Starting /dee2/code/volunteer_pipeline.sh SRR23047989 current disk space = 3050248761344 free memory = 1582606004 SRR23047989 SRAfilesize 04c01bf1475d3e3794e3b9ec1685c5bb SRR23047989.sra SRR23047989.sra file validated SRR23047989 is paired end SRR23047989 is conventional basespace SRR23047989 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR23047989_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9815 37.0 37.0 37.0 37.0 37.0 2 35.9965 37.0 37.0 37.0 37.0 37.0 3 36.174 37.0 37.0 37.0 37.0 37.0 4 36.3305 37.0 37.0 37.0 37.0 37.0 5 36.436 37.0 37.0 37.0 37.0 37.0 6 36.222 37.0 37.0 37.0 37.0 37.0 7 36.217 37.0 37.0 37.0 37.0 37.0 8 36.223 37.0 37.0 37.0 37.0 37.0 9 36.2135 37.0 37.0 37.0 37.0 37.0 10-14 36.270799999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.2384 37.0 37.0 37.0 37.0 37.0 20-24 36.251999999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.1104 37.0 37.0 37.0 37.0 37.0 30-34 36.1211 37.0 37.0 37.0 37.0 37.0 35-39 36.0477 37.0 37.0 37.0 37.0 37.0 40-44 36.0389 37.0 37.0 37.0 37.0 37.0 45-49 36.084799999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.0484 37.0 37.0 37.0 37.0 37.0 55-59 35.940900000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.0034 37.0 37.0 37.0 37.0 37.0 65-69 35.9705 37.0 37.0 37.0 37.0 37.0 70-74 35.925599999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.8712 37.0 37.0 37.0 37.0 37.0 80-84 35.866 37.0 37.0 37.0 37.0 37.0 85-89 35.8108 37.0 37.0 37.0 37.0 37.0 90-94 35.802200000000006 37.0 37.0 37.0 37.0 37.0 95-99 35.8103 37.0 37.0 37.0 37.0 37.0 100-104 35.7494 37.0 37.0 37.0 37.0 37.0 105-109 35.5828 37.0 37.0 37.0 37.0 37.0 110-114 35.674 37.0 37.0 37.0 37.0 37.0 115-119 35.7038 37.0 37.0 37.0 37.0 37.0 120-124 35.616800000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.452799999999996 37.0 37.0 37.0 34.6 37.0 130-134 35.2761 37.0 37.0 37.0 29.8 37.0 135-139 35.502500000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.307100000000005 37.0 37.0 37.0 32.2 37.0 145-149 35.327000000000005 37.0 37.0 37.0 32.2 37.0 150 35.436 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 5.0 26 5.0 27 6.0 28 16.0 29 36.0 30 59.0 31 71.0 32 110.0 33 149.0 34 214.0 35 438.0 36 2706.0 37 183.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.32245102963335 8.689100954294325 9.743847312908088 43.24460070316424 2 19.7 13.350000000000001 38.45 28.499999999999996 3 23.599999999999998 16.675 22.3 37.425000000000004 4 26.700000000000003 25.75 18.375 29.175 5 24.025 29.675 23.549999999999997 22.75 6 19.375 33.6 27.05 19.975 7 14.95 25.900000000000002 41.3 17.849999999999998 8 18.25 23.925 33.4 24.425 9 17.599999999999998 23.65 35.0 23.75 10-14 19.875 29.29 27.875 22.96 15-19 19.85 28.68 27.994999999999997 23.474999999999998 20-24 20.41 28.165000000000003 28.03 23.395 25-29 20.055 28.325 28.365000000000002 23.255 30-34 19.950000000000003 27.950000000000003 28.125 23.974999999999998 35-39 20.485 27.894999999999996 27.765 23.855 40-44 20.36 28.38 28.165000000000003 23.095 45-49 20.86 27.13 28.375 23.635 50-54 20.785 28.075 27.63 23.51 55-59 20.325 28.03 27.765 23.880000000000003 60-64 20.4 27.55 28.34 23.71 65-69 20.544999999999998 28.07 28.115000000000002 23.27 70-74 20.43 27.96 28.29 23.32 75-79 20.919999999999998 27.605 27.544999999999998 23.93 80-84 21.065 27.775 27.805000000000003 23.355 85-89 20.235 27.51 28.1 24.154999999999998 90-94 21.33 28.060000000000002 27.525 23.085 95-99 21.21 27.83 27.82 23.14 100-104 21.45 