Starting /dee2/code/volunteer_pipeline.sh SRR23047994 current disk space = 3050027569152 free memory = 1578094744 SRR23047994 SRAfilesize 0a9dd63134cc0728dce837e8f8a8c4c3 SRR23047994.sra SRR23047994.sra file validated SRR23047994 is paired end SRR23047994 is conventional basespace SRR23047994 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR23047994_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4695 37.0 37.0 37.0 37.0 37.0 2 36.4225 37.0 37.0 37.0 37.0 37.0 3 36.4675 37.0 37.0 37.0 37.0 37.0 4 36.566 37.0 37.0 37.0 37.0 37.0 5 36.5375 37.0 37.0 37.0 37.0 37.0 6 36.4705 37.0 37.0 37.0 37.0 37.0 7 36.461 37.0 37.0 37.0 37.0 37.0 8 36.504 37.0 37.0 37.0 37.0 37.0 9 36.4625 37.0 37.0 37.0 37.0 37.0 10-14 36.4741 37.0 37.0 37.0 37.0 37.0 15-19 36.48135 37.0 37.0 37.0 37.0 37.0 20-24 36.4291 37.0 37.0 37.0 37.0 37.0 25-29 36.399 37.0 37.0 37.0 37.0 37.0 30-34 36.392900000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.3948 37.0 37.0 37.0 37.0 37.0 40-44 36.387299999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.3692 37.0 37.0 37.0 37.0 37.0 50-54 36.3189 37.0 37.0 37.0 37.0 37.0 55-59 36.2962 37.0 37.0 37.0 37.0 37.0 60-64 36.2658 37.0 37.0 37.0 37.0 37.0 65-69 36.2138 37.0 37.0 37.0 37.0 37.0 70-74 36.1958 37.0 37.0 37.0 37.0 37.0 75-79 36.1883 37.0 37.0 37.0 37.0 37.0 80-84 36.2141 37.0 37.0 37.0 37.0 37.0 85-89 36.1415 37.0 37.0 37.0 37.0 37.0 90-94 36.0418 37.0 37.0 37.0 37.0 37.0 95-99 36.0005 37.0 37.0 37.0 37.0 37.0 100-104 36.0389 37.0 37.0 37.0 37.0 37.0 105-109 36.0712 37.0 37.0 37.0 37.0 37.0 110-114 36.0111 37.0 37.0 37.0 37.0 37.0 115-119 36.075399999999995 37.0 37.0 37.0 37.0 37.0 120-124 36.000099999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.929199999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.992 37.0 37.0 37.0 37.0 37.0 135-139 35.8997 37.0 37.0 37.0 37.0 37.0 140-144 35.804500000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.8217 37.0 37.0 37.0 37.0 37.0 150 35.77 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 4.0 26 3.0 27 4.0 28 8.0 29 20.0 30 31.0 31 43.0 32 71.0 33 80.0 34 134.0 35 355.0 36 2893.0 37 352.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.75 7.5249999999999995 9.625 43.1 2 19.839679358717436 13.627254509018035 36.82364729458918 29.70941883767535 3 24.8 15.925 20.925 38.35 4 26.424999999999997 25.025 20.175 28.375 5 23.849999999999998 29.275000000000002 23.125 23.75 6 18.099999999999998 32.550000000000004 28.425 20.925 7 14.475 25.825 42.8 16.900000000000002 8 18.224999999999998 23.025000000000002 35.025 23.724999999999998 9 20.0 23.75 33.800000000000004 22.45 10-14 19.705000000000002 29.360000000000003 27.85 23.085 15-19 20.256012800640033 28.081404070203508 28.281414070703537 23.381169058452922 20-24 20.294999999999998 28.189999999999998 28.515 23.0 25-29 20.05 28.515 27.58 23.855 30-34 20.09 28.24 27.55 24.12 35-39 19.994999999999997 27.655 28.01 24.34 40-44 20.11 28.13 28.285 23.474999999999998 45-49 20.474999999999998 27.950000000000003 27.345000000000002 24.23 