22.175 28.24 27.54 22.045 115-119 22.1 28.78 27.435 21.685 120-124 22.55 27.87 28.01 21.57 125-129 22.509999999999998 27.485 28.03 21.975 130-134 22.6 28.000000000000004 28.265 21.135 135-139 22.32 28.050000000000004 27.650000000000002 21.98 140-144 23.391169558477923 28.30641532076604 27.27636381819091 21.026051302565126 145-149 24.240000000000002 28.294999999999998 26.61 20.855 150 23.275000000000002 27.950000000000003 26.875 21.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 2.0 21 1.0 22 2.0 23 4.0 24 6.0 25 6.0 26 7.0 27 12.0 28 14.0 29 24.0 30 38.0 31 40.5 32 41.0 33 53.0 34 67.5 35 88.0 36 100.5 37 109.0 38 128.5 39 158.0 40 192.0 41 216.5 42 237.5 43 255.5 44 262.0 45 266.5 46 269.0 47 244.0 48 206.0 49 195.5 50 177.5 51 140.5 52 108.0 53 83.5 54 67.0 55 42.0 56 31.5 57 30.0 58 23.0 59 14.0 60 9.0 61 8.0 62 5.0 63 2.5 64 2.5 65 1.5 66 1.0 67 2.5 68 2.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.475 #Duplication Level Percentage of deduplicated Percentage of total 1 98.45138359989846 96.95 2 1.5486164001015486 3.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTAG 10 0.006973645 144.0 4 TTTTAGA 15 1.1730364E-4 144.0 5 AGAGTGA 10 0.006973645 144.0 9 TACAACA 10 0.006973645 144.0 3 TTTAGAG 10 0.006973645 144.0 6 TAGAGTG 10 0.006973645 144.0 8 CAAGGTT 10 0.006973645 144.0 3 CTCAAGG 10 0.006973645 144.0 1 TTAGAGT 10 0.006973645 144.0 7 >>END_MODULE SRR22954656 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22954656_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0885 37.0 36.0 37.0 35.0 38.0 2 35.6 37.0 36.0 37.0 34.0 38.0 3 36.2185 37.0 36.0 37.0 35.0 38.0 4 36.2235 37.0 36.0 37.0 35.0 38.0 5 36.12875 37.0 36.0 37.0 35.0 38.0 6 36.0895 37.0 36.0 37.0 35.0 38.0 7 36.03875 37.0 36.0 37.0 35.0 38.0 8 36.22475 37.0 36.0 37.0 35.0 38.0 9 36.1575 37.0 36.0 37.0 35.0 38.0 10-14 36.099849999999996 37.0 36.0 37.0 34.8 38.0 15-19 36.116099999999996 37.0 36.0 37.0 35.0 38.0 20-24 36.08585 37.0 36.0 37.0 35.0 38.0 25-29 36.023199999999996 37.0 36.0 37.0 35.0 38.0 30-34 36.046499999999995 37.0 36.0 37.0 34.8 38.0 35-39 36.0209 37.0 36.0 37.0 34.4 38.0 40-44 35.9442 37.0 36.0 37.0 34.0 38.0 45-49 35.878099999999996 37.0 36.0 37.0 34.0 38.0 50-54 35.794 37.0 36.0 37.0 34.0 38.0 55-59 35.772400000000005 37.0 36.0 37.0 33.8 38.0 60-64 35.64955 37.0 36.0 37.0 33.4 38.0 65-69 35.545550000000006 37.0 36.0 37.0 33.0 38.0 70-74 35.505250000000004 37.0 36.0 37.0 33.0 38.0 75-79 35.3562 37.0 36.0 37.0 32.4 38.0 80-84 35.273450000000004 37.0 36.0 37.0 32.0 38.0 85-89 35.0854 37.0 35.2 37.0 31.4 38.0 90-94 34.995349999999995 37.0 35.4 37.0 30.8 38.0 95-99 34.714099999999995 37.0 35.0 37.0 29.8 38.0 100-104 34.5504 37.0 35.0 37.0 29.2 38.0 105-109 34.4908 37.0 35.0 37.0 28.4 38.0 110-114 34.115899999999996 37.0 35.0 37.0 26.6 38.0 115-119 33.9688 36.6 35.0 37.0 26.6 38.0 120-124 33.68375 36.2 34.4 37.0 24.8 38.0 125-129 33.457550000000005 36.0 34.2 37.0 23.2 38.0 130-134 33.100049999999996 36.0 33.8 37.0 22.4 37.6 135-139 32.80844999999999 36.0 33.0 37.0 21.0 37.2 140-144 32.3935 36.0 32.2 37.0 18.6 37.0 145-149 32.14135 36.0 31.8 37.0 17.8 37.4 150 31.91 36.0 31.0 37.0 17.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 1.0 27 16.0 28 60.0 29 78.0 30 128.0 31 155.0 32 239.0 33 350.0 34 548.0 35 844.0 36 1143.0 37 438.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.475 17.05 10.25 40.225 2 17.175 22.275 47.325 13.225000000000001 3 12.925 25.5 34.35 27.224999999999998 4 19.05 35.475 26.924999999999997 18.55 5 20.825 35.175 26.35 17.65 6 14.7 34.975 30.4 19.925 7 13.825000000000001 15.75 46.0 24.425 8 17.724999999999998 21.875 29.225 31.175000000000004 9 19.825 22.2 31.525 26.450000000000003 10-14 20.555 29.275000000000002 27.389999999999997 22.78 15-19 20.715 27.76 28.67 22.855 20-24 20.69 27.47 29.099999999999998 22.74 25-29 20.995 28.87 28.29 21.845 30-34 20.895 28.325 27.994999999999997 22.785 35-39 20.830000000000002 28.98 27.955000000000002 22.235 40-44 21.315 28.42 27.644999999999996 22.62 45-49 21.23 28.415000000000003 