Starting /dee2/code/volunteer_pipeline.sh SRR23047988 current disk space = 3050321219584 free memory = 1582594720 SRR23047988 SRAfilesize 9564f7a0eb82ba84b158ce1b4e3ca2c8 SRR23047988.sra SRR23047988.sra file validated SRR23047988 is paired end SRR23047988 is conventional basespace SRR23047988 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR23047988_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.02275 37.0 37.0 37.0 37.0 37.0 2 35.966 37.0 37.0 37.0 37.0 37.0 3 36.2105 37.0 37.0 37.0 37.0 37.0 4 36.2775 37.0 37.0 37.0 37.0 37.0 5 36.3635 37.0 37.0 37.0 37.0 37.0 6 36.3135 37.0 37.0 37.0 37.0 37.0 7 36.232 37.0 37.0 37.0 37.0 37.0 8 36.34 37.0 37.0 37.0 37.0 37.0 9 36.367 37.0 37.0 37.0 37.0 37.0 10-14 36.2624 37.0 37.0 37.0 37.0 37.0 15-19 36.233 37.0 37.0 37.0 37.0 37.0 20-24 36.234 37.0 37.0 37.0 37.0 37.0 25-29 36.1925 37.0 37.0 37.0 37.0 37.0 30-34 36.122699999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.0778 37.0 37.0 37.0 37.0 37.0 40-44 36.1138 37.0 37.0 37.0 37.0 37.0 45-49 36.0671 37.0 37.0 37.0 37.0 37.0 50-54 36.0143 37.0 37.0 37.0 37.0 37.0 55-59 35.9899 37.0 37.0 37.0 37.0 37.0 60-64 35.97619999999999 37.0 37.0 37.0 37.0 37.0 65-69 35.932700000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.939499999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.9514 37.0 37.0 37.0 37.0 37.0 80-84 35.83749999999999 37.0 37.0 37.0 37.0 37.0 85-89 35.852999999999994 37.0 37.0 37.0 37.0 37.0 90-94 35.858000000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.7571 37.0 37.0 37.0 37.0 37.0 100-104 35.7363 37.0 37.0 37.0 37.0 37.0 105-109 35.6726 37.0 37.0 37.0 37.0 37.0 110-114 35.5756 37.0 37.0 37.0 37.0 37.0 115-119 35.7342 37.0 37.0 37.0 37.0 37.0 120-124 35.62820000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.3491 37.0 37.0 37.0 34.6 37.0 130-134 35.330600000000004 37.0 37.0 37.0 29.8 37.0 135-139 35.5306 37.0 37.0 37.0 34.6 37.0 140-144 35.3662 37.0 37.0 37.0 32.2 37.0 145-149 35.3167 37.0 37.0 37.0 32.2 37.0 150 35.4755 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 3.0 25 2.0 26 4.0 27 9.0 28 21.0 29 33.0 30 52.0 31 63.0 32 94.0 33 149.0 34 223.0 35 477.0 36 2697.0 37 173.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.37119879366675 8.469464689620509 9.801457652676552 44.35787886403619 2 19.650000000000002 13.3 37.675 29.375 3 22.675 16.725 22.8 37.8 4 25.650000000000002 25.05 17.875 31.424999999999997 5 23.925 29.4 22.1 24.575 6 17.625 33.475 27.025 21.875 7 13.3 25.95 41.075 19.675 8 18.075 22.75 34.275 24.9 9 18.0 24.025 34.025 23.95 10-14 19.15 29.494999999999997 27.474999999999998 23.880000000000003 15-19 19.715 27.76 28.465 24.060000000000002 20-24 20.34 27.605 28.13 23.925 25-29 19.919999999999998 28.33 28.144999999999996 23.605 30-34 19.8 28.58 27.57 24.05 35-39 19.895 27.91 27.67 24.525 40-44 20.13 28.415000000000003 27.845 23.61 45-49 20.47 27.455000000000002 28.189999999999998 23.885 50-54 20.724999999999998 28.13 27.3 23.845 55-59 20.36 27.705000000000002 27.625 24.310000000000002 60-64 20.34 28.355000000000004 26.840000000000003 24.465 65-69 20.64 27.834999999999997 27.615000000000002 23.91 70-74 19.945 28.285 27.215 24.555 75-79 20.53 27.74 27.415 24.315 80-84 20.544999999999998 27.534999999999997 27.765 24.154999999999998 85-89 20.105 27.779999999999998 27.900000000000002 24.215 90-94 21.055 27.584999999999997 27.250000000000004 24.11 95-99 21.12 27.425 27.36 24.095 100-104 20.78 28.48 27.175 23.565 105-109 21.145 