Starting /dee2/code/volunteer_pipeline.sh SRR23047990 current disk space = 3050290376704 free memory = 1582699284 SRR23047990 SRAfilesize 968e6e987f50696b0e4cff433ef69f62 SRR23047990.sra SRR23047990.sra file validated SRR23047990 is paired end SRR23047990 is conventional basespace SRR23047990 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR23047990_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0985 37.0 37.0 37.0 37.0 37.0 2 36.1505 37.0 37.0 37.0 37.0 37.0 3 36.1305 37.0 37.0 37.0 37.0 37.0 4 36.3195 37.0 37.0 37.0 37.0 37.0 5 36.353 37.0 37.0 37.0 37.0 37.0 6 36.308 37.0 37.0 37.0 37.0 37.0 7 36.168 37.0 37.0 37.0 37.0 37.0 8 36.257 37.0 37.0 37.0 37.0 37.0 9 36.175 37.0 37.0 37.0 37.0 37.0 10-14 36.219 37.0 37.0 37.0 37.0 37.0 15-19 36.2001 37.0 37.0 37.0 37.0 37.0 20-24 36.2157 37.0 37.0 37.0 37.0 37.0 25-29 36.1669 37.0 37.0 37.0 37.0 37.0 30-34 36.094199999999994 37.0 37.0 37.0 37.0 37.0 35-39 35.9955 37.0 37.0 37.0 37.0 37.0 40-44 36.0483 37.0 37.0 37.0 37.0 37.0 45-49 36.049400000000006 37.0 37.0 37.0 37.0 37.0 50-54 35.9662 37.0 37.0 37.0 37.0 37.0 55-59 35.95889999999999 37.0 37.0 37.0 37.0 37.0 60-64 35.9391 37.0 37.0 37.0 37.0 37.0 65-69 35.917899999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.8736 37.0 37.0 37.0 37.0 37.0 75-79 35.907500000000006 37.0 37.0 37.0 37.0 37.0 80-84 35.7771 37.0 37.0 37.0 37.0 37.0 85-89 35.735699999999994 37.0 37.0 37.0 37.0 37.0 90-94 35.7761 37.0 37.0 37.0 37.0 37.0 95-99 35.8155 37.0 37.0 37.0 37.0 37.0 100-104 35.7091 37.0 37.0 37.0 37.0 37.0 105-109 35.607 37.0 37.0 37.0 37.0 37.0 110-114 35.6009 37.0 37.0 37.0 37.0 37.0 115-119 35.5878 37.0 37.0 37.0 37.0 37.0 120-124 35.6356 37.0 37.0 37.0 37.0 37.0 125-129 35.39399999999999 37.0 37.0 37.0 32.2 37.0 130-134 35.2648 37.0 37.0 37.0 29.8 37.0 135-139 35.421499999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.3646 37.0 37.0 37.0 32.2 37.0 145-149 35.306599999999996 37.0 37.0 37.0 29.8 37.0 150 35.3805 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 6.0 26 8.0 27 12.0 28 16.0 29 40.0 30 37.0 31 73.0 32 95.0 33 160.0 34 252.0 35 461.0 36 2642.0 37 196.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.527847466131455 8.780732563973908 10.235825388861015 44.45559458103362 2 19.575 13.55 38.875 28.000000000000004 3 22.525000000000002 16.375 23.05 38.05 4 26.35 25.3 19.1 29.25 5 23.05 30.225 24.925 21.8 6 19.775000000000002 31.125000000000004 28.599999999999998 20.5 7 13.725000000000001 26.224999999999998 41.025 19.025 8 18.725 22.675 34.050000000000004 24.55 9 17.95 22.075 35.675000000000004 24.3 10-14 19.765 29.735 27.29 23.21 15-19 20.335 28.384999999999998 28.095 23.185 20-24 19.885 28.355000000000004 28.199999999999996 23.56 25-29 20.28 27.435 28.565 23.72 30-34 20.185 27.465 28.26 24.09 35-39 20.369999999999997 27.450000000000003 28.599999999999998 23.580000000000002 40-44 20.335 27.915 28.175 23.575 45-49 20.185 28.115000000000002 28.125 23.575 50-54 19.64 28.38 28.125 23.855 55-59 20.349999999999998 27.63 28.310000000000002 23.71 60-64 19.634999999999998 28.144999999999996 28.705000000000002 23.515 65-69 20.810000000000002 27.455000000000002 28.055000000000003 23.68 70-74 20.94 27.705000000000002 27.93 23.425 75-79 20.419999999999998 27.634999999999998 28.294999999999998 23.65 80-84 20.43 27.445000000000004 27.950000000000003 24.175 85-89 20.095 27.694999999999997 28.365000000000002 