28.1 22.255 50-54 21.385 28.165000000000003 28.395 22.055 55-59 21.525 28.33 28.1 22.045 60-64 21.395 27.875 28.1 22.63 65-69 20.865000000000002 28.49 27.750000000000004 22.895 70-74 21.310000000000002 28.07 28.560000000000002 22.06 75-79 21.475 28.155 27.965 22.405 80-84 21.246062303115156 28.15640782039102 27.66638331916596 22.931146557327867 85-89 21.73 27.57 28.050000000000004 22.650000000000002 90-94 21.485000000000003 27.125 29.310000000000002 22.08 95-99 21.63 28.199999999999996 28.04 22.13 100-104 21.52 27.925 28.34 22.215 105-109 21.584999999999997 28.12 27.845 22.45 110-114 22.145 27.810000000000002 27.455000000000002 22.59 115-119 22.335 27.67 27.495000000000005 22.5 120-124 21.69 27.425 27.88 23.005 125-129 21.976098804940246 27.411370568528426 28.371418570928547 22.24111205560278 130-134 22.42 27.43 28.09 22.06 135-139 22.686134306715335 27.44637231861593 27.83639181959098 22.031101555077754 140-144 22.72113605680284 27.241362068103403 27.546377318865943 22.491124556227813 145-149 23.19347902185328 27.309096364454668 27.444116617492625 22.053307996199432 150 22.900000000000002 28.025 26.775 22.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 2.0 20 2.0 21 0.5 22 1.5 23 3.0 24 4.0 25 5.0 26 7.0 27 8.0 28 11.5 29 21.0 30 27.5 31 34.5 32 39.5 33 55.5 34 67.0 35 77.5 36 102.5 37 129.5 38 156.5 39 170.0 40 184.0 41 194.5 42 225.5 43 274.5 44 276.5 45 263.0 46 246.0 47 228.0 48 224.0 49 199.5 50 165.0 51 127.0 52 105.5 53 94.0 54 66.5 55 46.5 56 38.5 57 29.5 58 21.0 59 15.5 60 13.0 61 11.0 62 8.0 63 5.0 64 4.5 65 4.5 66 2.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.005 140-144 0.005 145-149 0.015 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.32499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.29646580218663 96.65 2 1.703534197813374 3.35 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCATT 10 0.006973645 144.0 1 >>END_MODULE Read 1565818 spots for SRR22954656.sra Written 1565818 spots for SRR22954656.sra Read 1565818 spots for SRR22954656.sra Written 1565818 spots for SRR22954656.sra Read 1565818 spots for SRR22954656.sra Written 1565818 spots for SRR22954656.sra Read 1565818 spots for SRR22954656.sra Written 1565818 spots for SRR22954656.sra Read 1565818 spots for SRR22954656.sra Written 1565818 spots for SRR22954656.sra Read 1565818 spots for SRR22954656.sra Written 1565818 spots for SRR22954656.sra Read 1565818 spots for SRR22954656.sra Written 1565818 spots for SRR22954656.sra Read 1565818 spots for SRR22954656.sra Written 1565818 spots for SRR22954656.sra Read 1565818 spots for SRR22954656.sra Written 1565818 spots for SRR22954656.sra Read 1565818 spots for SRR22954656.sra Written 1565818 spots for SRR22954656.sra Read 1565818 spots for SRR22954656.sra Written 1565818 spots for SRR22954656.sra Read 1565818 spots for SRR22954656.sra Written 1565818 spots for SRR22954656.sra Read 1565818 spots for SRR22954656.sra Written 1565818 spots for SRR22954656.sra Read 1565818 spots for SRR22954656.sra Written 1565818 spots for SRR22954656.sra Read 1565819 spots for SRR22954656.sra Written 1565819 spots for SRR22954656.sra Read 1565818 spots for SRR22954656.sra Written 1565818 spots for SRR22954656.sra Read 1565818 spots for SRR22954656.sra Written 1565818 spots for SRR22954656.sra Read 1565818 spots for SRR22954656.sra Written 1565818 spots for SRR22954656.sra Read 1565818 spots for SRR22954656.sra Written 1565818 spots for SRR22954656.sra Read 1565818 spots for SRR22954656.sra Written 1565818 spots for SRR22954656.sra SRR ids: ['SRR22954656.