28.21 27.279999999999998 23.06 105-109 20.7 28.035 27.72 23.544999999999998 110-114 20.835 27.700000000000003 28.015 23.45 115-119 20.825 28.205000000000002 27.295 23.674999999999997 120-124 20.07 27.565 28.050000000000004 24.315 125-129 21.0 27.985 27.985 23.03 130-134 20.990000000000002 27.534999999999997 27.705000000000002 23.77 135-139 21.035 26.805 28.439999999999998 23.72 140-144 21.195 27.310000000000002 27.855 23.64 145-149 21.51 27.66 28.01 22.82 150 20.424999999999997 26.900000000000002 26.825 25.85 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.5 23 3.0 24 1.5 25 2.0 26 5.0 27 5.5 28 9.5 29 16.0 30 16.5 31 16.5 32 20.0 33 33.5 34 48.0 35 56.5 36 69.0 37 92.0 38 122.5 39 159.0 40 196.0 41 209.5 42 226.0 43 260.5 44 285.5 45 302.5 46 296.5 47 260.5 48 228.0 49 202.0 50 162.5 51 127.0 52 114.0 53 107.5 54 88.0 55 58.0 56 44.5 57 42.5 58 30.5 59 17.5 60 11.5 61 11.5 62 8.0 63 4.5 64 6.0 65 6.5 66 3.5 67 1.0 68 1.0 69 1.0 70 1.0 71 0.0 72 1.0 73 1.5 74 1.5 75 1.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.5 #Duplication Level Percentage of deduplicated Percentage of total 1 90.52486187845304 81.925 2 8.646408839779006 15.65 3 0.6629834254143646 1.7999999999999998 4 0.13812154696132595 0.5 5 0.027624309392265196 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCCTGGAAGTTGAGCACGAAGGACAGATCCATCAGGGAGGACCAGCTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAGGTA 10 0.006973645 144.0 7 >>END_MODULE SRR23047989 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR23047989_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.4075 37.0 37.0 37.0 37.0 37.0 2 35.4305 37.0 37.0 37.0 37.0 37.0 3 35.494 37.0 37.0 37.0 37.0 37.0 4 35.604 37.0 37.0 37.0 37.0 37.0 5 35.5795 37.0 37.0 37.0 37.0 37.0 6 35.399 37.0 37.0 37.0 37.0 37.0 7 35.447 37.0 37.0 37.0 37.0 37.0 8 35.6425 37.0 37.0 37.0 37.0 37.0 9 35.6415 37.0 37.0 37.0 37.0 37.0 10-14 35.5773 37.0 37.0 37.0 37.0 37.0 15-19 35.611200000000004 37.0 37.0 37.0 37.0 37.0 20-24 35.66160000000001 37.0 37.0 37.0 37.0 37.0 25-29 35.65749999999999 37.0 37.0 37.0 37.0 37.0 30-34 35.4577 37.0 37.0 37.0 37.0 37.0 35-39 35.501 37.0 37.0 37.0 37.0 37.0 40-44 35.4304 37.0 37.0 37.0 37.0 37.0 45-49 35.3323 37.0 37.0 37.0 34.6 37.0 50-54 35.4563 37.0 37.0 37.0 37.0 37.0 55-59 35.357899999999994 37.0 37.0 37.0 34.6 37.0 60-64 35.218599999999995 37.0 37.0 37.0 29.8 37.0 65-69 35.142399999999995 37.0 37.0 37.0 27.4 37.0 70-74 35.2012 37.0 37.0 37.0 29.8 37.0 75-79 35.226000000000006 37.0 37.0 37.0 29.8 37.0 80-84 35.1205 37.0 37.0 37.0 29.8 37.0 85-89 35.0545 37.0 37.0 37.0 27.4 37.0 90-94 35.0239 37.0 37.0 37.0 25.0 37.0 95-99 34.900400000000005 37.0 37.0 37.0 25.0 37.0 100-104 34.9471 37.0 37.0 37.0 25.0 37.0 105-109 34.9519 37.0 37.0 37.0 25.0 37.0 110-114 34.857099999999996 37.0 37.0 37.0 25.0 37.0 115-119 34.7162 37.0 37.0 37.0 25.0 37.0 120-124 34.7975 37.0 37.0 37.0 25.0 37.0 125-129 34.611200000000004 37.0 37.0 37.0 25.0 37.0 130-134 34.6205 37.0 37.0 37.0 25.0 37.0 135-139 34.491 37.0 37.0 37.0 25.0 37.0 140-144 34.4694 37.0 37.0 37.0 25.0 37.0 145-149 34.5142 37.0 37.0 37.0 25.0 37.0 150 34.606 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 7.0 23 9.0 24 12.0 25 22.0 26 22.0 27 39.0 28 36.0 29 60.0 30 75.0 31 94.0 32 150.0 33 190.0 34 303.0 35 931.0 36 1989.0 37 59.