Starting /dee2/code/volunteer_pipeline.sh SRR23047991 current disk space = 3050284138496 free memory = 1293713380 SRR23047991 SRAfilesize 97a24be5274c962edc7a2b9fa51dbcf5 SRR23047991.sra SRR23047991.sra file validated SRR23047991 is paired end SRR23047991 is conventional basespace SRR23047991 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR23047991_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9735 37.0 37.0 37.0 37.0 37.0 2 35.8955 37.0 37.0 37.0 37.0 37.0 3 36.186 37.0 37.0 37.0 37.0 37.0 4 36.192 37.0 37.0 37.0 37.0 37.0 5 36.273 37.0 37.0 37.0 37.0 37.0 6 36.2055 37.0 37.0 37.0 37.0 37.0 7 36.1295 37.0 37.0 37.0 37.0 37.0 8 36.325 37.0 37.0 37.0 37.0 37.0 9 36.22 37.0 37.0 37.0 37.0 37.0 10-14 36.21750000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.247699999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.187599999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.175200000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.168899999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.0431 37.0 37.0 37.0 37.0 37.0 40-44 35.9737 37.0 37.0 37.0 37.0 37.0 45-49 36.0578 37.0 37.0 37.0 37.0 37.0 50-54 35.9774 37.0 37.0 37.0 37.0 37.0 55-59 35.950300000000006 37.0 37.0 37.0 37.0 37.0 60-64 35.9591 37.0 37.0 37.0 37.0 37.0 65-69 35.965199999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.93429999999999 37.0 37.0 37.0 37.0 37.0 75-79 35.8264 37.0 37.0 37.0 37.0 37.0 80-84 35.8406 37.0 37.0 37.0 37.0 37.0 85-89 35.7867 37.0 37.0 37.0 37.0 37.0 90-94 35.785700000000006 37.0 37.0 37.0 37.0 37.0 95-99 35.7247 37.0 37.0 37.0 37.0 37.0 100-104 35.6709 37.0 37.0 37.0 37.0 37.0 105-109 35.621900000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.5416 37.0 37.0 37.0 37.0 37.0 115-119 35.624 37.0 37.0 37.0 37.0 37.0 120-124 35.5824 37.0 37.0 37.0 37.0 37.0 125-129 35.3799 37.0 37.0 37.0 37.0 37.0 130-134 35.3157 37.0 37.0 37.0 32.2 37.0 135-139 35.4148 37.0 37.0 37.0 37.0 37.0 140-144 35.3842 37.0 37.0 37.0 34.6 37.0 145-149 35.3533 37.0 37.0 37.0 34.6 37.0 150 35.546 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 5.0 27 16.0 28 25.0 29 40.0 30 49.0 31 75.0 32 99.0 33 139.0 34 223.0 35 489.0 36 2666.0 37 174.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.81900452488688 7.290095525389644 9.653092006033184 43.2378079436903 2 21.2 11.450000000000001 39.15 28.199999999999996 3 24.0 15.075 23.075000000000003 37.85 4 26.724999999999998 24.8 19.125 29.349999999999998 5 23.849999999999998 28.799999999999997 23.9 23.45 6 20.7 31.724999999999998 27.675 19.900000000000002 7 14.124999999999998 25.825 42.675000000000004 17.375 8 19.15 21.975 34.599999999999994 24.275 9 19.6 21.375 34.949999999999996 24.075 10-14 19.825 29.485 27.97 22.720000000000002 15-19 20.215 27.965 28.194999999999997 23.625 20-24 20.825 28.33 26.87 23.974999999999998 25-29 20.375 28.225 28.225 23.175 30-34 21.38 27.02 27.915 23.685000000000002 35-39 20.715 27.825 28.189999999999998 23.27 40-44 20.810000000000002 28.32 27.765 23.105 45-49 20.955 27.73 27.88 23.435 50-54 20.84 26.995 28.015 24.15 55-59 20.200000000000003 28.33 28.249999999999996 23.22 60-64 20.724999999999998 27.815 27.85 23.61 65-69 21.085 27.589999999999996 28.315 23.01 70-74 21.26 27.175 28.044999999999998 23.52 75-79 20.5 27.534999999999997 27.93 24.035 80-84 20.9 28.060000000000002 26.745 24.295 85-89 20.275000000000002 28.494999999999997 27.775 23.455000000000002 90-94 