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vixznkl1 SRR22954656.sra spots: 31316361 blocks: [[1, 1565818], [1565819, 3131636], [3131637, 4697454], [4697455, 6263272], [6263273, 7829090], [7829091, 9394908], [9394909, 10960726], [10960727, 12526544], [12526545, 14092362], [14092363, 15658180], [15658181, 17223998], [17223999, 18789816], [18789817, 20355634], [20355635, 21921452], [21921453, 23487270], [23487271, 25053088], [25053089, 26618906], [26618907, 28184724], [28184725, 29750542], [29750543, 31316361]] SRR22954656 file size 11151720 SRR22954656 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22954656 SRR22954656_1.fastq SRR22954656_2.fastq Input file: SRR22954656_1.fastq Paired file: SRR22954656_2.fastq trimmed: SRR22954656-trimmed-pair1.fastq, SRR22954656-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:13:57 2025 >> started Thu Feb 13 17:14:36 2025 >> done (38.947s) 31316361 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 31316361 (100.00%) read pairs available; of these: 3084308 ( 9.85%) trimmed read pairs available after processing 28232053 (90.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 140 6 0.00% 141 24 0.00% 142 159 0.00% 143 147 0.00% 144 145 0.00% 145 132 0.00% 146 109 0.00% 147 1003 0.00% 148 45320 0.14% 149 3037263 9.70% 150 28232053 90.15% 31316361 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=61.85 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=26.8 sequence=AAGTCGGAGGCCAAGG criterion=fanout-score sequence-density=0.41 sequence-density-rank=1 fanout-score=61.85 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=26.8 sequence=AAGTCGGAGGCCAAGG criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=60.66 fanout-score-rank=2 prefix-density=0.88 prefix-fanout=27.1 sequence=AAGTCGGATCGTAGCCATGTCG criterion=fanout-score sequence-density=0.04 sequence-density-rank=38 fanout-score=84.05 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=12.0 sequence=TTCTTCATTGCCCTCCAACCCTAGCTCAGTCACCAGCTGCAGCCCCAGC SRR22954656 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:16:01 Started mapping on | Feb 13 17:16:01 Finished on | Feb 13 17:19:27 Mapping speed, Million of reads per hour | 547.28 Number of input reads | 31316361 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 29085104 Uniquely mapped reads % | 92.88% Average mapped length | 288.69 Number of splices: Total | 23551049 Number of splices: Annotated (sjdb) | 23124973 Number of splices: GT/AG | 23211386 Number of splices: GC/AG | 257198 Number of splices: AT/AC | 23771 Number of splices: Non-canonical | 58694 Mismatch rate per base, % | 0.97% Deletion rate per base | 0.02% Deletion average length | 2.34 Insertion rate per base | 0.01% Insertion average length | 1.87 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 544175 % of reads mapped to multiple loci | 1.74% Number of reads mapped to too many loci | 1026 % of reads mapped to too many loci | 0.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.38% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1687082 1687082 1687082 N_multimapping 544175 544175 544175 N_noFeature 880409 14264206 15352894 N_ambiguous 517236 87797 82279 UnstrandedReadsAssigned:27687459 PositiveStrandReadsAssigned:14733101 NegativeStrandReadsAssigned:13649931 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR22954656 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22954656-trimmed-pair1.fastq SRR22954656-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,316,361 reads, 29,603,874 reads pseudoaligned [quant] estimated average fragment length: 229.177 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,261 rounds 52401 SRR22954656.ke.tsv 34699 SRR22954656.se.tsv 87100 total ==> SRR22954656.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.82 1591 30.8339 Potri.005G024800.1.v4.1 1035 806.823 271 11.6509 Potri.004G059700.1.v4.1 961 732.823 33 1.56201 Potri.007G009000.2.v4.1 1416 1187.82 0 0 Potri.003G141000.2.v4.1 2943 2714.82 415.172 5.30462 Potri.016G087400.1.v4.1 270 74.1843 1548 723.814 Potri.015G069301.1.v4.1 564 336.246 0 0 Potri.010G195200.1.v4.1 1773 1544.82 86 1.93102 Potri.012G127500.1.v4.1 977 748.823 1941 89.9112 ==> SRR22954656.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4890 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 1416 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 81 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR22954656 completed mapping pipeline successfully