27.93 27.33 23.595 110-114 20.7 28.189999999999998 27.05 24.060000000000002 115-119 20.86 27.43 27.794999999999998 23.915 120-124 20.669999999999998 27.505000000000003 27.51 24.315 125-129 21.02 28.005000000000003 27.275 23.7 130-134 21.105 27.229999999999997 28.13 23.535 135-139 20.77 27.255000000000003 27.41 24.565 140-144 20.810000000000002 28.275 27.13 23.785 145-149 21.23 27.13 28.125 23.515 150 20.95 26.8 28.575 23.674999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 1.5 26 3.5 27 6.0 28 8.5 29 9.0 30 16.5 31 23.0 32 37.0 33 40.0 34 31.5 35 46.0 36 66.5 37 93.5 38 121.0 39 143.5 40 164.0 41 191.0 42 224.0 43 254.5 44 280.0 45 291.0 46 267.0 47 248.5 48 249.0 49 226.0 50 174.0 51 151.0 52 142.0 53 111.0 54 86.0 55 71.0 56 60.0 57 39.0 58 30.0 59 28.5 60 20.0 61 12.5 62 8.5 63 6.5 64 4.0 65 1.5 66 2.5 67 1.0 68 0.0 69 3.0 70 3.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.375 #Duplication Level Percentage of deduplicated Percentage of total 1 88.54314002828855 78.25 2 10.042432814710041 17.75 3 1.2164073550212162 3.225 4 0.16973125884016974 0.6 5 0.0 0.0 6 0.0 0.0 7 0.028288543140028287 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCAGATCATCAAAGGTAGTTTCAAAAGCATGAGTATATCCGAAATTGA 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCGAG 10 0.006973645 144.0 5 >>END_MODULE SRR23047988 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR23047988_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.58475 37.0 37.0 37.0 37.0 37.0 2 35.7855 37.0 37.0 37.0 37.0 37.0 3 35.8055 37.0 37.0 37.0 37.0 37.0 4 35.8115 37.0 37.0 37.0 37.0 37.0 5 35.756 37.0 37.0 37.0 37.0 37.0 6 35.74 37.0 37.0 37.0 37.0 37.0 7 35.6455 37.0 37.0 37.0 37.0 37.0 8 35.9005 37.0 37.0 37.0 37.0 37.0 9 35.8705 37.0 37.0 37.0 37.0 37.0 10-14 35.7786 37.0 37.0 37.0 37.0 37.0 15-19 35.8307 37.0 37.0 37.0 37.0 37.0 20-24 35.8495 37.0 37.0 37.0 37.0 37.0 25-29 35.852 37.0 37.0 37.0 37.0 37.0 30-34 35.7543 37.0 37.0 37.0 37.0 37.0 35-39 35.69449999999999 37.0 37.0 37.0 37.0 37.0 40-44 35.715999999999994 37.0 37.0 37.0 37.0 37.0 45-49 35.7023 37.0 37.0 37.0 37.0 37.0 50-54 35.6935 37.0 37.0 37.0 37.0 37.0 55-59 35.5681 37.0 37.0 37.0 37.0 37.0 60-64 35.5025 37.0 37.0 37.0 37.0 37.0 65-69 35.5351 37.0 37.0 37.0 37.0 37.0 70-74 35.479 37.0 37.0 37.0 37.0 37.0 75-79 35.5025 37.0 37.0 37.0 37.0 37.0 80-84 35.3849 37.0 37.0 37.0 34.6 37.0 85-89 35.4331 37.0 37.0 37.0 37.0 37.0 90-94 35.323699999999995 37.0 37.0 37.0 34.6 37.0 95-99 35.214999999999996 37.0 37.0 37.0 29.8 37.0 100-104 35.32039999999999 37.0 37.0 37.0 34.6 37.0 105-109 35.3024 37.0 37.0 37.0 32.2 37.0 110-114 35.2404 37.0 37.0 37.0 29.8 37.0 115-119 35.07 37.0 37.0 37.0 25.0 37.0 120-124 35.1962 37.0 37.0 37.0 27.4 37.0 125-129 35.029700000000005 37.0 37.0 37.0 25.0 37.0 130-134 35.0215 37.0 37.0 37.0 25.0 37.0 135-139 34.9303 37.0 37.0 37.0 25.0 37.0 140-144 34.912099999999995 37.0 37.0 37.0 25.0 37.0 145-149 34.9378 37.0 37.0 37.0 25.0 37.0 150 34.742 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 6.0 23 6.0 24 15.0 25 13.0 26 15.0 27 24.0 28 28.0 29 37.0 30 60.0 31 90.0 32 110.0 33 155.0 34 285.0 35 776.0 36 2300.0 37 79.