Starting /dee2/code/volunteer_pipeline.sh SRR23047997 current disk space = 3049966710784 free memory = 1300375104 SRR23047997 SRAfilesize 587fa661bc1b6408b1f028ef85ee2d1c SRR23047997.sra SRR23047997.sra file validated SRR23047997 is paired end SRR23047997 is conventional basespace SRR23047997 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR23047997_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4865 37.0 37.0 37.0 37.0 37.0 2 36.3665 37.0 37.0 37.0 37.0 37.0 3 36.477 37.0 37.0 37.0 37.0 37.0 4 36.4705 37.0 37.0 37.0 37.0 37.0 5 36.489 37.0 37.0 37.0 37.0 37.0 6 36.57 37.0 37.0 37.0 37.0 37.0 7 36.4595 37.0 37.0 37.0 37.0 37.0 8 36.577 37.0 37.0 37.0 37.0 37.0 9 36.49 37.0 37.0 37.0 37.0 37.0 10-14 36.4877 37.0 37.0 37.0 37.0 37.0 15-19 36.49550000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.4107 37.0 37.0 37.0 37.0 37.0 25-29 36.424 37.0 37.0 37.0 37.0 37.0 30-34 36.4308 37.0 37.0 37.0 37.0 37.0 35-39 36.4164 37.0 37.0 37.0 37.0 37.0 40-44 36.3913 37.0 37.0 37.0 37.0 37.0 45-49 36.348200000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.318 37.0 37.0 37.0 37.0 37.0 55-59 36.28070000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.2821 37.0 37.0 37.0 37.0 37.0 65-69 36.194 37.0 37.0 37.0 37.0 37.0 70-74 36.1819 37.0 37.0 37.0 37.0 37.0 75-79 36.1785 37.0 37.0 37.0 37.0 37.0 80-84 36.14450000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.1563 37.0 37.0 37.0 37.0 37.0 90-94 36.0783 37.0 37.0 37.0 37.0 37.0 95-99 36.03 37.0 37.0 37.0 37.0 37.0 100-104 36.045899999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.021100000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.0176 37.0 37.0 37.0 37.0 37.0 115-119 36.0338 37.0 37.0 37.0 37.0 37.0 120-124 36.007799999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.927099999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.976099999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.8408 37.0 37.0 37.0 37.0 37.0 140-144 35.802800000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.780899999999995 37.0 37.0 37.0 37.0 37.0 150 35.66 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 3.0 25 2.0 26 4.0 27 8.0 28 16.0 29 26.0 30 30.0 31 38.0 32 51.0 33 87.0 34 118.0 35 378.0 36 2875.0 37 364.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.175000000000004 8.9 9.875 44.05 2 19.078617926890335 13.345017526289435 39.15873810716074 28.41762643965949 3 22.900000000000002 16.425 23.549999999999997 37.125 4 25.825 26.0 18.45 29.725 5 22.875 31.0 22.925 23.200000000000003 6 19.075 32.675 28.225 20.025000000000002 7 13.225000000000001 26.200000000000003 42.475 18.099999999999998 8 19.325 22.875 33.125 24.675 9 18.7 23.175 34.275 23.849999999999998 10-14 19.865 29.154999999999998 27.6 23.380000000000003 15-19 19.945 28.1 28.000000000000004 23.955000000000002 20-24 20.064999999999998 27.935 28.854999999999997 23.145 25-29 20.235 28.345 27.525 23.895 30-34 20.495 27.544999999999998 27.689999999999998 24.27 35-39 20.205000000000002 27.765 27.87 24.16 40-44 21.060000000000002 28.015 27.400000000000002 23.525 45-49 19.830000000000002 27.85 27.700000000000003 24.62 50-54 20.380000000000003 27.725 27.955000000000002 23.94 55-59 19.38 27.694999999999997 28.59 24.335 60-64 20.155 28.955 26.974999999999998 23.915 65-69 20.424999999999997 28.194999999999997 27.02 24.36 70-74 20.78 27.705000000000002 28.54 22.975 75-79 20.755000000000003 28.044999999999998 27.450000000000003 23.75 80-84 20.405 27.355 28.115000000000002 24.125 