Starting /dee2/code/volunteer_pipeline.sh SRR23047992 current disk space = 3050343034880 free memory = 1483601984 SRR23047992 SRAfilesize deb31acb401fbc56e02c1dc8c53e0c5c SRR23047992.sra SRR23047992.sra file validated SRR23047992 is paired end SRR23047992 is conventional basespace SRR23047992 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR23047992_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.02475 37.0 37.0 37.0 37.0 37.0 2 36.253 37.0 37.0 37.0 37.0 37.0 3 36.3685 37.0 37.0 37.0 37.0 37.0 4 36.376 37.0 37.0 37.0 37.0 37.0 5 36.387 37.0 37.0 37.0 37.0 37.0 6 36.359 37.0 37.0 37.0 37.0 37.0 7 36.3445 37.0 37.0 37.0 37.0 37.0 8 36.273 37.0 37.0 37.0 37.0 37.0 9 36.4125 37.0 37.0 37.0 37.0 37.0 10-14 36.397000000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.3606 37.0 37.0 37.0 37.0 37.0 20-24 36.3129 37.0 37.0 37.0 37.0 37.0 25-29 36.2881 37.0 37.0 37.0 37.0 37.0 30-34 36.221900000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.077999999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.1409 37.0 37.0 37.0 37.0 37.0 45-49 36.136399999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.110200000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.1274 37.0 37.0 37.0 37.0 37.0 60-64 36.031099999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.063700000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.0102 37.0 37.0 37.0 37.0 37.0 75-79 36.0613 37.0 37.0 37.0 37.0 37.0 80-84 35.9452 37.0 37.0 37.0 37.0 37.0 85-89 35.9257 37.0 37.0 37.0 37.0 37.0 90-94 35.878 37.0 37.0 37.0 37.0 37.0 95-99 35.788500000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.7763 37.0 37.0 37.0 37.0 37.0 105-109 35.77759999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.7231 37.0 37.0 37.0 37.0 37.0 115-119 35.7199 37.0 37.0 37.0 37.0 37.0 120-124 35.6742 37.0 37.0 37.0 37.0 37.0 125-129 35.7231 37.0 37.0 37.0 37.0 37.0 130-134 35.7016 37.0 37.0 37.0 37.0 37.0 135-139 35.6447 37.0 37.0 37.0 37.0 37.0 140-144 35.456100000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.57899999999999 37.0 37.0 37.0 37.0 37.0 150 35.5605 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 2.0 26 5.0 27 10.0 28 14.0 29 20.0 30 49.0 31 58.0 32 83.0 33 109.0 34 190.0 35 450.0 36 2846.0 37 162.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.679335514724386 8.935313365215203 10.168638308582935 43.21671281147748 2 21.325 13.900000000000002 37.2 27.575 3 23.3 16.825000000000003 22.275 37.6 4 26.125 26.05 19.425 28.4 5 23.95 29.5 24.55 22.0 6 19.725 33.550000000000004 26.25 20.474999999999998 7 13.975000000000001 24.4 42.55 19.075 8 18.7 22.575 33.550000000000004 25.174999999999997 9 17.95 23.674999999999997 34.275 24.099999999999998 10-14 19.955000000000002 30.214999999999996 26.91 22.919999999999998 15-19 19.355 28.29 29.125 23.23 20-24 20.16 28.144999999999996 28.015 23.68 25-29 19.675 28.565 28.33 23.43 30-34 20.055 28.410000000000004 27.345000000000002 24.19 35-39 20.365 27.889999999999997 27.66 24.085 40-44 20.665 28.63 27.235 23.47 45-49 19.905 28.1 27.72 24.275 50-54 20.810000000000002 27.965 27.544999999999998 23.68 55-59 19.93 28.34 27.85 23.880000000000003 60-64 20.03 27.99 27.675 24.305 65-69 19.89 28.515 27.52 24.075 70-74 20.849999999999998 28.139999999999997 27.584999999999997 23.425 75-79 20.4 28.294999999999998 27.43 23.875 80-84 19.865 28.075 27.12 24.94 85-89 20.945 27.555000000000003 28.275 23.225 90-94 20.68 27.79 27.83 23.7 95-99 20.555 27.975 27.584999999999997 23.885 100-104 20.955 