Starting /dee2/code/volunteer_pipeline.sh SRR23047996 current disk space = 3050023784448 free memory = 1309193816 SRR23047996 SRAfilesize 23f4f63487357fb66c604ed118204655 SRR23047996.sra SRR23047996.sra file validated SRR23047996 is paired end SRR23047996 is conventional basespace SRR23047996 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR23047996_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9615 37.0 37.0 37.0 37.0 37.0 2 36.1355 37.0 37.0 37.0 37.0 37.0 3 36.3065 37.0 37.0 37.0 37.0 37.0 4 36.356 37.0 37.0 37.0 37.0 37.0 5 36.4275 37.0 37.0 37.0 37.0 37.0 6 36.1825 37.0 37.0 37.0 37.0 37.0 7 36.3235 37.0 37.0 37.0 37.0 37.0 8 36.355 37.0 37.0 37.0 37.0 37.0 9 36.3015 37.0 37.0 37.0 37.0 37.0 10-14 36.3146 37.0 37.0 37.0 37.0 37.0 15-19 36.245400000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.2535 37.0 37.0 37.0 37.0 37.0 25-29 36.23910000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.161199999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.0796 37.0 37.0 37.0 37.0 37.0 40-44 36.118199999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.0501 37.0 37.0 37.0 37.0 37.0 50-54 35.9764 37.0 37.0 37.0 37.0 37.0 55-59 35.975100000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.0333 37.0 37.0 37.0 37.0 37.0 65-69 35.9727 37.0 37.0 37.0 37.0 37.0 70-74 35.920100000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.952099999999994 37.0 37.0 37.0 37.0 37.0 80-84 35.8797 37.0 37.0 37.0 37.0 37.0 85-89 35.8058 37.0 37.0 37.0 37.0 37.0 90-94 35.804 37.0 37.0 37.0 37.0 37.0 95-99 35.8088 37.0 37.0 37.0 37.0 37.0 100-104 35.7521 37.0 37.0 37.0 37.0 37.0 105-109 35.669 37.0 37.0 37.0 37.0 37.0 110-114 35.6505 37.0 37.0 37.0 37.0 37.0 115-119 35.737100000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.626799999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.507400000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.3673 37.0 37.0 37.0 29.8 37.0 135-139 35.5698 37.0 37.0 37.0 37.0 37.0 140-144 35.348 37.0 37.0 37.0 34.6 37.0 145-149 35.339 37.0 37.0 37.0 32.2 37.0 150 35.4905 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 2.0 26 3.0 27 10.0 28 26.0 29 27.0 30 44.0 31 63.0 32 112.0 33 149.0 34 203.0 35 482.0 36 2693.0 37 186.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.58169934640523 7.868275515334338 9.678230266465562 44.871794871794876 2 20.424999999999997 12.65 37.3 29.625 3 22.25 16.325 22.875 38.550000000000004 4 26.625 25.324999999999996 19.825 28.225 5 23.7 29.475 23.974999999999998 22.85 6 19.975 32.45 26.724999999999998 20.849999999999998 7 13.5 25.624999999999996 42.75 18.125 8 19.75 22.05 32.800000000000004 25.4 9 17.325 24.075 34.375 24.224999999999998 10-14 19.66 29.630000000000003 27.639999999999997 23.07 15-19 19.650000000000002 28.110000000000003 29.044999999999998 23.195 20-24 19.885 27.82 28.025 24.27 25-29 20.305 28.215 27.83 23.65 30-34 20.155 27.925 27.925 23.995 35-39 20.085 28.125 27.615000000000002 24.175 40-44 20.294999999999998 27.665 28.32 23.72 45-49 20.11 28.035 27.52 24.335 50-54 19.88 27.905 27.85 24.365000000000002 55-59 19.900000000000002 27.735 27.96 24.404999999999998 60-64 19.939999999999998 28.275 27.52 24.265 65-69 20.43 28.4 26.76 24.41 70-74 20.244999999999997 28.335 27.534999999999997 23.885 75-79 20.135 27.950000000000003 27.55 24.365000000000002 80-84 20.380000000000003 26.985 28.125 24.51 85-89 20.085 28.125 27.595 24.195 90-94 20.575 27.85 27.584999999999997 23.990000000000002 95-99 20.369999999999997 27.665 27.96 24.005000000000003 