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.99421965317919 22.040713747172656 12.666499120382005 28.298567479266147 2 20.150000000000002 34.275 31.65 13.925 3 20.349999999999998 33.125 27.325 19.2 4 23.425 37.025000000000006 20.974999999999998 18.575 5 24.675 35.875 22.325 17.125 6 18.975 40.025 24.45 16.55 7 19.55 21.3 38.525 20.625 8 20.45 25.15 29.475 24.925 9 22.6 26.450000000000003 28.525 22.425 10-14 23.169999999999998 30.505 24.62 21.705 15-19 23.135 29.285 26.724999999999998 20.855 20-24 22.74 30.020000000000003 26.035000000000004 21.205 25-29 22.655 29.625 26.400000000000002 21.32 30-34 22.59 29.18 26.605 21.625 35-39 23.71 29.220000000000002 25.924999999999997 21.145 40-44 23.965 28.575 26.47 20.990000000000002 45-49 23.25 29.215000000000003 26.005 21.529999999999998 50-54 23.47 28.970000000000002 26.625 20.935000000000002 55-59 24.15 28.515 26.195 21.14 60-64 22.99 28.884999999999998 26.875 21.25 65-69 23.22 28.610000000000003 27.005000000000003 21.165 70-74 23.525 28.605000000000004 26.82 21.05 75-79 23.98 27.705000000000002 26.66 21.654999999999998 80-84 23.28 27.860000000000003 27.250000000000004 21.61 85-89 23.43 28.139999999999997 26.715 21.715 90-94 23.34 28.185 26.650000000000002 21.825 95-99 23.330000000000002 28.42 26.76 21.490000000000002 100-104 23.65 28.51 26.619999999999997 21.22 105-109 24.15 27.955000000000002 26.76 21.135 110-114 23.830000000000002 28.305000000000003 27.0 20.865000000000002 115-119 23.215 28.134999999999998 27.435 21.215 120-124 23.705000000000002 27.800000000000004 27.26 21.235 125-129 23.62 28.395 26.810000000000002 21.175 130-134 24.01 27.505000000000003 27.12 21.365000000000002 135-139 23.395 28.035 27.355 21.215 140-144 24.285 28.455000000000002 26.400000000000002 20.86 145-149 24.055 27.755000000000003 27.255000000000003 20.935000000000002 150 23.325000000000003 27.474999999999998 27.55 21.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 1.0 7 1.5 8 2.0 9 3.5 10 3.0 11 1.5 12 0.5 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 0.5 19 0.0 20 0.5 21 0.5 22 1.0 23 2.5 24 3.0 25 3.0 26 2.5 27 2.5 28 4.0 29 9.0 30 13.0 31 14.0 32 20.5 33 26.5 34 36.0 35 54.0 36 79.0 37 98.0 38 120.0 39 153.5 40 197.0 41 238.0 42 234.5 43 251.5 44 285.5 45 277.0 46 260.5 47 243.5 48 232.5 49 219.0 50 185.5 51 154.5 52 127.5 53 94.0 54 76.0 55 64.5 56 54.5 57 44.0 58 30.5 59 21.0 60 12.5 61 8.0 62 6.0 63 6.0 64 3.5 65 2.5 66 2.5 67 1.0 68 0.0 69 1.5 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.225 #Duplication Level Percentage of deduplicated Percentage of total 1 89.32474082376015 79.7 2 9.414401793219389 16.8 3 1.1207621182404035 3.0 4 0.14009526478005044 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTCCC 10 0.006973645 144.0 3 CCTCCCA 10 0.006973645 144.0 4 >>END_MODULE Read 1926081 spots for SRR23047988.sra Written 1926081 spots for SRR23047988.sra Read 1926081 spots for SRR23047988.sra Written 1926081 spots for SRR23047988.sra Read 1926081 spots for SRR23047988.sra Written 1926081 spots for SRR23047988.sra Read 1926081 spots for SRR23047988.sra Written 1926081 spots for SRR23047988.sra Read 1926081 spots for SRR23047988.sra Written 1926081 spots for SRR23047988.sra Read 1926081 spots for SRR23047988.sra Written 1926081 spots for SRR23047988.sra Read 1926081 spots for SRR23047988.sra Written 1926081 spots for SRR23047988.sra Read 1926095 spots for SRR23047988.sra Written 1926095 spots for SRR23047988.sra Read 1926081 spots for SRR23047988.sra Written 1926081 spots for SRR23047988.sra Read 1926081 spots for SRR23047988.sra Written 1926081 spots for SRR23047988.sra Read 1926081 spots for SRR23047988.sra Written 1926081 spots for SRR23047988.sra Read 1926081 spots for SRR23047988.sra Written 1926081 spots for SRR23047988.sra Read 