85-89 20.875 27.560000000000002 27.6 23.965 90-94 20.695 28.07 27.200000000000003 24.035 95-99 20.515 27.689999999999998 27.615000000000002 24.18 100-104 20.91 27.46 27.560000000000002 24.07 105-109 20.49 27.700000000000003 27.49 24.32 110-114 20.865000000000002 27.339999999999996 28.255000000000003 23.54 115-119 20.86 26.8 28.37 23.97 120-124 20.419999999999998 27.994999999999997 27.485 24.099999999999998 125-129 20.775 27.43 27.955000000000002 23.84 130-134 20.5 27.66 27.860000000000003 23.98 135-139 20.96 27.18 27.72 24.14 140-144 20.64 26.63 28.725 24.005000000000003 145-149 20.82 27.625 27.525 24.03 150 21.0 26.674999999999997 27.625 24.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.5 24 2.0 25 2.5 26 6.0 27 7.0 28 9.5 29 10.0 30 10.5 31 16.0 32 26.5 33 38.0 34 43.0 35 45.5 36 71.5 37 95.0 38 117.0 39 157.5 40 191.5 41 213.0 42 237.5 43 253.5 44 268.0 45 279.0 46 263.5 47 256.0 48 227.5 49 201.5 50 196.5 51 168.0 52 132.0 53 99.5 54 80.0 55 64.0 56 41.5 57 30.5 58 32.5 59 31.0 60 18.5 61 13.5 62 9.5 63 5.5 64 6.5 65 6.5 66 4.0 67 0.5 68 1.0 69 2.0 70 1.0 71 0.5 72 1.5 73 1.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.75 #Duplication Level Percentage of deduplicated Percentage of total 1 89.44289693593315 80.27499999999999 2 9.805013927576601 17.599999999999998 3 0.6406685236768802 1.725 4 0.11142061281337048 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGCAGA 10 0.006973645 144.0 6 CAAAACC 35 0.0034045284 61.714283 3 >>END_MODULE SRR23047997 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR23047997_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9 37.0 37.0 37.0 37.0 37.0 2 35.9015 37.0 37.0 37.0 37.0 37.0 3 36.078 37.0 37.0 37.0 37.0 37.0 4 36.1555 37.0 37.0 37.0 37.0 37.0 5 36.197 37.0 37.0 37.0 37.0 37.0 6 36.0425 37.0 37.0 37.0 37.0 37.0 7 36.099 37.0 37.0 37.0 37.0 37.0 8 36.163 37.0 37.0 37.0 37.0 37.0 9 36.1215 37.0 37.0 37.0 37.0 37.0 10-14 36.167500000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.1157 37.0 37.0 37.0 37.0 37.0 20-24 36.1173 37.0 37.0 37.0 37.0 37.0 25-29 36.0829 37.0 37.0 37.0 37.0 37.0 30-34 36.1225 37.0 37.0 37.0 37.0 37.0 35-39 36.0461 37.0 37.0 37.0 37.0 37.0 40-44 36.0307 37.0 37.0 37.0 37.0 37.0 45-49 36.000600000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.0286 37.0 37.0 37.0 37.0 37.0 55-59 35.9259 37.0 37.0 37.0 37.0 37.0 60-64 35.8876 37.0 37.0 37.0 37.0 37.0 65-69 35.81569999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.87859999999999 37.0 37.0 37.0 37.0 37.0 75-79 35.8947 37.0 37.0 37.0 37.0 37.0 80-84 35.710699999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.726800000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.7318 37.0 37.0 37.0 37.0 37.0 95-99 35.72710000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.6738 37.0 37.0 37.0 37.0 37.0 105-109 35.707100000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.6526 37.0 37.0 37.0 37.0 37.0 115-119 35.7062 37.0 37.0 37.0 37.0 37.0 120-124 35.5017 37.0 37.0 37.0 37.0 37.0 125-129 35.605900000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.7704 37.0 37.0 37.0 37.0 37.0 135-139 35.648799999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.5287 37.0 37.0 37.0 37.0 37.0 145-149 35.3952 37.0 37.0 37.0 37.0 37.0 150 35.473 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 4.0 23 4.0 24 9.0 25 11.0 26 9.0 27 10.0 28 11.0 29 18.0 30 29.0 31 53.0 32 72.0 33 126.0 34 239.0 35 639.0 36 2579.0 37 187.