23.845 90-94 20.215 28.075 28.065 23.645 95-99 20.22 27.405 28.449999999999996 23.925 100-104 20.78 27.755000000000003 28.01 23.455000000000002 105-109 20.715 27.305 27.865000000000002 24.115000000000002 110-114 20.525 27.195000000000004 28.165000000000003 24.115000000000002 115-119 20.525 27.735 27.85 23.89 120-124 20.535 27.400000000000002 27.37 24.695 125-129 21.125 27.060000000000002 28.345 23.47 130-134 20.86 26.815 28.59 23.735 135-139 20.674999999999997 27.500000000000004 28.09 23.735 140-144 20.96 27.634999999999998 28.105000000000004 23.3 145-149 20.745 27.51 28.04 23.705000000000002 150 20.1 26.950000000000003 28.249999999999996 24.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 2.0 23 2.5 24 1.0 25 1.5 26 4.5 27 5.0 28 6.5 29 10.0 30 15.5 31 20.5 32 25.0 33 35.0 34 45.0 35 60.0 36 82.5 37 110.5 38 121.0 39 149.5 40 194.5 41 222.0 42 246.5 43 264.5 44 270.5 45 283.5 46 279.5 47 266.0 48 233.5 49 198.0 50 184.0 51 149.5 52 114.0 53 85.5 54 67.0 55 48.5 56 38.0 57 37.5 58 30.0 59 19.0 60 12.5 61 7.5 62 8.0 63 4.5 64 2.5 65 5.0 66 6.5 67 5.5 68 2.0 69 2.0 70 3.0 71 1.5 72 1.5 73 2.5 74 1.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.725 #Duplication Level Percentage of deduplicated Percentage of total 1 90.49324882887848 82.1 2 8.87296775971342 16.1 3 0.5511160099200882 1.5 4 0.08266740148801323 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTTCAA 10 0.006973645 144.0 1 >>END_MODULE SRR23047990 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR23047990_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.629 37.0 37.0 37.0 37.0 37.0 2 35.5675 37.0 37.0 37.0 37.0 37.0 3 35.634 37.0 37.0 37.0 37.0 37.0 4 35.6515 37.0 37.0 37.0 37.0 37.0 5 35.699 37.0 37.0 37.0 37.0 37.0 6 35.467 37.0 37.0 37.0 37.0 37.0 7 35.4705 37.0 37.0 37.0 37.0 37.0 8 35.672 37.0 37.0 37.0 37.0 37.0 9 35.7725 37.0 37.0 37.0 37.0 37.0 10-14 35.74 37.0 37.0 37.0 37.0 37.0 15-19 35.740700000000004 37.0 37.0 37.0 37.0 37.0 20-24 35.7209 37.0 37.0 37.0 37.0 37.0 25-29 35.7342 37.0 37.0 37.0 37.0 37.0 30-34 35.6854 37.0 37.0 37.0 37.0 37.0 35-39 35.6896 37.0 37.0 37.0 37.0 37.0 40-44 35.541000000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.5376 37.0 37.0 37.0 37.0 37.0 50-54 35.517700000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.463800000000006 37.0 37.0 37.0 37.0 37.0 60-64 35.3614 37.0 37.0 37.0 34.6 37.0 65-69 35.31699999999999 37.0 37.0 37.0 34.6 37.0 70-74 35.2597 37.0 37.0 37.0 34.6 37.0 75-79 35.366200000000006 37.0 37.0 37.0 34.6 37.0 80-84 35.2456 37.0 37.0 37.0 32.2 37.0 85-89 35.1677 37.0 37.0 37.0 27.4 37.0 90-94 35.1329 37.0 37.0 37.0 25.0 37.0 95-99 35.049 37.0 37.0 37.0 27.4 37.0 100-104 35.11 37.0 37.0 37.0 29.8 37.0 105-109 35.1802 37.0 37.0 37.0 25.0 37.0 110-114 34.9813 37.0 37.0 37.0 25.0 37.0 115-119 34.837 37.0 37.0 37.0 25.0 37.0 120-124 34.8818 37.0 37.0 37.0 25.0 37.0 125-129 34.8087 37.0 37.0 37.0 25.0 37.0 130-134 34.686699999999995 37.0 37.0 37.0 25.0 37.0 135-139 34.6838 37.0 37.0 37.0 25.0 37.0 140-144 34.69179999999999 37.0 37.0 37.0 25.0 37.0 145-149 34.7903 37.0 37.0 37.0 25.0 37.0 150 34.7815 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 5.0 23 12.0 24 16.0 25 16.0 26 17.0 27 25.0 28 31.0 29 55.0 30 78.0 31 78.0 32 119.0 33 174.0 34 310.0 35 905.0 36 2108.0 37 50.