50-54 19.945 27.98 28.375 23.7 55-59 20.255000000000003 27.750000000000004 27.925 24.07 60-64 20.52 27.47 27.839999999999996 24.169999999999998 65-69 20.015 27.834999999999997 28.095 24.055 70-74 19.945 27.955000000000002 28.360000000000003 23.74 75-79 20.195 27.900000000000002 27.74 24.165 80-84 20.044999999999998 28.59 27.145000000000003 24.22 85-89 20.169999999999998 28.13 27.42 24.279999999999998 90-94 21.32 28.01 26.955000000000002 23.715 95-99 20.330000000000002 27.339999999999996 28.599999999999998 23.73 100-104 20.87 27.725 27.185 24.22 105-109 21.279999999999998 27.575 27.675 23.47 110-114 20.715 27.834999999999997 27.52 23.93 115-119 21.165 27.07 28.095 23.669999999999998 120-124 20.755000000000003 27.52 27.435 24.29 125-129 20.785 28.09 27.894999999999996 23.23 130-134 21.240000000000002 27.43 27.860000000000003 23.47 135-139 20.849999999999998 27.935 27.855 23.36 140-144 21.19 26.795 28.475 23.54 145-149 20.974999999999998 27.560000000000002 27.810000000000002 23.655 150 22.650000000000002 27.400000000000002 26.625 23.325000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 1.0 23 3.5 24 4.0 25 5.0 26 4.5 27 2.0 28 4.0 29 9.0 30 12.5 31 15.5 32 21.5 33 28.5 34 36.5 35 52.0 36 80.0 37 105.0 38 126.5 39 155.5 40 182.5 41 215.5 42 249.0 43 263.5 44 265.0 45 280.0 46 269.0 47 245.5 48 247.5 49 226.0 50 185.5 51 149.5 52 120.0 53 101.5 54 82.5 55 53.0 56 41.5 57 39.0 58 32.0 59 27.5 60 19.0 61 12.0 62 6.0 63 2.5 64 5.0 65 4.5 66 2.0 67 1.0 68 1.0 69 0.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.375 #Duplication Level Percentage of deduplicated Percentage of total 1 90.29045643153528 81.6 2 8.990318118948824 16.25 3 0.5809128630705395 1.575 4 0.11065006915629322 0.4 5 0.0 0.0 6 0.0 0.0 7 0.027662517289073305 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCGGTCTTAACATATATAATAAGGCTATTGTTAAGTGTTCCAATATGGA 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTTGTC 10 0.006973645 144.0 4 CTAGCTC 10 0.006973645 144.0 6 TTGCCTC 10 0.006973645 144.0 9 >>END_MODULE SRR23047994 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR23047994_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.028 37.0 37.0 37.0 37.0 37.0 2 35.8995 37.0 37.0 37.0 37.0 37.0 3 36.0415 37.0 37.0 37.0 37.0 37.0 4 36.0145 37.0 37.0 37.0 37.0 37.0 5 36.1235 37.0 37.0 37.0 37.0 37.0 6 36.0245 37.0 37.0 37.0 37.0 37.0 7 36.1595 37.0 37.0 37.0 37.0 37.0 8 36.1715 37.0 37.0 37.0 37.0 37.0 9 36.143 37.0 37.0 37.0 37.0 37.0 10-14 36.221 37.0 37.0 37.0 37.0 37.0 15-19 36.1837 37.0 37.0 37.0 37.0 37.0 20-24 36.1909 37.0 37.0 37.0 37.0 37.0 25-29 36.1417 37.0 37.0 37.0 37.0 37.0 30-34 36.1591 37.0 37.0 37.0 37.0 37.0 35-39 36.101 37.0 37.0 37.0 37.0 37.0 40-44 36.0542 37.0 37.0 37.0 37.0 37.0 45-49 36.0544 37.0 37.0 37.0 37.0 37.0 50-54 36.0623 37.0 37.0 37.0 37.0 37.0 55-59 36.0166 37.0 37.0 37.0 37.0 37.0 60-64 35.932900000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.892100000000006 37.0 37.0 37.0 37.0 37.0 70-74 35.9149 37.0 37.0 37.0 37.0 37.0 75-79 35.91420000000001 