27.91 26.93 24.205 105-109 20.205000000000002 28.15 27.785 23.86 110-114 20.525 27.900000000000002 28.055000000000003 23.52 115-119 21.154999999999998 27.54 27.950000000000003 23.355 120-124 21.415 27.16 27.584999999999997 23.84 125-129 20.8 27.865000000000002 27.855 23.48 130-134 20.775 27.310000000000002 28.325 23.59 135-139 20.32 27.67 27.685 24.325 140-144 20.835 27.794999999999998 27.089999999999996 24.279999999999998 145-149 21.215 27.3 28.155 23.330000000000002 150 21.099999999999998 26.3 28.825 23.775 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 1.0 25 3.0 26 5.0 27 8.0 28 9.0 29 11.0 30 13.0 31 18.5 32 25.5 33 38.5 34 53.5 35 63.0 36 79.5 37 102.0 38 131.5 39 148.5 40 157.0 41 190.5 42 236.0 43 244.5 44 252.0 45 278.0 46 304.0 47 297.0 48 245.0 49 210.0 50 182.5 51 148.0 52 111.5 53 89.0 54 77.5 55 65.0 56 51.5 57 37.5 58 32.5 59 25.0 60 20.5 61 13.5 62 6.5 63 4.5 64 1.5 65 1.0 66 1.5 67 2.0 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.225 #Duplication Level Percentage of deduplicated Percentage of total 1 90.24660570795234 81.425 2 8.783596564145192 15.85 3 0.8589637018564699 2.325 4 0.11083402604599613 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTTAA 10 0.006973645 144.0 4 AACCAGT 10 0.006973645 144.0 6 >>END_MODULE SRR23047992 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR23047992_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.54275 37.0 37.0 37.0 37.0 37.0 2 35.8715 37.0 37.0 37.0 37.0 37.0 3 35.751 37.0 37.0 37.0 37.0 37.0 4 35.988 37.0 37.0 37.0 37.0 37.0 5 36.1035 37.0 37.0 37.0 37.0 37.0 6 35.9175 37.0 37.0 37.0 37.0 37.0 7 35.6905 37.0 37.0 37.0 37.0 37.0 8 35.8385 37.0 37.0 37.0 37.0 37.0 9 36.007 37.0 37.0 37.0 37.0 37.0 10-14 35.91799999999999 37.0 37.0 37.0 37.0 37.0 15-19 35.9193 37.0 37.0 37.0 37.0 37.0 20-24 35.8779 37.0 37.0 37.0 37.0 37.0 25-29 35.920700000000004 37.0 37.0 37.0 37.0 37.0 30-34 35.791 37.0 37.0 37.0 37.0 37.0 35-39 35.77380000000001 37.0 37.0 37.0 37.0 37.0 40-44 35.735400000000006 37.0 37.0 37.0 37.0 37.0 45-49 35.6913 37.0 37.0 37.0 37.0 37.0 50-54 35.663199999999996 37.0 37.0 37.0 37.0 37.0 55-59 35.617399999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.5107 37.0 37.0 37.0 37.0 37.0 65-69 35.64630000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.4667 37.0 37.0 37.0 37.0 37.0 75-79 35.4973 37.0 37.0 37.0 37.0 37.0 80-84 35.382600000000004 37.0 37.0 37.0 32.2 37.0 85-89 35.394 37.0 37.0 37.0 34.6 37.0 90-94 35.3367 37.0 37.0 37.0 34.6 37.0 95-99 35.2257 37.0 37.0 37.0 29.8 37.0 100-104 35.37259999999999 37.0 37.0 37.0 32.2 37.0 105-109 35.143 37.0 37.0 37.0 29.8 37.0 110-114 35.2367 37.0 37.0 37.0 29.8 37.0 115-119 35.2068 37.0 37.0 37.0 27.4 37.0 120-124 35.0493 37.0 37.0 37.0 25.0 37.0 125-129 35.1383 37.0 37.0 37.0 29.8 37.0 130-134 35.176 37.0 37.0 37.0 29.8 37.0 135-139 34.90069999999999 37.0 37.0 37.0 27.4 37.0 140-144 34.8017 37.0 37.0 37.0 25.0 37.0 145-149 35.0683 37.0 37.0 37.0 27.4 37.0 150 35.1015 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 4.0 23 2.0 24 13.0 25 9.0 26 20.0 27 16.0 28 27.0 29 37.0 30 39.0 31 88.0 32 91.0 33 157.0 34 298.0 35 922.0 36 2224.0 37 53.