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.22328148519819 21.625689914701454 14.776718514801807 28.374310085298543 2 19.6 32.75 33.925 13.725000000000001 3 19.85 33.35 27.224999999999998 19.575 4 25.25 37.55 19.075 18.125 5 23.875 37.875 21.2 17.05 6 19.15 41.575 23.025000000000002 16.25 7 18.55 21.4 40.35 19.7 8 21.075 23.849999999999998 29.15 25.924999999999997 9 23.1 25.8 28.599999999999998 22.5 10-14 23.77 29.935000000000002 25.169999999999998 21.125 15-19 23.48 29.459999999999997 26.35 20.71 20-24 23.23 29.849999999999998 26.565 20.355 25-29 23.085 30.380000000000003 25.88 20.655 30-34 23.13 29.43 26.43 21.01 35-39 22.985 29.74 26.450000000000003 20.825 40-44 23.275000000000002 28.835 26.805 21.085 45-49 22.89 28.749999999999996 27.18 21.18 50-54 22.53 29.604999999999997 26.845000000000002 21.02 55-59 23.735 28.705000000000002 26.415 21.145 60-64 23.78 28.595 26.479999999999997 21.145 65-69 23.76 28.37 27.175 20.695 70-74 23.61 29.04 26.545 20.805 75-79 23.75 28.12 26.33 21.8 80-84 23.28 28.860000000000003 26.88 20.979999999999997 85-89 24.83 28.439999999999998 26.334999999999997 20.395 90-94 23.93 28.65 26.490000000000002 20.93 95-99 23.925 28.345 26.889999999999997 20.84 100-104 23.405 28.475 26.88 21.240000000000002 105-109 23.845 28.49 26.665 21.0 110-114 23.044999999999998 28.675 27.384999999999998 20.895 115-119 23.71 28.71 26.655 20.925 120-124 23.535 28.910000000000004 26.605 20.95 125-129 23.015 28.615000000000002 27.215 21.154999999999998 130-134 24.175 28.29 26.465 21.07 135-139 24.15 28.235 27.08 20.535 140-144 23.875 28.165000000000003 27.224999999999998 20.735 145-149 23.52 28.21 26.945000000000004 21.325 150 23.549999999999997 29.025000000000002 27.125 20.3 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 1.5 9 1.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.5 22 0.5 23 0.5 24 2.0 25 2.0 26 1.5 27 5.5 28 7.5 29 10.5 30 17.5 31 22.5 32 26.0 33 34.5 34 43.0 35 61.5 36 85.0 37 104.5 38 132.5 39 154.0 40 192.0 41 226.5 42 248.0 43 281.5 44 288.0 45 284.0 46 282.0 47 260.0 48 230.5 49 198.5 50 159.0 51 120.5 52 98.0 53 82.0 54 65.0 55 59.5 56 50.0 57 38.0 58 29.5 59 16.0 60 10.5 61 10.5 62 11.5 63 9.0 64 6.0 65 4.5 66 1.0 67 0.5 68 0.5 69 1.0 70 2.0 71 1.5 72 1.5 73 2.0 74 1.5 75 0.5 76 0.0 77 1.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.05 #Duplication Level Percentage of deduplicated Percentage of total 1 91.02141680395387 82.875 2 8.237232289950576 15.0 3 0.6315211422295441 1.725 4 0.10982976386600769 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1933001 spots for SRR23047990.sra Written 1933001 spots for SRR23047990.sra Read 1933001 spots for SRR23047990.sra Written 1933001 spots for SRR23047990.sra Read 1933001 spots for SRR23047990.sra Written 1933001 spots for SRR23047990.sra Read 1933001 spots for SRR23047990.sra Written 1933001 spots for SRR23047990.sra Read 1933001 spots for SRR23047990.sra Written 1933001 spots for SRR23047990.sra Read 1933001 spots for SRR23047990.sra Written 1933001 spots for SRR23047990.sra Read 1933001 spots for SRR23047990.sra Written 1933001 spots for SRR23047990.sra Read 1933001 spots for SRR23047990.sra Written 1933001 spots for SRR23047990.sra Read 1933001 spots for SRR23047990.sra Written 1933001 spots for SRR23047990.sra Read 1933001 spots for SRR23047990.sra Written 1933001 spots for SRR23047990.sra Read 1933001 spots for SRR23047990.sra Written 1933001 spots for SRR23047990.sra Read 1933001 spots for SRR23047990.sra Written 