100-104 20.61 27.800000000000004 27.415 24.175 105-109 20.195 27.845 27.845 24.115000000000002 110-114 21.154999999999998 27.325 27.41 24.11 115-119 20.65 28.025 27.87 23.455000000000002 120-124 20.979999999999997 27.025 27.565 24.43 125-129 20.775 28.000000000000004 27.474999999999998 23.75 130-134 20.905 27.98 27.24 23.875 135-139 21.01 27.775 27.13 24.085 140-144 20.82 27.810000000000002 27.005000000000003 24.365000000000002 145-149 20.905 27.62 27.305 24.169999999999998 150 20.825 27.900000000000002 28.749999999999996 22.525000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.5 22 0.5 23 1.0 24 1.0 25 3.5 26 5.0 27 7.0 28 7.5 29 9.5 30 15.0 31 20.5 32 30.5 33 37.0 34 40.0 35 55.5 36 72.5 37 98.5 38 122.0 39 133.0 40 171.0 41 210.5 42 233.0 43 254.0 44 276.5 45 287.0 46 274.5 47 255.5 48 229.0 49 216.0 50 186.5 51 140.5 52 130.5 53 114.0 54 84.0 55 62.5 56 49.5 57 43.5 58 33.0 59 23.5 60 19.5 61 13.5 62 7.0 63 5.0 64 5.5 65 2.5 66 1.0 67 1.0 68 0.5 69 2.0 70 2.5 71 0.5 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5499999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.3 #Duplication Level Percentage of deduplicated Percentage of total 1 90.08859357696566 81.35 2 9.108527131782946 16.45 3 0.7751937984496124 2.1 4 0.02768549280177187 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAACGC 10 0.006973645 144.0 8 >>END_MODULE SRR23047996 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR23047996_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.611 37.0 37.0 37.0 37.0 37.0 2 35.8 37.0 37.0 37.0 37.0 37.0 3 35.85 37.0 37.0 37.0 37.0 37.0 4 35.8635 37.0 37.0 37.0 37.0 37.0 5 35.8295 37.0 37.0 37.0 37.0 37.0 6 35.8905 37.0 37.0 37.0 37.0 37.0 7 35.7375 37.0 37.0 37.0 37.0 37.0 8 35.8365 37.0 37.0 37.0 37.0 37.0 9 35.8955 37.0 37.0 37.0 37.0 37.0 10-14 35.823100000000004 37.0 37.0 37.0 37.0 37.0 15-19 35.786699999999996 37.0 37.0 37.0 37.0 37.0 20-24 35.8226 37.0 37.0 37.0 37.0 37.0 25-29 35.843900000000005 37.0 37.0 37.0 37.0 37.0 30-34 35.806799999999996 37.0 37.0 37.0 37.0 37.0 35-39 35.761199999999995 37.0 37.0 37.0 37.0 37.0 40-44 35.700399999999995 37.0 37.0 37.0 37.0 37.0 45-49 35.7161 37.0 37.0 37.0 37.0 37.0 50-54 35.6519 37.0 37.0 37.0 37.0 37.0 55-59 35.6531 37.0 37.0 37.0 37.0 37.0 60-64 35.579299999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.45119999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.4554 37.0 37.0 37.0 37.0 37.0 75-79 35.5796 37.0 37.0 37.0 37.0 37.0 80-84 35.4159 37.0 37.0 37.0 37.0 37.0 85-89 35.4459 37.0 37.0 37.0 34.6 37.0 90-94 35.4178 37.0 37.0 37.0 37.0 37.0 95-99 35.323100000000004 37.0 37.0 37.0 29.8 37.0 100-104 35.3398 37.0 37.0 37.0 34.6 37.0 105-109 35.4109 37.0 37.0 37.0 34.6 37.0 110-114 35.2465 37.0 37.0 37.0 32.2 37.0 115-119 35.1932 37.0 37.0 37.0 29.8 37.0 120-124 35.2573 37.0 37.0 37.0 32.2 37.0 125-129 35.016099999999994 37.0 37.0 37.0 25.0 37.0 130-134 35.0356 37.0 37.0 37.0 25.0 37.0 135-139 34.9573 37.0 37.0 37.0 25.0 37.0 140-144 35.027699999999996 37.0 37.0 37.0 25.0 37.0 145-149 35.04880000000001 37.0 37.0 37.0 25.0 37.0 150 35.1615 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 5.0 23 7.0 24 12.0 25 10.0 26 18.0 27 26.0 28 19.0 29 51.0 30 51.0 31 93.0 32 98.0 33 159.0 34 263.0 35 735.0 36 2366.0 37 87.