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.449999999999996 21.575 14.2 28.775000000000002 2 18.525 34.525 32.324999999999996 14.625 3 19.975 31.474999999999998 28.299999999999997 20.25 4 23.599999999999998 36.65 21.525 18.224999999999998 5 24.675 37.625 21.475 16.225 6 19.975 38.775 24.8 16.45 7 20.075000000000003 20.525 39.65 19.75 8 20.875 24.525 28.725 25.874999999999996 9 22.650000000000002 26.025 29.25 22.075 10-14 23.405 30.130000000000003 24.86 21.605 15-19 22.955000000000002 29.43 26.745 20.87 20-24 23.01 29.99 26.340000000000003 20.66 25-29 22.900000000000002 28.845 27.29 20.965 30-34 22.605 29.665000000000003 26.915 20.815 35-39 23.185 29.565 26.174999999999997 21.075 40-44 22.745 28.845 26.479999999999997 21.93 45-49 22.985 29.060000000000002 26.979999999999997 20.974999999999998 50-54 22.994999999999997 28.105000000000004 27.275 21.625 55-59 23.369999999999997 27.97 27.37 21.29 60-64 23.925 27.98 26.68 21.415 65-69 23.505000000000003 27.195000000000004 27.57 21.73 70-74 23.73 28.715000000000003 26.55 21.005 75-79 24.08 28.01 26.775 21.135 80-84 23.72 28.67 26.26 21.349999999999998 85-89 23.5 28.735 26.215 21.55 90-94 23.51 28.439999999999998 27.07 20.979999999999997 95-99 23.695 27.87 26.979999999999997 21.455 100-104 23.935000000000002 28.660000000000004 26.46 20.945 105-109 23.36 28.735 26.775 21.13 110-114 23.695 28.17 27.01 21.125 115-119 23.605 28.854999999999997 26.705000000000002 20.835 120-124 23.765 28.365000000000002 27.1 20.77 125-129 23.94 27.884999999999998 27.465 20.71 130-134 24.005000000000003 27.689999999999998 27.639999999999997 20.665 135-139 23.585 27.82 27.445000000000004 21.15 140-144 24.095 28.645 26.765 20.495 145-149 23.515 27.76 27.73 20.995 150 24.675 28.375 26.325 20.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 1.0 19 1.0 20 0.5 21 0.0 22 0.0 23 0.5 24 1.5 25 6.0 26 6.5 27 8.0 28 9.5 29 11.5 30 16.0 31 18.5 32 20.5 33 31.0 34 46.5 35 60.0 36 81.5 37 111.0 38 128.0 39 140.0 40 177.0 41 219.5 42 257.0 43 262.0 44 270.0 45 268.0 46 255.0 47 264.5 48 251.0 49 210.0 50 182.0 51 155.5 52 112.0 53 84.5 54 75.0 55 63.5 56 42.5 57 35.5 58 30.0 59 22.5 60 15.5 61 10.0 62 7.5 63 7.0 64 6.5 65 3.5 66 2.0 67 1.0 68 0.5 69 1.0 70 1.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.01109877913429 81.10000000000001 2 9.07325194228635 16.35 3 0.8324084350721421 2.25 4 0.0832408435072142 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGCCAC 10 0.006973645 144.0 2 >>END_MODULE Read 1774938 spots for SRR23047997.sra Written 1774938 spots for SRR23047997.sra Read 1774938 spots for SRR23047997.sra Written 1774938 spots for SRR23047997.sra Read 1774938 spots for SRR23047997.sra Written 1774938 spots for SRR23047997.sra Read 1774938 spots for SRR23047997.sra Written 1774938 spots for SRR23047997.sra Read 1774938 spots for SRR23047997.sra Written 1774938 spots for SRR23047997.sra Read 1774938 spots for SRR23047997.sra Written 1774938 spots for SRR23047997.sra Read 1774938 spots for SRR23047997.sra Written 1774938 spots for SRR23047997.sra Read 1774938 spots for SRR23047997.sra Written 1774938 spots for SRR23047997.sra Read 1774938 spots for SRR23047997.sra Written 1774938 spots for SRR23047997.sra Read 1774938 spots for SRR23047997.sra Written 1774938 spots for SRR23047997.sra Read 1774938 spots for SRR23047997.sra Written 1774938 spots for SRR23047997.sra Read 1774938 spots for SRR23047997.sra Written 1774938 spots for SRR23047997.sra Read 1774938 spots for SRR23047997.sra Written 1774938 spots for SRR23047997.sra