1926081 spots for SRR23047988.sra Written 1926081 spots for SRR23047988.sra Read 1926081 spots for SRR23047988.sra Written 1926081 spots for SRR23047988.sra Read 1926081 spots for SRR23047988.sra Written 1926081 spots for SRR23047988.sra Read 1926081 spots for SRR23047988.sra Written 1926081 spots for SRR23047988.sra Read 1926081 spots for SRR23047988.sra Written 1926081 spots for SRR23047988.sra Read 1926081 spots for SRR23047988.sra Written 1926081 spots for SRR23047988.sra Read 1926081 spots for SRR23047988.sra Written 1926081 spots for SRR23047988.sra Read 1926081 spots for SRR23047988.sra Written 1926081 spots for SRR23047988.sra SRR ids: ['SRR23047988.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_shvu0cde SRR23047988.sra spots: 38521634 blocks: [[1, 1926081], [1926082, 3852162], [3852163, 5778243], [5778244, 7704324], [7704325, 9630405], [9630406, 11556486], [11556487, 13482567], [13482568, 15408648], [15408649, 17334729], [17334730, 19260810], [19260811, 21186891], [21186892, 23112972], [23112973, 25039053], [25039054, 26965134], [26965135, 28891215], [28891216, 30817296], [30817297, 32743377], [32743378, 34669458], [34669459, 36595539], [36595540, 38521634]] SRR23047988 file size 12994398 SRR23047988 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR23047988 SRR23047988_1.fastq SRR23047988_2.fastq Input file: SRR23047988_1.fastq Paired file: SRR23047988_2.fastq trimmed: SRR23047988-trimmed-pair1.fastq, SRR23047988-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 06:48:20 2025 >> started Wed Feb 12 06:49:04 2025 >> done (43.999s) 38521634 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 38521634 (100.00%) read pairs available; of these: 89835 ( 0.23%) trimmed read pairs available after processing 38431799 (99.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 1 0.00% 27 3 0.00% 28 1 0.00% 29 0 0.00% 30 1 0.00% 31 0 0.00% 32 0 0.00% 33 3 0.00% 34 1 0.00% 35 1 0.00% 36 1 0.00% 37 0 0.00% 38 1 0.00% 39 1 0.00% 40 1 0.00% 41 1 0.00% 42 3 0.00% 43 2 0.00% 44 0 0.00% 45 4 0.00% 46 4 0.00% 47 1 0.00% 48 0 0.00% 49 6 0.00% 50 3 0.00% 51 6 0.00% 52 4 0.00% 53 3 0.00% 54 4 0.00% 55 6 0.00% 56 3 0.00% 57 1 0.00% 58 3 0.00% 59 3 0.00% 60 3 0.00% 61 8 0.00% 62 5 0.00% 63 3 0.00% 64 3 0.00% 65 1 0.00% 66 5 0.00% 67 5 0.00% 68 3 0.00% 69 3 0.00% 70 3 0.00% 71 5 0.00% 72 4 0.00% 73 4 0.00% 74 4 0.00% 75 5 0.00% 76 4 0.00% 77 3 0.00% 78 6 0.00% 79 10 0.00% 80 4 0.00% 81 12 0.00% 82 10 0.00% 83 6 0.00% 84 9 0.00% 85 6 0.00% 86 5 0.00% 87 8 0.00% 88 13 0.00% 89 10 0.00% 90 4 0.00% 91 4 0.00% 92 7 0.00% 93 11 0.00% 94 7 0.00% 95 2 0.00% 96 8 0.00% 97 5 0.00% 98 8 0.00% 99 7 0.00% 100 5 0.00% 101 7 0.00% 102 9 0.00% 103 12 0.00% 104 9 0.00% 105 9 0.00% 106 11 0.00% 107 9 0.00% 108 8 0.00% 109 18 0.00% 110 8 0.00% 111 7 0.00% 112 6 0.00% 113 10 0.00% 114 13 0.00% 115 8 0.00% 116 11 0.00% 117 6 0.00% 118 17 0.00% 119 6 0.00% 120 9 0.00% 121 21 0.00% 122 18 0.00% 123 16 0.00% 124 15 0.00% 125 12 0.00% 126 11 0.00% 127 10 0.00% 128 9 0.00% 129 12 0.00% 130 19 0.00% 131 18 0.00% 132 13 0.00% 133 21 0.00% 134 23 0.00% 135 15 0.00% 136 27 0.00% 137 16 0.00% 138 0 0.00% 139 0 0.00% 140 10 0.00% 141 57 0.00% 142 69 0.00% 143 64 0.00% 144 0 0.00% 145 223 0.00% 146 21185 0.05% 147 21899 0.06% 148 22522 0.06% 149 23026 0.06% 150 38431799 99.77% 38521634 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=5.34 fanout-score-rank=14 prefix-density=0.25 prefix-fanout=4.7 