20.97 28.335 27.250000000000004 23.445 95-99 21.295 27.200000000000003 28.055000000000003 23.45 100-104 21.765 27.3 27.625 23.31 105-109 20.979999999999997 27.49 28.075 23.455000000000002 110-114 21.2 27.935 27.49 23.375 115-119 21.37 26.93 27.985 23.715 120-124 21.17 28.28 27.115000000000002 23.435 125-129 21.54 27.265 27.77 23.425 130-134 21.22 27.534999999999997 27.705000000000002 23.54 135-139 20.78 26.86 28.055000000000003 24.305 140-144 21.57 26.974999999999998 28.53 22.925 145-149 21.85 27.48 27.72 22.95 150 20.05 26.575 28.9 24.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 2.0 25 1.5 26 2.0 27 3.0 28 4.0 29 7.0 30 9.5 31 16.5 32 25.5 33 31.5 34 42.0 35 49.5 36 69.0 37 98.5 38 130.5 39 150.0 40 166.5 41 215.5 42 251.0 43 267.0 44 282.0 45 277.0 46 276.0 47 267.5 48 231.0 49 195.0 50 177.5 51 158.5 52 130.5 53 104.5 54 77.0 55 60.0 56 55.5 57 44.5 58 25.0 59 19.5 60 17.5 61 12.0 62 9.0 63 5.0 64 5.0 65 6.5 66 3.5 67 3.0 68 3.0 69 3.0 70 2.5 71 0.5 72 0.5 73 0.5 74 0.5 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5499999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.0 #Duplication Level Percentage of deduplicated Percentage of total 1 89.01685393258427 79.225 2 9.775280898876403 17.4 3 1.095505617977528 2.9250000000000003 4 0.08426966292134831 0.3 5 0.0 0.0 6 0.02808988764044944 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACAAGGGCGACAAGCCTACAGGCAACTGGTTTTGTGCCTCAATTACTAAA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGCAA 10 0.006973645 144.0 1 AAAAAAA 65 2.1579981E-5 17.723076 85-89 >>END_MODULE SRR23047991 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR23047991_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.5975 37.0 37.0 37.0 37.0 37.0 2 35.735 37.0 37.0 37.0 37.0 37.0 3 35.734 37.0 37.0 37.0 37.0 37.0 4 35.6975 37.0 37.0 37.0 37.0 37.0 5 35.897 37.0 37.0 37.0 37.0 37.0 6 35.766 37.0 37.0 37.0 37.0 37.0 7 35.6325 37.0 37.0 37.0 37.0 37.0 8 35.93 37.0 37.0 37.0 37.0 37.0 9 35.838 37.0 37.0 37.0 37.0 37.0 10-14 35.8027 37.0 37.0 37.0 37.0 37.0 15-19 35.8349 37.0 37.0 37.0 37.0 37.0 20-24 35.777300000000004 37.0 37.0 37.0 37.0 37.0 25-29 35.8155 37.0 37.0 37.0 37.0 37.0 30-34 35.668600000000005 37.0 37.0 37.0 37.0 37.0 35-39 35.5925 37.0 37.0 37.0 37.0 37.0 40-44 35.604699999999994 37.0 37.0 37.0 37.0 37.0 45-49 35.5961 37.0 37.0 37.0 37.0 37.0 50-54 35.5755 37.0 37.0 37.0 37.0 37.0 55-59 35.5067 37.0 37.0 37.0 37.0 37.0 60-64 35.411 37.0 37.0 37.0 34.6 37.0 65-69 35.3397 37.0 37.0 37.0 34.6 37.0 70-74 35.3954 37.0 37.0 37.0 34.6 37.0 75-79 35.3952 37.0 37.0 37.0 34.6 37.0 80-84 35.292 37.0 37.0 37.0 32.2 37.0 85-89 35.3523 37.0 37.0 37.0 34.6 37.0 90-94 35.2299 37.0 37.0 37.0 29.8 37.0 95-99 35.07300000000001 37.0 37.0 37.0 27.4 37.0 100-104 35.1229 37.0 37.0 37.0 27.4 37.0 105-109 35.055600000000005 37.0 37.0 37.0 25.0 37.0 110-114 35.0333 37.0 37.0 37.0 25.0 37.0 115-119 34.9697 37.0 37.0 37.0 25.0 37.0 120-124 34.988600000000005 37.0 37.0 37.0 25.0 37.0 125-129 34.8266 37.0 37.0 37.0 25.0 37.0 130-134 34.7087 37.0 37.0 37.0 25.0 37.0 135-139 34.7204 37.0 37.0 37.0 25.0 37.0 140-144 34.6425 37.0 37.0 37.0 25.0 37.0 145-149 34.739999999999995 37.0 37.0 37.0 25.0 37.0 150 34.7505 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 9.0 23 9.0 24 6.0 25 19.0 26 23.0 27 30.0 28 43.0 29 53.0 30 62.0 31 88.0 32 113.0 33 159.0 34 291.0 35 821.0 36 2194.0 37 80.