Read 1774938 spots for SRR23047997.sra Written 1774938 spots for SRR23047997.sra Read 1774955 spots for SRR23047997.sra Written 1774955 spots for SRR23047997.sra Read 1774938 spots for SRR23047997.sra Written 1774938 spots for SRR23047997.sra Read 1774938 spots for SRR23047997.sra Written 1774938 spots for SRR23047997.sra Read 1774938 spots for SRR23047997.sra Written 1774938 spots for SRR23047997.sra Read 1774938 spots for SRR23047997.sra Written 1774938 spots for SRR23047997.sra Read 1774938 spots for SRR23047997.sra Written 1774938 spots for SRR23047997.sra SRR ids: ['SRR23047997.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rjaznnt4 SRR23047997.sra spots: 35498777 blocks: [[1, 1774938], [1774939, 3549876], [3549877, 5324814], [5324815, 7099752], [7099753, 8874690], [8874691, 10649628], [10649629, 12424566], [12424567, 14199504], [14199505, 15974442], [15974443, 17749380], [17749381, 19524318], [19524319, 21299256], [21299257, 23074194], [23074195, 24849132], [24849133, 26624070], [26624071, 28399008], [28399009, 30173946], [30173947, 31948884], [31948885, 33723822], [33723823, 35498777]] SRR23047997 file size 11973003 SRR23047997 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR23047997 SRR23047997_1.fastq SRR23047997_2.fastq Input file: SRR23047997_1.fastq Paired file: SRR23047997_2.fastq trimmed: SRR23047997-trimmed-pair1.fastq, SRR23047997-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 07:29:56 2025 >> started Wed Feb 12 07:30:39 2025 >> done (43.682s) 35498777 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 35498777 (100.00%) read pairs available; of these: 84441 ( 0.24%) trimmed read pairs available after processing 35414336 (99.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 1 0.00% 28 0 0.00% 29 1 0.00% 30 0 0.00% 31 3 0.00% 32 2 0.00% 33 1 0.00% 34 0 0.00% 35 1 0.00% 36 1 0.00% 37 2 0.00% 38 4 0.00% 39 3 0.00% 40 2 0.00% 41 5 0.00% 42 2 0.00% 43 4 0.00% 44 0 0.00% 45 3 0.00% 46 3 0.00% 47 4 0.00% 48 2 0.00% 49 3 0.00% 50 3 0.00% 51 6 0.00% 52 3 0.00% 53 5 0.00% 54 12 0.00% 55 3 0.00% 56 6 0.00% 57 3 0.00% 58 7 0.00% 59 7 0.00% 60 4 0.00% 61 7 0.00% 62 3 0.00% 63 9 0.00% 64 9 0.00% 65 7 0.00% 66 5 0.00% 67 7 0.00% 68 8 0.00% 69 11 0.00% 70 10 0.00% 71 9 0.00% 72 8 0.00% 73 10 0.00% 74 5 0.00% 75 9 0.00% 76 8 0.00% 77 4 0.00% 78 2 0.00% 79 6 0.00% 80 10 0.00% 81 7 0.00% 82 7 0.00% 83 7 0.00% 84 12 0.00% 85 13 0.00% 86 11 0.00% 87 3 0.00% 88 5 0.00% 89 10 0.00% 90 8 0.00% 91 10 0.00% 92 7 0.00% 93 8 0.00% 94 9 0.00% 95 14 0.00% 96 11 0.00% 97 10 0.00% 98 11 0.00% 99 16 0.00% 100 9 0.00% 101 5 0.00% 102 7 0.00% 103 7 0.00% 104 6 0.00% 105 15 0.00% 106 7 0.00% 107 9 0.00% 108 11 0.00% 109 10 0.00% 110 7 0.00% 111 9 0.00% 112 9 0.00% 113 10 0.00% 114 17 0.00% 115 9 0.00% 116 12 0.00% 117 12 0.00% 118 14 0.00% 119 13 0.00% 120 10 0.00% 121 30 0.00% 122 19 0.00% 123 26 0.00% 124 20 0.00% 125 13 0.00% 126 11 0.00% 127 11 0.00% 128 12 0.00% 129 10 0.00% 130 10 0.00% 131 21 0.00% 132 14 0.00% 133 21 0.00% 134 22 0.00% 135 13 0.00% 136 18 0.00% 137 15 0.00% 138 0 0.00% 139 0 0.00% 140 8 0.00% 141 51 0.00% 142 53 0.00% 143 58 0.00% 144 0 0.00% 145 188 0.00% 146 19626 0.06% 147 20548 0.06% 148 21376 0.06% 149 21606 0.06% 150 35414336 99.76% 35498777 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=10.06 fanout-score-rank=8 prefix-density=0.45 prefix-fanout=5.7 