37.0 37.0 37.0 37.0 37.0 80-84 35.815099999999994 37.0 37.0 37.0 37.0 37.0 85-89 35.71810000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.818599999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.7953 37.0 37.0 37.0 37.0 37.0 100-104 35.7354 37.0 37.0 37.0 37.0 37.0 105-109 35.7736 37.0 37.0 37.0 37.0 37.0 110-114 35.7367 37.0 37.0 37.0 37.0 37.0 115-119 35.814800000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.6537 37.0 37.0 37.0 37.0 37.0 125-129 35.6943 37.0 37.0 37.0 37.0 37.0 130-134 35.7641 37.0 37.0 37.0 37.0 37.0 135-139 35.699999999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.6698 37.0 37.0 37.0 37.0 37.0 145-149 35.5369 37.0 37.0 37.0 37.0 37.0 150 35.713 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 6.0 23 4.0 24 7.0 25 9.0 26 7.0 27 17.0 28 12.0 29 18.0 30 34.0 31 43.0 32 63.0 33 93.0 34 198.0 35 634.0 36 2628.0 37 226.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.324999999999996 23.200000000000003 12.975 30.5 2 18.45 34.375 33.175 14.000000000000002 3 19.900000000000002 32.05 26.900000000000002 21.15 4 24.25 35.825 21.15 18.775 5 23.849999999999998 36.4 23.425 16.325 6 19.325 39.475 24.425 16.775000000000002 7 20.125 20.674999999999997 39.6 19.6 8 21.5 24.375 27.825 26.3 9 23.65 24.775 28.325 23.25 10-14 23.200000000000003 30.095 24.62 22.085 15-19 22.79 29.935000000000002 26.625 20.65 20-24 22.134999999999998 29.044999999999998 27.47 21.349999999999998 25-29 22.41 29.220000000000002 27.07 21.3 30-34 22.81 29.044999999999998 26.6 21.545 35-39 22.85 28.51 27.195000000000004 21.445 40-44 23.01 28.895 26.58 21.515 45-49 22.875 28.765 27.12 21.240000000000002 50-54 23.575 28.720000000000002 26.939999999999998 20.765 55-59 22.98 29.270000000000003 26.375 21.375 60-64 22.895 28.68 27.139999999999997 21.285 65-69 23.625 27.99 26.965 21.42 70-74 23.745 27.950000000000003 26.82 21.485000000000003 75-79 22.91 28.549999999999997 27.265 21.275 80-84 23.155 28.24 27.16 21.445 85-89 23.925 28.349999999999998 26.86 20.865000000000002 90-94 22.965 28.725 27.150000000000002 21.16 95-99 23.080000000000002 28.134999999999998 27.245 21.54 100-104 23.494999999999997 28.050000000000004 26.845000000000002 21.61 105-109 23.66 27.905 27.305 21.13 110-114 24.104999999999997 28.005000000000003 27.029999999999998 20.86 115-119 23.645 28.705000000000002 27.134999999999998 20.515 120-124 23.91 28.29 26.91 20.89 125-129 23.305 28.470000000000002 27.310000000000002 20.915 130-134 23.825 28.310000000000002 27.015 20.849999999999998 135-139 23.96 28.415000000000003 26.915 20.71 140-144 23.365 28.499999999999996 27.589999999999996 20.544999999999998 145-149 23.599999999999998 27.71 27.92 20.77 150 23.425 28.175 28.1 20.3 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 1.0 11 1.0 12 1.0 13 2.0 14 1.5 15 1.5 16 3.0 17 3.0 18 1.