1933001 spots for SRR23047990.sra Read 1933001 spots for SRR23047990.sra Written 1933001 spots for SRR23047990.sra Read 1933010 spots for SRR23047990.sra Written 1933010 spots for SRR23047990.sra Read 1933001 spots for SRR23047990.sra Written 1933001 spots for SRR23047990.sra Read 1933001 spots for SRR23047990.sra Written 1933001 spots for SRR23047990.sra Read 1933001 spots for SRR23047990.sra Written 1933001 spots for SRR23047990.sra Read 1933001 spots for SRR23047990.sra Written 1933001 spots for SRR23047990.sra Read 1933001 spots for SRR23047990.sra Written 1933001 spots for SRR23047990.sra Read 1933001 spots for SRR23047990.sra Written 1933001 spots for SRR23047990.sra SRR ids: ['SRR23047990.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yd2iv_al SRR23047990.sra spots: 38660029 blocks: [[1, 1933001], [1933002, 3866002], [3866003, 5799003], [5799004, 7732004], [7732005, 9665005], [9665006, 11598006], [11598007, 13531007], [13531008, 15464008], [15464009, 17397009], [17397010, 19330010], [19330011, 21263011], [21263012, 23196012], [23196013, 25129013], [25129014, 27062014], [27062015, 28995015], [28995016, 30928016], [30928017, 32861017], [32861018, 34794018], [34794019, 36727019], [36727020, 38660029]] SRR23047990 file size 13041160 SRR23047990 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR23047990 SRR23047990_1.fastq SRR23047990_2.fastq Input file: SRR23047990_1.fastq Paired file: SRR23047990_2.fastq trimmed: SRR23047990-trimmed-pair1.fastq, SRR23047990-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 06:59:35 2025 >> started Wed Feb 12 07:00:17 2025 >> done (41.894s) 38660029 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 38660029 (100.00%) read pairs available; of these: 96118 ( 0.25%) trimmed read pairs available after processing 38563911 (99.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 23 1 0.00% 24 0 0.00% 25 1 0.00% 26 0 0.00% 27 2 0.00% 28 2 0.00% 29 1 0.00% 30 2 0.00% 31 1 0.00% 32 4 0.00% 33 3 0.00% 34 4 0.00% 35 5 0.00% 36 2 0.00% 37 6 0.00% 38 4 0.00% 39 4 0.00% 40 9 0.00% 41 6 0.00% 42 5 0.00% 43 5 0.00% 44 13 0.00% 45 5 0.00% 46 4 0.00% 47 5 0.00% 48 10 0.00% 49 8 0.00% 50 6 0.00% 51 10 0.00% 52 6 0.00% 53 8 0.00% 54 6 0.00% 55 6 0.00% 56 15 0.00% 57 15 0.00% 58 14 0.00% 59 17 0.00% 60 14 0.00% 61 16 0.00% 62 16 0.00% 63 18 0.00% 64 13 0.00% 65 13 0.00% 66 21 0.00% 67 19 0.00% 68 11 0.00% 69 16 0.00% 70 18 0.00% 71 16 0.00% 72 17 0.00% 73 20 0.00% 74 12 0.00% 75 11 0.00% 76 10 0.00% 77 22 0.00% 78 13 0.00% 79 18 0.00% 80 22 0.00% 81 20 0.00% 82 16 0.00% 83 29 0.00% 84 19 0.00% 85 23 0.00% 86 17 0.00% 87 24 0.00% 88 21 0.00% 89 20 0.00% 90 23 0.00% 91 31 0.00% 92 18 0.00% 93 22 0.00% 94 26 0.00% 95 16 0.00% 96 22 0.00% 97 11 0.00% 98 20 0.00% 99 23 0.00% 100 21 0.00% 101 20 0.00% 102 17 0.00% 103 19 0.00% 104 22 0.00% 105 26 0.00% 106 25 0.00% 107 29 0.00% 108 19 0.00% 109 24 0.00% 110 31 0.00% 111 24 0.00% 112 23 0.00% 113 25 0.00% 114 30 0.00% 115 22 0.00% 116 24 0.00% 117 30 0.00% 118 43 0.00% 119 5 0.00% 120 15 0.00% 121 46 0.00% 122 40 0.00% 123 35 0.00% 124 47 0.00% 125 27 0.00% 126 27 0.00% 127 22 0.00% 128 40 0.00% 129 26 0.00% 130 35 0.00% 131 32 0.00% 132 43 0.00% 133 46 0.00% 134 33 0.00% 135 38 0.00% 136 48 0.00% 137 38 0.00% 138 0 0.00% 139 0 0.00% 140 13 0.00% 141 98 0.00% 142 98 0.00% 143 90 0.00% 144 0 0.00% 145 327 0.00% 146 22187 0.06% 147 23102 