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.23355097940733 21.597187343043696 14.138623807132095 29.030637870416875 2 19.0 34.150000000000006 32.25 14.6 3 19.3 32.725 28.475 19.5 4 24.075 37.95 19.675 18.3 5 23.549999999999997 37.75 21.825 16.875 6 19.225 41.15 23.95 15.675 7 18.8 20.9 39.5 20.8 8 20.599999999999998 25.074999999999996 28.999999999999996 25.324999999999996 9 23.1 27.0 28.075 21.825 10-14 23.235 30.525000000000002 25.124999999999996 21.115000000000002 15-19 22.71 29.604999999999997 27.255000000000003 20.43 20-24 22.68 29.475 27.66 20.185 25-29 22.040000000000003 29.825000000000003 27.125 21.01 30-34 22.225 29.985 26.855 20.935000000000002 35-39 23.41 28.835 27.185 20.57 40-44 23.44 28.315 27.99 20.255000000000003 45-49 22.900000000000002 28.68 27.500000000000004 20.919999999999998 50-54 22.25 28.625 27.950000000000003 21.175 55-59 23.025000000000002 28.625 27.495000000000005 20.855 60-64 23.325000000000003 28.13 27.555000000000003 20.990000000000002 65-69 23.075000000000003 28.084999999999997 27.655 21.185000000000002 70-74 23.14 28.425 27.189999999999998 21.245 75-79 23.365 28.215 27.41 21.01 80-84 23.355 28.365000000000002 27.155 21.125 85-89 23.630000000000003 28.715000000000003 26.93 20.724999999999998 90-94 23.875 28.384999999999998 26.57 21.17 95-99 23.494999999999997 28.985 26.834999999999997 20.685000000000002 100-104 23.22 28.24 27.205000000000002 21.335 105-109 23.31 28.37 27.26 21.060000000000002 110-114 23.265 28.660000000000004 27.29 20.785 115-119 23.735 28.16 27.275 20.830000000000002 120-124 23.549999999999997 28.705000000000002 26.75 20.995 125-129 23.400000000000002 28.305000000000003 26.915 21.38 130-134 23.155 28.03 27.465 21.349999999999998 135-139 23.72 27.855 26.840000000000003 21.584999999999997 140-144 22.994999999999997 28.625 27.125 21.255 145-149 23.7 28.294999999999998 26.674999999999997 21.33 150 23.849999999999998 28.65 26.775 20.724999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 1.0 5 1.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 2.0 15 2.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.5 23 1.5 24 2.0 25 5.0 26 8.0 27 6.5 28 6.0 29 8.5 30 17.5 31 23.5 32 29.0 33 46.0 34 56.0 35 64.0 36 83.0 37 109.5 38 140.0 39 170.5 40 193.0 41 231.5 42 261.5 43 277.5 44 289.5 45 284.5 46 287.0 47 257.0 48 218.0 49 193.5 50 158.5 51 127.0 52 100.5 53 76.0 54 61.0 55 48.0 56 35.0 57 30.0 58 24.0 59 15.5 60 8.5 61 7.0 62 6.0 63 5.5 64 3.0 65 0.5 66 1.0 67 1.0 68 1.0 69 0.5 70 1.0 71 1.0 72 0.5 73 0.5 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 1.5 99 1.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.325 #Duplication Level Percentage of deduplicated Percentage of total 1 91.37695045168354 83.45 2 7.856556255132767 14.35 3 0.6569942513003011 1.7999999999999998 4 0.10949904188338351 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTTCAA 10 0.006973645 144.0 5 >>END_MODULE Read 1940793 spots for SRR23047989.sra Written 1940793 spots for SRR23047989.sra Read 1940793 spots for SRR23047989.sra Written 1940793 spots for SRR23047989.sra Read 1940793 spots for SRR23047989.sra Written 1940793 spots for SRR23047989.sra Read 1940793 spots for SRR23047989.sra Written 1940793 spots for SRR23047989.sra Read 1940793 spots for SRR23047989.sra Written 1940793 spots for SRR23047989.sra Read 1940793 spots for SRR23047989.sra Written 1940793 spots for SRR23047989.sra Read 1940793 spots for SRR23047989.sra Written 1940793 spots for SRR23047989.sra Read 1940793 spots for SRR23047989.sra Written 1940793 spots for SRR23047989.sra Read 1940793 spots for SRR23047989.sra Written 1940793 