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.5 24 2.5 25 3.0 26 2.5 27 4.0 28 4.5 29 7.0 30 10.5 31 11.5 32 17.5 33 30.0 34 43.0 35 56.0 36 72.0 37 99.5 38 130.0 39 163.0 40 198.5 41 250.5 42 272.0 43 271.0 44 294.0 45 287.5 46 267.5 47 252.0 48 218.0 49 189.0 50 175.5 51 143.5 52 116.5 53 99.5 54 71.5 55 52.0 56 36.5 57 24.0 58 23.5 59 24.0 60 15.5 61 11.5 62 10.5 63 4.5 64 2.5 65 3.5 66 2.5 67 0.0 68 0.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.5 #Duplication Level Percentage of deduplicated Percentage of total 1 90.58011049723757 81.975 2 8.56353591160221 15.5 3 0.6629834254143646 1.7999999999999998 4 0.16574585635359115 0.6 5 0.027624309392265196 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTTAATTTGAGACAGAAAACATGAAATCCTCCTACACTTTCTTCATTCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.025 0.0 0.0 126-127 0.0 0.0 0.025 0.0 0.0 128-129 0.0 0.0 0.025 0.0 0.0 130-131 0.0 0.0 0.025 0.0 0.0 132-133 0.0 0.0 0.025 0.0 0.0 134-135 0.0 0.0 0.025 0.0 0.0 136-137 0.0 0.0 0.025 0.0 0.0 138 0.0 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGGGG 10 0.006973645 144.0 9 TCAGGTT 10 0.006973645 144.0 8 TTTCAGC 10 0.006973645 144.0 7 CAGGTTT 10 0.006973645 144.0 9 TTCAGCT 10 0.006973645 144.0 8 >>END_MODULE Read 1691803 spots for SRR23047994.sra Written 1691803 spots for SRR23047994.sra Read 1691803 spots for SRR23047994.sra Written 1691803 spots for SRR23047994.sra Read 1691803 spots for SRR23047994.sra Written 1691803 spots for SRR23047994.sra Read 1691803 spots for SRR23047994.sra Written 1691803 spots for SRR23047994.sra Read 1691803 spots for SRR23047994.sra Written 1691803 spots for SRR23047994.sra Read 1691803 spots for SRR23047994.sra Written 1691803 spots for SRR23047994.sra Read 1691803 spots for SRR23047994.sra Written 1691803 spots for SRR23047994.sra Read 1691803 spots for SRR23047994.sra Written 1691803 spots for SRR23047994.sra Read 1691803 spots for SRR23047994.sra Written 1691803 spots for SRR23047994.sra Read 1691803 spots for SRR23047994.sra Written 1691803 spots for SRR23047994.sra Read 1691803 spots for SRR23047994.sra Written 1691803 spots for SRR23047994.sra Read 1691803 spots for SRR23047994.sra Written 1691803 spots for SRR23047994.sra Read 1691817 spots for SRR23047994.sra Written 1691817 spots for SRR23047994.sra Read 1691803 spots for SRR23047994.sra Written 1691803 spots for SRR23047994.sra Read 1691803 spots for SRR23047994.sra Written 1691803 spots for SRR23047994.sra Read 1691803 spots for SRR23047994.sra Written 1691803 spots for SRR23047994.sra Read 1691803 spots for SRR23047994.sra Written 1691803 spots for SRR23047994.sra Read 1691803 spots for SRR23047994.sra Written 1691803 spots for SRR23047994.sra Read 1691803 spots for SRR23047994.sra Written 1691803 spots for SRR23047994.sra Read 1691803 spots for SRR23047994.sra Written 1691803 spots for SRR23047994.sra SRR ids: ['SRR23047994.