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.97285067873303 23.755656108597282 13.499245852187029 26.772247360482655 2 19.975 34.050000000000004 31.8 14.174999999999999 3 22.0 32.074999999999996 25.575 20.349999999999998 4 24.474999999999998 38.824999999999996 19.3 17.4 5 23.75 37.375 22.325 16.55 6 20.525 39.425 23.474999999999998 16.575 7 18.7 21.0 38.875 21.425 8 20.125 23.575 31.65 24.65 9 23.925 25.174999999999997 27.3 23.599999999999998 10-14 22.88 30.275000000000002 25.435000000000002 21.41 15-19 23.22 29.935000000000002 26.665 20.18 20-24 22.945 29.21 26.840000000000003 21.005 25-29 22.925 29.75 26.77 20.555 30-34 22.830000000000002 29.62 26.985 20.565 35-39 23.11 29.555 26.745 20.59 40-44 23.380000000000003 28.74 26.905 20.974999999999998 45-49 22.99 29.5 26.06 21.45 50-54 22.965 28.395 27.279999999999998 21.36 55-59 23.665 28.215 26.665 21.455 60-64 23.125 28.7 27.08 21.095 65-69 23.465 27.650000000000002 27.52 21.365000000000002 70-74 23.73 28.49 26.41 21.37 75-79 23.325000000000003 27.72 27.48 21.475 80-84 23.62 28.849999999999998 26.38 21.15 85-89 23.36 28.62 27.065 20.955 90-94 24.4 27.505000000000003 27.405 20.69 95-99 24.085 28.084999999999997 27.11 20.72 100-104 23.365 27.860000000000003 27.32 21.455 105-109 23.68 27.639999999999997 27.089999999999996 21.59 110-114 23.990000000000002 28.4 26.695 20.915 115-119 24.035 28.499999999999996 27.18 20.285 120-124 23.61 28.29 27.16 20.94 125-129 23.7 27.865000000000002 27.16 21.275 130-134 23.805 28.415000000000003 27.07 20.71 135-139 23.59 27.715 28.04 20.655 140-144 23.06 28.105000000000004 27.43 21.404999999999998 145-149 23.945 27.63 27.555000000000003 20.87 150 24.3 27.0 28.025 20.674999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 1.0 7 0.5 8 0.5 9 0.5 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.5 21 1.0 22 0.5 23 1.5 24 3.0 25 3.0 26 3.5 27 2.0 28 2.0 29 10.0 30 11.0 31 13.0 32 26.0 33 32.0 34 40.5 35 68.5 36 80.0 37 99.0 38 137.5 39 149.0 40 182.0 41 243.5 42 265.5 43 271.5 44 293.0 45 291.0 46 276.0 47 265.5 48 237.0 49 211.0 50 170.5 51 128.5 52 110.5 53 82.5 54 64.5 55 53.0 56 36.0 57 27.5 58 22.0 59 15.0 60 16.5 61 15.5 62 6.5 63 3.0 64 4.5 65 3.0 66 1.0 67 1.5 68 1.5 69 1.0 70 0.5 71 0.0 72 2.5 73 2.5 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5499999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.525 #Duplication Level Percentage of deduplicated Percentage of total 1 90.33416183374759 81.77499999999999 2 8.892571112952224 16.1 3 0.7456503728251864 2.025 4 0.027616680475006903 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.025 0.0 0.0 0.0 0.0 118-119 0.025 0.0 0.0 0.0 0.0 120-121 0.025 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.025 0.0 0.0 0.0 0.0 136-137 0.025 0.0 0.0 0.0 0.0 138 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAGCAC 10 0.006973645 144.0 8 AAGCACT 10 0.006973645 144.0 9 >>END_MODULE Read 1882949 spots for SRR23047996.sra Written 1882949 spots for SRR23047996.sra Read 1882949 spots for SRR23047996.sra Written 1882949 spots for SRR23047996.sra Read 1882949 spots for SRR23047996.sra Written 1882949 spots for SRR23047996.sra Read 1882949 spots for SRR23047996.sra Written 1882949 spots for SRR23047996.sra Read 1882949 spots for SRR23047996.sra Written 1882949 spots for SRR23047996.sra Read 1882949 spots for SRR23047996.sra Written 1882949 spots for SRR23047996.sra Read 1882949 spots for SRR23047996.sra Written 1882949 spots for SRR23047996.sra Read 1882949 spots for SRR23047996.sra Written 1882949 spots for SRR23047996.sra Read 1882949 spots for SRR23047996.sra Written 1882949 spots for SRR23047996.sra Read 1882949 spots for SRR23047996.sra Written 1882949 spots for SRR23047996.sra Read 1882949 spots for