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.91214667685256 21.594092182327476 12.987012987012985 30.506748153806978 2 18.95 34.0 31.775 15.275 3 19.3 33.300000000000004 28.425 18.975 4 23.799999999999997 36.625 21.55 18.025 5 22.7 36.7 23.3 17.299999999999997 6 19.675 39.125 23.0 18.2 7 18.925 22.05 38.9 20.125 8 22.675 24.775 28.599999999999998 23.95 9 24.3 25.95 28.299999999999997 21.45 10-14 23.995 29.465000000000003 25.395 21.145 15-19 23.06 29.445 26.865 20.630000000000003 20-24 23.355 29.14 27.229999999999997 20.275000000000002 25-29 23.005 29.035 26.41 21.55 30-34 23.169999999999998 28.82 26.99 21.02 35-39 22.925 28.945 26.995 21.135 40-44 23.035 28.04 28.03 20.895 45-49 22.78 28.360000000000003 27.345000000000002 21.515 50-54 22.515 28.475 27.584999999999997 21.425 55-59 22.955000000000002 28.33 27.389999999999997 21.325 60-64 23.150000000000002 27.815 27.58 21.455 65-69 23.135 28.410000000000004 27.185 21.27 70-74 23.580000000000002 28.555000000000003 26.484999999999996 21.38 75-79 23.69 27.805000000000003 26.935 21.57 80-84 22.884999999999998 28.82 26.63 21.665 85-89 23.68 27.875 27.634999999999998 20.810000000000002 90-94 24.02 28.139999999999997 27.584999999999997 20.255000000000003 95-99 23.625 28.07 27.12 21.185000000000002 100-104 23.585 28.315 27.3 20.8 105-109 23.315 28.439999999999998 27.134999999999998 21.11 110-114 23.585 28.595 26.755000000000003 21.065 115-119 23.715 28.444999999999997 26.724999999999998 21.115000000000002 120-124 23.71 28.49 26.889999999999997 20.91 125-129 24.055 28.225 27.115000000000002 20.605 130-134 23.794999999999998 28.125 27.51 20.57 135-139 23.945 28.244999999999997 26.58 21.23 140-144 23.625 28.345 26.93 21.099999999999998 145-149 23.215 29.255 26.805 20.724999999999998 150 24.025 27.474999999999998 28.299999999999997 20.200000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.5 17 1.5 18 1.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 1.5 25 2.0 26 3.5 27 6.5 28 10.5 29 12.5 30 11.0 31 16.0 32 29.5 33 33.0 34 38.5 35 60.5 36 77.0 37 93.0 38 134.0 39 173.0 40 195.0 41 218.0 42 242.0 43 275.5 44 304.0 45 304.5 46 275.5 47 245.0 48 231.0 49 202.0 50 169.5 51 144.5 52 111.0 53 91.5 54 71.0 55 44.0 56 33.0 57 32.0 58 27.5 59 20.0 60 13.0 61 10.0 62 8.0 63 4.0 64 4.0 65 3.0 66 1.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.5 72 1.0 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.5 99 1.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.825 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.875 #Duplication Level Percentage of deduplicated Percentage of total 1 90.92159559834938 82.625 2 8.198074277854195 14.899999999999999 3 0.797799174690509 2.175 4 0.08253094910591473 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1835881 spots for SRR23047992.sra Written 1835881 spots for SRR23047992.sra Read 1835881 spots for SRR23047992.sra Written 1835881 spots for SRR23047992.sra Read 1835881 spots for SRR23047992.sra Written 1835881 spots for SRR23047992.sra Read 1835881 spots for SRR23047992.sra Written 1835881 spots for SRR23047992.sra Read 1835881 spots for SRR23047992.sra Written 1835881 spots for SRR23047992.sra Read 1835881 spots for SRR23047992.sra Written 1835881 spots for SRR23047992.sra Read 1835881 spots for SRR23047992.sra Written 1835881 spots for SRR23047992.sra Read 1835881 spots for SRR23047992.sra Written 1835881 spots for SRR23047992.sra Read 1835881 spots for SRR23047992.sra Written 1835881 spots for SRR23047992.sra Read 1835881 spots for SRR23047992.sra Written 1835881 spots for SRR23047992.sra Read 1835881 spots for SRR23047992.sra Written 1835881 spots for SRR23047992.sra Read 1835881 spots for SRR23047992.sra Written 1835881 spots for SRR23047992.sra Read 1835894 spots for SRR23047992.sra Written 1835894 spots for SRR23047992.sra Read 1835881 