0.06% 148 23572 0.06% 149 24562 0.06% 150 38563911 99.75% 38660029 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.91 fanout-score-rank=18 prefix-density=0.43 prefix-fanout=2.7 sequence=TTTATCAACCCAAACCCAAACCCTATCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=34.04 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.3 sequence=ATTGCAATACACGCATGGAGATTGGATCCTGGCTCCTTACTCCATTTTATTCTTTTATTCTAGGTACAGTCCACAGTTCCACAGCATTCCTTAACAATATCACAAGAATATATCGCAGTTTTTTGGATCTTAACCAA criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=6.82 fanout-score-rank=7 prefix-density=0.67 prefix-fanout=4.4 sequence=GTTGAAGCTATAATTGTGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=199.08 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=9.2 sequence=GGTGGAGGAGACCTTACTAGTATCATCTCAAGAGAAAAGTTCAACGAGATGCTCAAACATAGAAATGATGGCGGATGCCCGGCCAAGGGATTCTACACTTACGATGCTTTCATCTCAGCCGCCAAGGCCTTCCCTGGATTTGGCACTACTGGTGATGTTGCCACTCGTAAAAGGGAGATTGCTGCTTTCTTCGGCCAGACCTCTCATGAAACTACTGGAGGATGGCAAACTGCACC SRR23047990 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 07:01:06 Started mapping on | Feb 12 07:01:06 Finished on | Feb 12 07:05:12 Mapping speed, Million of reads per hour | 565.76 Number of input reads | 38660029 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 35735835 Uniquely mapped reads % | 92.44% Average mapped length | 298.97 Number of splices: Total | 35260277 Number of splices: Annotated (sjdb) | 34502147 Number of splices: GT/AG | 34724091 Number of splices: GC/AG | 437919 Number of splices: AT/AC | 28718 Number of splices: Non-canonical | 69549 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.02% Deletion average length | 2.93 Insertion rate per base | 0.01% Insertion average length | 1.93 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1429701 % of reads mapped to multiple loci | 3.70% Number of reads mapped to too many loci | 800578 % of reads mapped to too many loci | 2.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.13% % of reads unmapped: other | 0.66% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1494493 1494493 1494493 N_multimapping 1429701 1429701 1429701 N_noFeature 825830 35399606 964293 N_ambiguous 393547 2716 193792 UnstrandedReadsAssigned:34516458 PositiveStrandReadsAssigned:333513 NegativeStrandReadsAssigned:34577750 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR23047990 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR23047990-trimmed-pair1.fastq SRR23047990-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,660,029 reads, 35,890,881 reads pseudoaligned [quant] estimated average fragment length: 293.198 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,230 rounds 52401 SRR23047990.ke.tsv 34699 SRR23047990.se.tsv 87100 total ==> SRR23047990.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1725.8 6783 90.0148 Potri.005G024800.1.v4.1 1035 742.802 2875 88.6436 Potri.004G059700.1.v4.1 961 668.813 18 0.616384 Potri.007G009000.2.v4.1 1416 1123.8 0 0 Potri.003G141000.2.v4.1 2943 2650.8 1207.42 10.4319 Potri.016G087400.1.v4.1 270 47.1673 1095 531.687 Potri.015G069301.1.v4.1 564 273.312 0 0 Potri.010G195200.1.v4.1 1773 1480.8 2488 38.4801 Potri.012G127500.1.v4.1 977 684.802 5655 189.126 ==> SRR23047990.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 713 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1293 SRR23047990 completed mapping pipeline successfully