SRR23047996.sra Written 1882949 spots for SRR23047996.sra Read 1882949 spots for SRR23047996.sra Written 1882949 spots for SRR23047996.sra Read 1882949 spots for SRR23047996.sra Written 1882949 spots for SRR23047996.sra Read 1882949 spots for SRR23047996.sra Written 1882949 spots for SRR23047996.sra Read 1882949 spots for SRR23047996.sra Written 1882949 spots for SRR23047996.sra Read 1882949 spots for SRR23047996.sra Written 1882949 spots for SRR23047996.sra Read 1882949 spots for SRR23047996.sra Written 1882949 spots for SRR23047996.sra Read 1882949 spots for SRR23047996.sra Written 1882949 spots for SRR23047996.sra Read 1882949 spots for SRR23047996.sra Written 1882949 spots for SRR23047996.sra Read 1882951 spots for SRR23047996.sra Written 1882951 spots for SRR23047996.sra SRR ids: ['SRR23047996.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0vuczwro SRR23047996.sra spots: 37658982 blocks: [[1, 1882949], [1882950, 3765898], [3765899, 5648847], [5648848, 7531796], [7531797, 9414745], [9414746, 11297694], [11297695, 13180643], [13180644, 15063592], [15063593, 16946541], [16946542, 18829490], [18829491, 20712439], [20712440, 22595388], [22595389, 24478337], [24478338, 26361286], [26361287, 28244235], [28244236, 30127184], [30127185, 32010133], [32010134, 33893082], [33893083, 35776031], [35776032, 37658982]] SRR23047996 file size 12702916 SRR23047996 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR23047996 SRR23047996_1.fastq SRR23047996_2.fastq Input file: SRR23047996_1.fastq Paired file: SRR23047996_2.fastq trimmed: SRR23047996-trimmed-pair1.fastq, SRR23047996-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 07:22:32 2025 >> started Wed Feb 12 07:23:14 2025 >> done (41.904s) 37658982 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 37658982 (100.00%) read pairs available; of these: 82520 ( 0.22%) trimmed read pairs available after processing 37576462 (99.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 2 0.00% 27 2 0.00% 28 0 0.00% 29 0 0.00% 30 2 0.00% 31 1 0.00% 32 2 0.00% 33 2 0.00% 34 4 0.00% 35 3 0.00% 36 1 0.00% 37 3 0.00% 38 2 0.00% 39 0 0.00% 40 2 0.00% 41 2 0.00% 42 4 0.00% 43 2 0.00% 44 3 0.00% 45 5 0.00% 46 3 0.00% 47 1 0.00% 48 3 0.00% 49 7 0.00% 50 6 0.00% 51 7 0.00% 52 1 0.00% 53 5 0.00% 54 2 0.00% 55 9 0.00% 56 11 0.00% 57 3 0.00% 58 4 0.00% 59 7 0.00% 60 8 0.00% 61 6 0.00% 62 7 0.00% 63 8 0.00% 64 8 0.00% 65 6 0.00% 66 7 0.00% 67 8 0.00% 68 4 0.00% 69 11 0.00% 70 6 0.00% 71 9 0.00% 72 8 0.00% 73 8 0.00% 74 10 0.00% 75 9 0.00% 76 6 0.00% 77 9 0.00% 78 10 0.00% 79 9 0.00% 80 7 0.00% 81 7 0.00% 82 10 0.00% 83 9 0.00% 84 8 0.00% 85 12 0.00% 86 14 0.00% 87 9 0.00% 88 8 0.00% 89 15 0.00% 90 13 0.00% 91 14 0.00% 92 5 0.00% 93 11 0.00% 94 12 0.00% 95 12 0.00% 96 12 0.00% 97 6 0.00% 98 13 0.00% 99 5 0.00% 100 10 0.00% 101 18 0.00% 102 8 0.00% 103 10 0.00% 104 9 0.00% 105 18 0.00% 106 12 0.00% 107 19 0.00% 108 12 0.00% 109 13 0.00% 110 17 0.00% 111 13 0.00% 112 15 0.00% 113 7 0.00% 114 16 0.00% 115 13 0.00% 116 11 0.00% 117 17 0.00% 118 17 0.00% 119 11 0.00% 120 13 0.00% 121 21 0.00% 122 24 0.00% 123 25 0.00% 124 22 0.00% 125 14 0.00% 126 10 0.00% 127 13 0.00% 128 16 0.00% 129 13 0.00% 130 28 0.00% 131 24 0.00% 132 19 0.00% 133 28 0.00% 134 22 0.00% 135 34 0.00% 136 15 0.00% 137 20 0.00% 138 0 0.00% 139 0 0.00% 140 9 0.00% 141 72 0.00% 142 74 0.00% 143 79 0.00% 144 0 0.00% 145 225 0.00% 146 19236 0.05% 147 19899 0.05% 148 20585 0.05% 149 21242 0.06% 150 37576462 99.78% 37658982 