spots for SRR23047992.sra Written 1835881 spots for SRR23047992.sra Read 1835881 spots for SRR23047992.sra Written 1835881 spots for SRR23047992.sra Read 1835881 spots for SRR23047992.sra Written 1835881 spots for SRR23047992.sra Read 1835881 spots for SRR23047992.sra Written 1835881 spots for SRR23047992.sra Read 1835881 spots for SRR23047992.sra Written 1835881 spots for SRR23047992.sra Read 1835881 spots for SRR23047992.sra Written 1835881 spots for SRR23047992.sra Read 1835881 spots for SRR23047992.sra Written 1835881 spots for SRR23047992.sra SRR ids: ['SRR23047992.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j4icmabs SRR23047992.sra spots: 36717633 blocks: [[1, 1835881], [1835882, 3671762], [3671763, 5507643], [5507644, 7343524], [7343525, 9179405], [9179406, 11015286], [11015287, 12851167], [12851168, 14687048], [14687049, 16522929], [16522930, 18358810], [18358811, 20194691], [20194692, 22030572], [22030573, 23866453], [23866454, 25702334], [25702335, 27538215], [27538216, 29374096], [29374097, 31209977], [31209978, 33045858], [33045859, 34881739], [34881740, 36717633]] SRR23047992 file size 12384843 SRR23047992 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR23047992 SRR23047992_1.fastq SRR23047992_2.fastq Input file: SRR23047992_1.fastq Paired file: SRR23047992_2.fastq trimmed: SRR23047992-trimmed-pair1.fastq, SRR23047992-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 06:39:46 2025 >> started Wed Feb 12 06:40:28 2025 >> done (41.825s) 36717633 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 36717633 (100.00%) read pairs available; of these: 94383 ( 0.26%) trimmed read pairs available after processing 36623250 (99.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 30 1 0.00% 31 0 0.00% 32 1 0.00% 33 1 0.00% 34 0 0.00% 35 0 0.00% 36 1 0.00% 37 0 0.00% 38 0 0.00% 39 2 0.00% 40 1 0.00% 41 2 0.00% 42 2 0.00% 43 3 0.00% 44 1 0.00% 45 3 0.00% 46 4 0.00% 47 3 0.00% 48 1 0.00% 49 2 0.00% 50 3 0.00% 51 3 0.00% 52 5 0.00% 53 2 0.00% 54 5 0.00% 55 4 0.00% 56 2 0.00% 57 3 0.00% 58 1 0.00% 59 3 0.00% 60 4 0.00% 61 2 0.00% 62 3 0.00% 63 2 0.00% 64 7 0.00% 65 6 0.00% 66 2 0.00% 67 6 0.00% 68 5 0.00% 69 3 0.00% 70 6 0.00% 71 6 0.00% 72 3 0.00% 73 1 0.00% 74 4 0.00% 75 7 0.00% 76 5 0.00% 77 5 0.00% 78 3 0.00% 79 1 0.00% 80 4 0.00% 81 5 0.00% 82 4 0.00% 83 4 0.00% 84 4 0.00% 85 5 0.00% 86 11 0.00% 87 2 0.00% 88 6 0.00% 89 6 0.00% 90 4 0.00% 91 2 0.00% 92 8 0.00% 93 8 0.00% 94 4 0.00% 95 4 0.00% 96 6 0.00% 97 6 0.00% 98 12 0.00% 99 9 0.00% 100 12 0.00% 101 8 0.00% 102 8 0.00% 103 5 0.00% 104 7 0.00% 105 6 0.00% 106 1 0.00% 107 11 0.00% 108 8 0.00% 109 11 0.00% 110 9 0.00% 111 15 0.00% 112 12 0.00% 113 8 0.00% 114 8 0.00% 115 12 0.00% 116 14 0.00% 117 12 0.00% 118 9 0.00% 119 5 0.00% 120 6 0.00% 121 10 0.00% 122 22 0.00% 123 17 0.00% 124 11 0.00% 125 10 0.00% 126 11 0.00% 127 2 0.00% 128 10 0.00% 129 8 0.00% 130 14 0.00% 131 23 0.00% 132 28 0.00% 133 17 0.00% 134 14 0.00% 135 23 0.00% 136 13 0.00% 137 27 0.00% 138 0 0.00% 139 0 0.00% 140 12 0.00% 141 114 0.00% 142 60 0.00% 143 47 0.00% 144 0 0.00% 145 192 0.00% 146 22186 0.06% 147 22902 0.06% 148 23739 0.06% 149 24430 0.07% 150 36623250 99.74% 36717633 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=9.75 fanout-score-rank=10 prefix-density=0.46 prefix-fanout=5.6 sequence=CCAGCAGTGTCCCAGCCGTAGTCACCAGGGAACTCACCAGTCAAGTAGGATGGGGGCTCACCAGAGAACGGGCCCAAGTATTTAACACGGTCTGGTCCGTACCATGGGCTCCCGGAGGGAACAGGCTTGGTGGTTTTCCTCATGGAGACACGGCCATTGCCCATGATCTCAGAGGAGGAGGGGTTGAGCTTCACC