spots for SRR23047989.sra Read 1940793 spots for SRR23047989.sra Written 1940793 spots for SRR23047989.sra Read 1940793 spots for SRR23047989.sra Written 1940793 spots for SRR23047989.sra Read 1940797 spots for SRR23047989.sra Written 1940797 spots for SRR23047989.sra Read 1940793 spots for SRR23047989.sra Written 1940793 spots for SRR23047989.sra Read 1940793 spots for SRR23047989.sra Written 1940793 spots for SRR23047989.sra Read 1940793 spots for SRR23047989.sra Written 1940793 spots for SRR23047989.sra Read 1940793 spots for SRR23047989.sra Written 1940793 spots for SRR23047989.sra Read 1940793 spots for SRR23047989.sra Written 1940793 spots for SRR23047989.sra Read 1940793 spots for SRR23047989.sra Written 1940793 spots for SRR23047989.sra Read 1940793 spots for SRR23047989.sra Written 1940793 spots for SRR23047989.sra Read 1940793 spots for SRR23047989.sra Written 1940793 spots for SRR23047989.sra SRR ids: ['SRR23047989.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zb_xswi6 SRR23047989.sra spots: 38815864 blocks: [[1, 1940793], [1940794, 3881586], [3881587, 5822379], [5822380, 7763172], [7763173, 9703965], [9703966, 11644758], [11644759, 13585551], [13585552, 15526344], [15526345, 17467137], [17467138, 19407930], [19407931, 21348723], [21348724, 23289516], [23289517, 25230309], [25230310, 27171102], [27171103, 29111895], [29111896, 31052688], [31052689, 32993481], [32993482, 34934274], [34934275, 36875067], [36875068, 38815864]] SRR23047989 file size 13093816 SRR23047989 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR23047989 SRR23047989_1.fastq SRR23047989_2.fastq Input file: SRR23047989_1.fastq Paired file: SRR23047989_2.fastq trimmed: SRR23047989-trimmed-pair1.fastq, SRR23047989-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 06:50:26 2025 >> started Wed Feb 12 06:51:11 2025 >> done (45.151s) 38815864 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 38815864 (100.00%) read pairs available; of these: 93107 ( 0.24%) trimmed read pairs available after processing 38722757 (99.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 2 0.00% 22 1 0.00% 23 2 0.00% 24 0 0.00% 25 3 0.00% 26 3 0.00% 27 1 0.00% 28 2 0.00% 29 3 0.00% 30 2 0.00% 31 2 0.00% 32 4 0.00% 33 6 0.00% 34 2 0.00% 35 7 0.00% 36 7 0.00% 37 10 0.00% 38 12 0.00% 39 5 0.00% 40 8 0.00% 41 12 0.00% 42 6 0.00% 43 9 0.00% 44 4 0.00% 45 9 0.00% 46 4 0.00% 47 10 0.00% 48 9 0.00% 49 6 0.00% 50 9 0.00% 51 7 0.00% 52 13 0.00% 53 10 0.00% 54 16 0.00% 55 12 0.00% 56 15 0.00% 57 13 0.00% 58 12 0.00% 59 24 0.00% 60 16 0.00% 61 22 0.00% 62 21 0.00% 63 18 0.00% 64 20 0.00% 65 12 0.00% 66 12 0.00% 67 14 0.00% 68 14 0.00% 69 15 0.00% 70 17 0.00% 71 22 0.00% 72 20 0.00% 73 24 0.00% 74 17 0.00% 75 17 0.00% 76 21 0.00% 77 21 0.00% 78 20 0.00% 79 16 0.00% 80 24 0.00% 81 25 0.00% 82 26 0.00% 83 30 0.00% 84 17 0.00% 85 31 0.00% 86 38 0.00% 87 21 0.00% 88 16 0.00% 89 23 0.00% 90 25 0.00% 91 22 0.00% 92 28 0.00% 93 29 0.00% 94 22 0.00% 95 20 0.00% 96 28 0.00% 97 15 0.00% 98 22 0.00% 99 28 0.00% 100 29 0.00% 101 25 0.00% 102 32 0.00% 103 18 0.00% 104 35 0.00% 105 23 0.00% 106 29 0.00% 107 28 0.00% 108 32 0.00% 109 28 0.00% 110 30 0.00% 111 36 0.00% 112 22 0.00% 113 27 0.00% 114 31 0.00% 115 27 0.00% 116 21 0.00% 117 33 0.00% 118 36 0.00% 119 14 0.00% 120 27 0.00% 121 36 0.00% 122 41 0.00% 123 45 0.00% 124 59 0.00% 125 30 0.00% 126 22 0.00% 127 22 0.00% 128 33 0.00% 129 29 0.00% 130 49 0.00% 131 52 0.00% 132 35 0.00% 133 