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=6.74 fanout-score-rank=11 prefix-density=0.24 prefix-fanout=5.6 sequence=AACATCTGAATTGCATATGATACGGCTGGAAGTGACCGCAAAGTCATTCGAAGCGGCTCCGATGATATAACGATCACCAGTTCTAACCTCATCACCGAAGACATCGATCACTGCTTCAGCATGAACGGCACGAGGAAATATTGAAGTTGCCGTGAAGGCAAAGAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=28 fanout-score=130.64 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=14.3 sequence=TCTCATCAAGGCTTCCAGAACTTCCAAAGAAGATGATTCCGGAAGTACGAAATCTAAGCAAGAGAATTTGCACAGCTGTAGCCACATTTACTGAGTGACTCCCGGTCTTAACATATATAATAAGGCTATTGTTAAGTGTTCCAATATGGAACCTTCTTCCGGCAATGTCAACAGAAGGATTTTCACTGTCAGGCTCATAAAGACCAGAGTCTAGAAGAGCCTTTTCGTTGTTATCAGAGGTAAAAACAAGGCCTAAGCGAAGGAATGCAATTTTGCAATTGCT criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.75 fanout-score-rank=27 prefix-density=0.20 prefix-fanout=2.6 sequence=TGCAAGTGCGGCAG criterion=fanout-score sequence-density=0.09 sequence-density-rank=13 fanout-score=383.22 fanout-score-rank=1 prefix-density=1.03 prefix-fanout=33.7 sequence=AAGAAGAAGAAA SRR23047996 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 07:23:57 Started mapping on | Feb 12 07:23:57 Finished on | Feb 12 07:27:13 Mapping speed, Million of reads per hour | 691.70 Number of input reads | 37658982 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 35763765 Uniquely mapped reads % | 94.97% Average mapped length | 299.12 Number of splices: Total | 35713830 Number of splices: Annotated (sjdb) | 35067734 Number of splices: GT/AG | 35135022 Number of splices: GC/AG | 484926 Number of splices: AT/AC | 27153 Number of splices: Non-canonical | 66729 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.02% Deletion average length | 2.78 Insertion rate per base | 0.01% Insertion average length | 2.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1093863 % of reads mapped to multiple loci | 2.90% Number of reads mapped to too many loci | 254259 % of reads mapped to too many loci | 0.68% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.18% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 801354 801354 801354 N_multimapping 1093863 1093863 1093863 N_noFeature 802935 35462162 904284 N_ambiguous 395014 2199 193194 UnstrandedReadsAssigned:34565816 PositiveStrandReadsAssigned:299404 NegativeStrandReadsAssigned:34666287 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR23047996 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR23047996-trimmed-pair1.fastq SRR23047996-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,658,982 reads, 35,481,177 reads pseudoaligned [quant] estimated average fragment length: 295.93 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,204 rounds 52401 SRR23047996.ke.tsv 34699 SRR23047996.se.tsv 87100 total ==> SRR23047996.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1723.07 5160 68.691 Potri.005G024800.1.v4.1 1035 740.07 3370 104.45 Potri.004G059700.1.v4.1 961 666.08 34 1.17086 Potri.007G009000.2.v4.1 1416 1121.07 0 0 Potri.003G141000.2.v4.1 2943 2648.07 1552 13.4436 Potri.016G087400.1.v4.1 270 46.4167 1588 784.746 Potri.015G069301.1.v4.1 564 270.465 0 0 Potri.010G195200.1.v4.1 1773 1478.07 1256.94 19.5062 Potri.012G127500.1.v4.1 977 682.075 4644 156.176 ==> SRR23047996.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 64 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 395 Potri.001G212900.v4.1 12 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 1 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 32 SRR23047996 completed mapping pipeline successfully