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.545500251382606 21.84514831573655 12.996480643539469 29.61287078934138 2 19.375 35.875 31.35 13.4 3 20.849999999999998 33.050000000000004 26.424999999999997 19.675 4 24.65 37.025000000000006 19.325 19.0 5 24.825 36.625 22.55 16.0 6 18.075 41.125 23.7 17.1 7 18.925 20.724999999999998 39.875 20.474999999999998 8 21.9 25.1 27.625 25.374999999999996 9 22.95 26.724999999999998 28.075 22.25 10-14 23.025000000000002 31.369999999999997 24.265 21.34 15-19 22.75 30.070000000000004 26.825 20.355 20-24 22.535 30.53 26.31 20.625 25-29 23.315 29.285 25.845000000000002 21.555 30-34 22.53 29.32 26.779999999999998 21.37 35-39 22.3 30.25 26.71 20.74 40-44 22.53 29.335 27.034999999999997 21.099999999999998 45-49 23.055 29.255 26.665 21.025 50-54 22.505 30.115 27.025 20.355 55-59 23.695 28.810000000000002 26.605 20.89 60-64 23.244999999999997 29.12 26.640000000000004 20.995 65-69 23.119999999999997 28.560000000000002 27.334999999999997 20.985 70-74 23.23 29.4 26.634999999999998 20.735 75-79 23.25 28.83 26.88 21.04 80-84 23.525 28.189999999999998 27.575 20.71 85-89 23.425 28.04 27.655 20.880000000000003 90-94 23.685000000000002 28.485 26.5 21.33 95-99 22.965 28.59 26.72 21.725 100-104 23.98 28.095 26.805 21.12 105-109 23.48 28.73 26.314999999999998 21.475 110-114 23.244999999999997 28.415000000000003 27.015 21.325 115-119 23.655 28.050000000000004 27.485 20.810000000000002 120-124 23.59 28.355000000000004 26.895000000000003 21.16 125-129 23.69 28.544999999999998 27.150000000000002 20.615 130-134 23.395 28.265 27.18 21.16 135-139 23.97 28.904999999999998 26.825 20.3 140-144 23.895 27.925 26.834999999999997 21.345 145-149 23.669999999999998 28.115000000000002 27.060000000000002 21.154999999999998 150 21.825 29.875 27.175 21.125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 1.0 9 1.5 10 1.5 11 1.5 12 1.0 13 1.0 14 1.5 15 0.5 16 0.5 17 1.5 18 1.5 19 0.5 20 0.0 21 0.0 22 0.5 23 0.5 24 2.5 25 3.0 26 2.5 27 5.0 28 8.0 29 10.5 30 13.5 31 16.0 32 22.0 33 34.0 34 51.0 35 70.5 36 85.5 37 115.0 38 144.0 39 154.0 40 213.0 41 258.5 42 254.0 43 268.5 44 289.5 45 285.0 46 259.5 47 243.0 48 234.0 49 204.5 50 158.0 51 131.5 52 107.0 53 79.5 54 58.5 55 43.5 56 39.5 57 34.5 58 23.5 59 15.0 60 9.0 61 6.0 62 6.0 63 6.0 64 4.0 65 1.0 66 1.0 67 2.0 68 1.0 69 0.5 70 1.0 71 1.5 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5499999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 89.57809443978765 80.15 2 9.332215702710254 16.7 3 0.9499860296172116 2.55 4 0.08382229673093043 0.3 5 0.0 0.0 6 0.05588153115395362 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit CGAAGACCGACAATGAGAAACGTCACTGCAAGATTAAGAGAGATAACTGC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 70 7.738999E-4 14.4 110-114 >>END_MODULE Read 1885451 spots for SRR23047991.sra Written 1885451 spots for SRR23047991.sra Read 1885451 spots for SRR23047991.sra Written 1885451 spots for SRR23047991.sra Read 1885451 spots for SRR23047991.sra Written 1885451 spots for SRR23047991.sra Read 1885451 spots for SRR23047991.sra Written 1885451 spots for SRR23047991.sra Read 1885451 spots for SRR23047991.sra Written 1885451 spots for SRR23047991.sra Read 1885451 spots for SRR23047991.sra Written 1885451 spots for SRR23047991.sra Read 1885451 spots for SRR23047991.sra Written 1885451 spots for SRR23047991.sra Read 1885451 spots for SRR23047991.sra Written 1885451 spots for SRR23047991.sra Read 