criterion=fanout-score sequence-density=0.06 sequence-density-rank=30 fanout-score=85.69 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=11.4 sequence=TCTTCTCATCACTCACAAGCAAGTCGTGGCGTAGGAATTGAATTAATGAACTTGGTGGCAGCAAGGAAGGCGTTGTAGGAGGCTAAGTAGCTAACTCCTGAGTCTGAACTTGTTTTACCAGCTACATTTGAAACACCTTGGAACACCACGAAGAGCTTTTCATTTGACAAAGATGTCAAAGCTACAGAAGCACTTGCTGTATCGGCAGTTGTTGCATTAAAATTATCGTTAAGGAAGTCTCCGTATGCTTTATTTCGAACGTAAAAATCAGAAGTAGAACCCTTCGATCCAAAGACAACTTTGGGTTTTCCGGGCAGGCATTCATCAGAATAGCATTGTCTTAACTTCAAATCCTTGAGCGCTTTAGTGGCAGCATTATACCAGGATGTGGTGATGGGAAGCCAGAAAACTTTCTTGGGTGCTTCATTTGGAGAGAACATGTTAATTGTCTCATACTCTACAGTCCCCAACAGGTTCTCTCCATTCTCTGGATAATTGAAATCTCCAAATA criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=36 prefix-density=0.27 prefix-fanout=2.1 sequence=TCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=141.62 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=5.9 sequence=TCTTCTCTCTGTCTTCTTGATTCCTTGTTTTTCGTTCTGTTTATTACAGCAGCAATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGAAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCCGCAA SRR23047992 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 06:41:11 Started mapping on | Feb 12 06:41:12 Finished on | Feb 12 06:44:11 Mapping speed, Million of reads per hour | 738.46 Number of input reads | 36717633 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 35267851 Uniquely mapped reads % | 96.05% Average mapped length | 299.13 Number of splices: Total | 34713354 Number of splices: Annotated (sjdb) | 34177968 Number of splices: GT/AG | 34120804 Number of splices: GC/AG | 497543 Number of splices: AT/AC | 26225 Number of splices: Non-canonical | 68782 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 2.73 Insertion rate per base | 0.01% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 903124 % of reads mapped to multiple loci | 2.46% Number of reads mapped to too many loci | 136001 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.00% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 546658 546658 546658 N_multimapping 903124 903124 903124 N_noFeature 878566 34967069 974192 N_ambiguous 414444 1677 208353 UnstrandedReadsAssigned:33974841 PositiveStrandReadsAssigned:299105 NegativeStrandReadsAssigned:34085306 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR23047992 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR23047992-trimmed-pair1.fastq SRR23047992-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,717,633 reads, 34,639,730 reads pseudoaligned [quant] estimated average fragment length: 291.847 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,261 rounds 52401 SRR23047992.ke.tsv 34699 SRR23047992.se.tsv 87100 total ==> SRR23047992.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1727.15 3666 48.6294 Potri.005G024800.1.v4.1 1035 744.153 2393 73.6746 Potri.004G059700.1.v4.1 961 670.16 29 0.991418 Potri.007G009000.2.v4.1 1416 1125.15 3 0.0610867 Potri.003G141000.2.v4.1 2943 2652.15 1366.26 11.8024 Potri.016G087400.1.v4.1 270 47.9359 1817.58 868.702 Potri.015G069301.1.v4.1 564 274.662 0 0 Potri.010G195200.1.v4.1 1773 1482.15 520 8.03799 Potri.012G127500.1.v4.1 977 686.153 10449 348.892 ==> SRR23047992.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 58 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 351 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 24 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 18 SRR23047992 completed mapping pipeline successfully