38 0.00% 134 39 0.00% 135 39 0.00% 136 41 0.00% 137 41 0.00% 138 0 0.00% 139 0 0.00% 140 29 0.00% 141 103 0.00% 142 101 0.00% 143 120 0.00% 144 0 0.00% 145 331 0.00% 146 21499 0.06% 147 22100 0.06% 148 22740 0.06% 149 23718 0.06% 150 38722757 99.76% 38815864 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=3.10 fanout-score-rank=21 prefix-density=0.45 prefix-fanout=2.8 sequence=TTTATCAACCCAAACCCAAACCCTATCACA criterion=fanout-score sequence-density=0.08 sequence-density-rank=31 fanout-score=24.06 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=8.0 sequence=AGCACCAAGTGGAGGGTGGACTCCTTCTGGATGTTGTA criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=4.30 fanout-score-rank=13 prefix-density=0.62 prefix-fanout=3.2 sequence=CTGAAGCAGTGATCGATGTCTTCGGTGATGAGGTTAGAACTGGTGATCGTTATATCATCGGAGCCGCTTCGAATGACTTTGCGGTCACTTCCAGCCGTATCATATGCAA criterion=fanout-score sequence-density=0.10 sequence-density-rank=25 fanout-score=22.93 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=7.5 sequence=AAGGCCAAGATCCAGGACAAGGAGGG SRR23047989 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 06:51:53 Started mapping on | Feb 12 06:51:54 Finished on | Feb 12 06:56:11 Mapping speed, Million of reads per hour | 543.72 Number of input reads | 38815864 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 36248182 Uniquely mapped reads % | 93.38% Average mapped length | 298.90 Number of splices: Total | 35473498 Number of splices: Annotated (sjdb) | 34691404 Number of splices: GT/AG | 34939462 Number of splices: GC/AG | 436390 Number of splices: AT/AC | 26987 Number of splices: Non-canonical | 70659 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.02% Deletion average length | 2.79 Insertion rate per base | 0.01% Insertion average length | 1.93 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1476024 % of reads mapped to multiple loci | 3.80% Number of reads mapped to too many loci | 454664 % of reads mapped to too many loci | 1.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.16% % of reads unmapped: other | 0.48% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1091658 1091658 1091658 N_multimapping 1476024 1476024 1476024 N_noFeature 825863 35929793 961303 N_ambiguous 378321 3630 192504 UnstrandedReadsAssigned:35043998 PositiveStrandReadsAssigned:314759 NegativeStrandReadsAssigned:35094375 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR23047989 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR23047989-trimmed-pair1.fastq SRR23047989-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,815,864 reads, 36,244,845 reads pseudoaligned [quant] estimated average fragment length: 293.85 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,140 rounds 52401 SRR23047989.ke.tsv 34699 SRR23047989.se.tsv 87100 total ==> SRR23047989.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1725.15 7691 104.1 Potri.005G024800.1.v4.1 1035 742.15 4379 137.777 Potri.004G059700.1.v4.1 961 668.185 14 0.489245 Potri.007G009000.2.v4.1 1416 1123.15 0 0 Potri.003G141000.2.v4.1 2943 2650.15 1413.22 12.4518 Potri.016G087400.1.v4.1 270 47.3078 1202 593.289 Potri.015G069301.1.v4.1 564 272.972 0 0 Potri.010G195200.1.v4.1 1773 1480.15 2272.81 35.8552 Potri.012G127500.1.v4.1 977 684.157 5372 183.347 ==> SRR23047989.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 6 Potri.001G122700.v4.1 740 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 976 SRR23047989 completed mapping pipeline successfully