1885451 spots for SRR23047991.sra Written 1885451 spots for SRR23047991.sra Read 1885451 spots for SRR23047991.sra Written 1885451 spots for SRR23047991.sra Read 1885451 spots for SRR23047991.sra Written 1885451 spots for SRR23047991.sra Read 1885451 spots for SRR23047991.sra Written 1885451 spots for SRR23047991.sra Read 1885451 spots for SRR23047991.sra Written 1885451 spots for SRR23047991.sra Read 1885462 spots for SRR23047991.sra Written 1885462 spots for SRR23047991.sra Read 1885451 spots for SRR23047991.sra Written 1885451 spots for SRR23047991.sra Read 1885451 spots for SRR23047991.sra Written 1885451 spots for SRR23047991.sra Read 1885451 spots for SRR23047991.sra Written 1885451 spots for SRR23047991.sra Read 1885451 spots for SRR23047991.sra Written 1885451 spots for SRR23047991.sra Read 1885451 spots for SRR23047991.sra Written 1885451 spots for SRR23047991.sra Read 1885451 spots for SRR23047991.sra Written 1885451 spots for SRR23047991.sra SRR ids: ['SRR23047991.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0nk2xz8c SRR23047991.sra spots: 37709031 blocks: [[1, 1885451], [1885452, 3770902], [3770903, 5656353], [5656354, 7541804], [7541805, 9427255], [9427256, 11312706], [11312707, 13198157], [13198158, 15083608], [15083609, 16969059], [16969060, 18854510], [18854511, 20739961], [20739962, 22625412], [22625413, 24510863], [24510864, 26396314], [26396315, 28281765], [28281766, 30167216], [30167217, 32052667], [32052668, 33938118], [33938119, 35823569], [35823570, 37709031]] SRR23047991 file size 12719827 SRR23047991 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR23047991 SRR23047991_1.fastq SRR23047991_2.fastq Input file: SRR23047991_1.fastq Paired file: SRR23047991_2.fastq trimmed: SRR23047991-trimmed-pair1.fastq, SRR23047991-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 06:36:30 2025 >> started Wed Feb 12 06:37:18 2025 >> done (47.988s) 37709031 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 37709031 (100.00%) read pairs available; of these: 98313 ( 0.26%) trimmed read pairs available after processing 37610718 (99.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 1 0.00% 27 1 0.00% 28 4 0.00% 29 4 0.00% 30 1 0.00% 31 1 0.00% 32 5 0.00% 33 1 0.00% 34 6 0.00% 35 6 0.00% 36 3 0.00% 37 9 0.00% 38 5 0.00% 39 8 0.00% 40 5 0.00% 41 8 0.00% 42 8 0.00% 43 6 0.00% 44 6 0.00% 45 10 0.00% 46 12 0.00% 47 14 0.00% 48 7 0.00% 49 4 0.00% 50 10 0.00% 51 9 0.00% 52 7 0.00% 53 11 0.00% 54 14 0.00% 55 17 0.00% 56 13 0.00% 57 14 0.00% 58 17 0.00% 59 23 0.00% 60 18 0.00% 61 17 0.00% 62 15 0.00% 63 12 0.00% 64 23 0.00% 65 11 0.00% 66 11 0.00% 67 16 0.00% 68 11 0.00% 69 12 0.00% 70 12 0.00% 71 13 0.00% 72 16 0.00% 73 16 0.00% 74 17 0.00% 75 16 0.00% 76 23 0.00% 77 24 0.00% 78 29 0.00% 79 17 0.00% 80 26 0.00% 81 21 0.00% 82 17 0.00% 83 39 0.00% 84 32 0.00% 85 19 0.00% 86 22 0.00% 87 20 0.00% 88 25 0.00% 89 31 0.00% 90 36 0.00% 91 28 0.00% 92 22 0.00% 93 23 0.00% 94 34 0.00% 95 17 0.00% 96 20 0.00% 97 30 0.00% 98 25 0.00% 99 26 0.00% 100 20 0.00% 101 22 0.00% 102 16 0.00% 103 19 0.00% 104 37 0.00% 105 23 0.00% 106 30 0.00% 107 45 0.00% 108 34 0.00% 109 37 0.00% 110 38 0.00% 111 21 0.00% 112 31 0.00% 113 28 0.00% 114 18 0.00% 115 30 0.00% 116 27 0.00% 117 28 0.00% 118 38 0.00% 119 15 0.00% 120 21 0.00% 121 38 0.00% 122 39 0.00% 123 42 0.00% 124 45 0.00% 125 20 0.00% 126 22 0.00% 127 29 0.00% 128 29 0.00% 129 29 0.00% 130 42 