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kfmqfgy4 SRR23047994.sra spots: 33836074 blocks: [[1, 1691803], [1691804, 3383606], [3383607, 5075409], [5075410, 6767212], [6767213, 8459015], [8459016, 10150818], [10150819, 11842621], [11842622, 13534424], [13534425, 15226227], [15226228, 16918030], [16918031, 18609833], [18609834, 20301636], [20301637, 21993439], [21993440, 23685242], [23685243, 25377045], [25377046, 27068848], [27068849, 28760651], [28760652, 30452454], [30452455, 32144257], [32144258, 33836074]] SRR23047994 file size 11411191 SRR23047994 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR23047994 SRR23047994_1.fastq SRR23047994_2.fastq Input file: SRR23047994_1.fastq Paired file: SRR23047994_2.fastq trimmed: SRR23047994-trimmed-pair1.fastq, SRR23047994-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 07:19:13 2025 >> started Wed Feb 12 07:19:50 2025 >> done (36.465s) 33836074 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 33836073 (100.00%) read pairs available; of these: 82198 ( 0.24%) trimmed read pairs available after processing 33753875 (99.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 21 1 0.00% 22 1 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 1 0.00% 28 1 0.00% 29 0 0.00% 30 2 0.00% 31 0 0.00% 32 1 0.00% 33 2 0.00% 34 2 0.00% 35 2 0.00% 36 3 0.00% 37 3 0.00% 38 3 0.00% 39 3 0.00% 40 1 0.00% 41 1 0.00% 42 1 0.00% 43 5 0.00% 44 3 0.00% 45 1 0.00% 46 5 0.00% 47 2 0.00% 48 2 0.00% 49 5 0.00% 50 4 0.00% 51 0 0.00% 52 3 0.00% 53 5 0.00% 54 3 0.00% 55 6 0.00% 56 3 0.00% 57 5 0.00% 58 4 0.00% 59 6 0.00% 60 7 0.00% 61 5 0.00% 62 11 0.00% 63 4 0.00% 64 9 0.00% 65 5 0.00% 66 8 0.00% 67 8 0.00% 68 4 0.00% 69 8 0.00% 70 12 0.00% 71 10 0.00% 72 10 0.00% 73 3 0.00% 74 2 0.00% 75 3 0.00% 76 6 0.00% 77 8 0.00% 78 7 0.00% 79 3 0.00% 80 7 0.00% 81 9 0.00% 82 11 0.00% 83 10 0.00% 84 5 0.00% 85 8 0.00% 86 7 0.00% 87 4 0.00% 88 10 0.00% 89 13 0.00% 90 9 0.00% 91 12 0.00% 92 9 0.00% 93 4 0.00% 94 5 0.00% 95 5 0.00% 96 2 0.00% 97 10 0.00% 98 5 0.00% 99 2 0.00% 100 7 0.00% 101 15 0.00% 102 9 0.00% 103 6 0.00% 104 7 0.00% 105 6 0.00% 106 12 0.00% 107 13 0.00% 108 9 0.00% 109 13 0.00% 110 9 0.00% 111 14 0.00% 112 13 0.00% 113 8 0.00% 114 11 0.00% 115 9 0.00% 116 11 0.00% 117 19 0.00% 118 20 0.00% 119 7 0.00% 120 13 0.00% 121 30 0.00% 122 19 0.00% 123 23 0.00% 124 29 0.00% 125 13 0.00% 126 18 0.00% 127 19 0.00% 128 7 0.00% 129 13 0.00% 130 17 0.00% 131 26 0.00% 132 14 0.00% 133 17 0.00% 134 17 0.00% 135 14 0.00% 136 18 0.00% 137 24 0.00% 138 0 0.00% 139 0 0.00% 140 12 0.00% 141 42 0.00% 142 48 0.00% 143 44 0.00% 144 0 0.00% 145 173 0.00% 146 19408 0.06% 147 19860 0.06% 148 20587 0.06% 149 21105 0.06% 150 33753875 99.76% 33836073 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=5.30 fanout-score-rank=11 prefix-density=0.37 prefix-fanout=4.8 sequence=AACATCTGAATTGCATATGATACGGCTGGAAGTGACCGCAAAGTCATTCGAAGCGGCTCCGATGATATAACGATCACCAGTTCTAACCTCATCACCGAAGACATCGATCACTGCTTCAGCATGAACGGCACGAGGAAATATTGAAGTTGCCGTGAAGGCAAAGAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=49.12 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.9 