sequence=AACATCTGAATTGCATATGATACGGCTGGAAGTGACCGCAAAGTCATTCGAAGCGGCTCCGATGATATAACGATCACCAGTTCTAACCTCATCACCGAAGACATCGATCACTGCTTCAGCATGAACGGCACGAGGAAATATTGAAGTTGCCGTGAAGGCAAAGAG criterion=fanout-score sequence-density=0.10 sequence-density-rank=22 fanout-score=43.75 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=10.1 sequence=AATTTCTTCCAATTCCAAGCTCCTGTGAAAGCAACAGCAAGCGGCACGGAAACATCACCTGGCACTATACTTTCTTTATCAAGGCTCCCAGCACTACCAAAGTGAATAATTCCATGAATACGGAATCTATTCAAGAGGATTTGCACAGCAATGGCAGCATTTACAGAATTTCCCCCGATCTTAACATATACAATAAAACGAGCATTAAGTGTCCCAATGTGGAACCTTCTCCCCGCAATGTCAACATAAGGCGTTTCAGCATCAGGTGTGAAGAGACCAGAGTCTTGAAGGGCCTTTTCGTTG criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.73 fanout-score-rank=22 prefix-density=0.41 prefix-fanout=2.5 sequence=ATAGAGAGAAAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=482.41 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=12.3 sequence=AAAAAGAAGACCGTCAACTCCAACCCACGGCCACCAAACATCATCTCTTCAATCGTAAATCACAAATACATACACGTTTACTCATCAGCTCGAAAATGGCAGCAG SRR23047988 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 06:49:48 Started mapping on | Feb 12 06:49:48 Finished on | Feb 12 06:53:22 Mapping speed, Million of reads per hour | 648.03 Number of input reads | 38521634 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 36644716 Uniquely mapped reads % | 95.13% Average mapped length | 299.12 Number of splices: Total | 36161945 Number of splices: Annotated (sjdb) | 35605378 Number of splices: GT/AG | 35563369 Number of splices: GC/AG | 504119 Number of splices: AT/AC | 27442 Number of splices: Non-canonical | 67015 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.02% Deletion average length | 2.76 Insertion rate per base | 0.01% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1161204 % of reads mapped to multiple loci | 3.01% Number of reads mapped to too many loci | 231809 % of reads mapped to too many loci | 0.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.06% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 715714 715714 715714 N_multimapping 1161204 1161204 1161204 N_noFeature 812894 36326703 901468 N_ambiguous 448776 1439 218430 UnstrandedReadsAssigned:35383046 PositiveStrandReadsAssigned:316574 NegativeStrandReadsAssigned:35524818 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR23047988 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR23047988-trimmed-pair1.fastq SRR23047988-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,521,634 reads, 36,361,013 reads pseudoaligned [quant] estimated average fragment length: 291.716 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,147 rounds 52401 SRR23047988.ke.tsv 34699 SRR23047988.se.tsv 87100 total ==> SRR23047988.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1727.28 2945 35.197 Potri.005G024800.1.v4.1 1035 744.284 2109 58.4954 Potri.004G059700.1.v4.1 961 670.303 17 0.523554 Potri.007G009000.2.v4.1 1416 1125.28 0 0 Potri.003G141000.2.v4.1 2943 2652.28 1401 10.9044 Potri.016G087400.1.v4.1 270 47.0832 1595 699.324 Potri.015G069301.1.v4.1 564 274.65 0 0 Potri.010G195200.1.v4.1 1773 1482.28 786 10.9465 Potri.012G127500.1.v4.1 977 686.297 7508 225.838 ==> SRR23047988.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 72 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 454 Potri.001G212900.v4.1 204 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 68 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 17 SRR23047988 completed mapping pipeline successfully