0.00% 131 52 0.00% 132 50 0.00% 133 50 0.00% 134 65 0.00% 135 54 0.00% 136 43 0.00% 137 40 0.00% 138 0 0.00% 139 0 0.00% 140 31 0.00% 141 101 0.00% 142 101 0.00% 143 95 0.00% 144 0 0.00% 145 301 0.00% 146 22377 0.06% 147 23414 0.06% 148 24173 0.06% 149 25340 0.07% 150 37610718 99.74% 37709031 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=3.18 fanout-score-rank=20 prefix-density=0.41 prefix-fanout=2.8 sequence=TTTATCAACCCAAACCCAAACCCTATCACA criterion=fanout-score sequence-density=0.14 sequence-density-rank=21 fanout-score=9.59 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=5.1 sequence=CAAACACAACAGGAAAAGGGATGGT criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=4.26 fanout-score-rank=15 prefix-density=0.64 prefix-fanout=3.2 sequence=CTGAAGCAGTGATCGATGTCTTCGGTGATGAGGTTAGAACTGGTGATCGTTATATCATCGGAGCCGCTTCGAATGACTTTGCGGTCACTTCCAGCCGTATCATATGCAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=28 fanout-score=25.25 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=7.8 sequence=AAGGCCAAGATCCAGGACAAGGAGGG SRR23047991 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 06:38:09 Started mapping on | Feb 12 06:38:09 Finished on | Feb 12 06:42:19 Mapping speed, Million of reads per hour | 543.01 Number of input reads | 37709031 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 35293811 Uniquely mapped reads % | 93.60% Average mapped length | 298.95 Number of splices: Total | 34414450 Number of splices: Annotated (sjdb) | 33630934 Number of splices: GT/AG | 33896730 Number of splices: GC/AG | 424230 Number of splices: AT/AC | 26990 Number of splices: Non-canonical | 66500 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 2.82 Insertion rate per base | 0.01% Insertion average length | 1.95 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1415105 % of reads mapped to multiple loci | 3.75% Number of reads mapped to too many loci | 403327 % of reads mapped to too many loci | 1.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.16% % of reads unmapped: other | 0.42% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1000115 1000115 1000115 N_multimapping 1415105 1415105 1415105 N_noFeature 797029 34985910 930411 N_ambiguous 362087 3233 185099 UnstrandedReadsAssigned:34134695 PositiveStrandReadsAssigned:304668 NegativeStrandReadsAssigned:34178301 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR23047991 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR23047991-trimmed-pair1.fastq SRR23047991-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,709,031 reads, 35,226,284 reads pseudoaligned [quant] estimated average fragment length: 290.312 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,168 rounds 52401 SRR23047991.ke.tsv 34699 SRR23047991.se.tsv 87100 total ==> SRR23047991.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1728.69 7588 109.096 Potri.005G024800.1.v4.1 1035 745.688 3940 131.322 Potri.004G059700.1.v4.1 961 671.694 14 0.518029 Potri.007G009000.2.v4.1 1416 1126.69 0 0 Potri.003G141000.2.v4.1 2943 2653.69 1243.21 11.6437 Potri.016G087400.1.v4.1 270 48.3453 1191 612.287 Potri.015G069301.1.v4.1 564 276.152 0 0 Potri.010G195200.1.v4.1 1773 1483.69 2281.8 38.2238 Potri.012G127500.1.v4.1 977 687.694 4017 145.179 ==> SRR23047991.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 738 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 879 SRR23047991 completed mapping pipeline successfully