sequence=CCAGCAGTGTCCCAGCCGTAGTCACCAGGGAACTCACCAGTCAAGTAGGATGGGGGCTCACCAGAGAACGGGCCCAAGTATTTAACACGGTCTGGTCCGTACCATGGGCTCCCGGAGGGAACAGGCTTGGTGGTTTTCCTCATGGAGACACGGCCATTGCCCATGATCTCAGAGGAGGAGGGGTTGAGCTTCACCGCCTTTCCGGCTAGCGAAGGGGA criterion=fanout-score sequence-density=0.03 sequence-density-rank=33 fanout-score=40.62 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=9.3 sequence=CAATATCTTCCTTGGGAATTTTGTCACTCTTGAATATTCCAATGCAGACACCAATCCTATCATCTCTGGTTGGAGCCCAGTAGAATTTCTCCATACGACCATCACGGATAAGAGGAGCATACAATGTTGAAAAATCGTTACCAGTGACGATGATGGGGACACGTGGATTCTCCTCCTTGTTGTACATGCCGGGAAGTTGCACATTTGTTGGGTTGTCAGCAATGTTCATGAGGGTAGCATTAACCATCTGGTTGTTGACGGTGTATTGGGTAGTTCCACCAAGTCTACCAGCTCCGGCATCAAGATCGTTGATGAAGAGGCAGCACATCTTTCCCTTCTTCTTGATTATATCAGCCGCCTCACGGTACCTTTGCCTGATAAGCTTTGCGGGT criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.64 fanout-score-rank=32 prefix-density=0.37 prefix-fanout=2.4 sequence=ATAGAGAGAAAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=378.87 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=11.7 sequence=AAAAAGAAGACCGTCAACTCCAACCCACGGCCACCAAACATCATCTCTTCAATCGTAAATCACAAATACATACACGTTTACTCATCAGCTCGAAAATGGCAGCAG SRR23047997 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 07:31:29 Started mapping on | Feb 12 07:31:29 Finished on | Feb 12 07:34:33 Mapping speed, Million of reads per hour | 694.54 Number of input reads | 35498777 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 33883212 Uniquely mapped reads % | 95.45% Average mapped length | 299.20 Number of splices: Total | 33448035 Number of splices: Annotated (sjdb) | 32923244 Number of splices: GT/AG | 32896079 Number of splices: GC/AG | 463031 Number of splices: AT/AC | 25107 Number of splices: Non-canonical | 63818 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.93 Insertion rate per base | 0.01% Insertion average length | 1.99 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1023882 % of reads mapped to multiple loci | 2.88% Number of reads mapped to too many loci | 207257 % of reads mapped to too many loci | 0.58% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.93% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 591683 591683 591683 N_multimapping 1023882 1023882 1023882 N_noFeature 792107 33603708 875842 N_ambiguous 401921 1609 205059 UnstrandedReadsAssigned:32689184 PositiveStrandReadsAssigned:277895 NegativeStrandReadsAssigned:32802311 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR23047997 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR23047997-trimmed-pair1.fastq SRR23047997-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,498,777 reads, 33,420,637 reads pseudoaligned [quant] estimated average fragment length: 297.549 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,214 rounds 52401 SRR23047997.ke.tsv 34699 SRR23047997.se.tsv 87100 total ==> SRR23047997.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1721.45 3362 45.6532 Potri.005G024800.1.v4.1 1035 738.451 2096 66.3496 Potri.004G059700.1.v4.1 961 664.483 46 1.61824 Potri.007G009000.2.v4.1 1416 1119.45 0 0 Potri.003G141000.2.v4.1 2943 2646.45 1276 11.2708 Potri.016G087400.1.v4.1 270 46.782 1432 715.538 Potri.015G069301.1.v4.1 564 269.497 0 0 Potri.010G195200.1.v4.1 1773 1476.45 588 9.30951 Potri.012G127500.1.v4.1 977 680.477 7818 268.565 ==> SRR23047997.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 80 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 393 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 26 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 12 SRR23047997 completed mapping pipeline successfully