sequence=CTCCCTTCACATAGCACAGCACAAACAAGAAATCAAGACACGAACATTCAGTGGTTCAAAACCAGCATTTATTGCACATTACATTACTTTATTCCCATGAAATAGCCCGGCCGAAGTCGTTACTCCTGAGCATTTAGTAGAGAAAGTAGTCTATCACAAGACGCTGTGACAAAGTAGGCAAAAATCCTTCTGCAAATGCAGCAAGAGCAGCAGAATCGAGGTACTCTTGCAAACCTGACTTGCTCTCAAATGTAGATTCAAAGGCATGAGTGTATCCTCGGTTTAGCTCCGCAGACTCCATGCCCAAATCCGTGCCCCAATTGAAACTCTTCATGGTTGGAATGAGATCGAGCAGATTGGTATAGTCATTAATGTAGTTGTCGATTTGTTCTCGTGTGATCTCATCCTTGAACCGAGTCAACAATGTGTGCTTCACAAGCT criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=35 prefix-density=0.32 prefix-fanout=2.0 sequence=AGTTAAGACAATG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=138.84 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=6.2 sequence=TCTTCTCTCTGTCTTCTTGATTCCTTGTTTTTCGTTCTGTTTATTACAGCAGCAATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGAAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCCGCAA SRR23047994 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 07:20:30 Started mapping on | Feb 12 07:20:30 Finished on | Feb 12 07:23:30 Mapping speed, Million of reads per hour | 676.72 Number of input reads | 33836073 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 32334573 Uniquely mapped reads % | 95.56% Average mapped length | 299.17 Number of splices: Total | 31688940 Number of splices: Annotated (sjdb) | 31213701 Number of splices: GT/AG | 31163299 Number of splices: GC/AG | 435814 Number of splices: AT/AC | 23537 Number of splices: Non-canonical | 66290 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.70 Insertion rate per base | 0.01% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 957928 % of reads mapped to multiple loci | 2.83% Number of reads mapped to too many loci | 147433 % of reads mapped to too many loci | 0.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.04% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 543572 543572 543572 N_multimapping 957928 957928 957928 N_noFeature 699532 32069565 777566 N_ambiguous 387363 1467 199516 UnstrandedReadsAssigned:31247678 PositiveStrandReadsAssigned:263541 NegativeStrandReadsAssigned:31357491 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR23047994 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR23047994-trimmed-pair1.fastq SRR23047994-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,836,073 reads, 31,939,510 reads pseudoaligned [quant] estimated average fragment length: 294.041 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,252 rounds 52401 SRR23047994.ke.tsv 34699 SRR23047994.se.tsv 87100 total ==> SRR23047994.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1724.96 3576.64 49.68 Potri.005G024800.1.v4.1 1035 741.959 1768 57.0936 Potri.004G059700.1.v4.1 961 667.98 34 1.21955 Potri.007G009000.2.v4.1 1416 1122.96 0 0 Potri.003G141000.2.v4.1 2943 2649.96 1292.27 11.6842 Potri.016G087400.1.v4.1 270 47.4921 1571.6 792.874 Potri.015G069301.1.v4.1 564 272.777 0 0 Potri.010G195200.1.v4.1 1773 1479.96 780 12.6279 Potri.012G127500.1.v4.1 977 683.969 7511 263.115 ==> SRR23047994.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 89 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 365 Potri.001G212900.v4.1 72 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 40 SRR23047994 completed mapping pipeline successfully