Starting /dee2/code/volunteer_pipeline.sh SRR23047998 current disk space = 3049859481600 free memory = 1408735844 SRR23047998 SRAfilesize 645da215dfa95e226b442385d0a86405 SRR23047998.sra SRR23047998.sra file validated SRR23047998 is paired end SRR23047998 is conventional basespace SRR23047998 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR23047998_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0575 37.0 37.0 37.0 37.0 37.0 2 36.3405 37.0 37.0 37.0 37.0 37.0 3 36.359 37.0 37.0 37.0 37.0 37.0 4 36.352 37.0 37.0 37.0 37.0 37.0 5 36.4585 37.0 37.0 37.0 37.0 37.0 6 36.453 37.0 37.0 37.0 37.0 37.0 7 36.368 37.0 37.0 37.0 37.0 37.0 8 36.3295 37.0 37.0 37.0 37.0 37.0 9 36.335 37.0 37.0 37.0 37.0 37.0 10-14 36.4063 37.0 37.0 37.0 37.0 37.0 15-19 36.3804 37.0 37.0 37.0 37.0 37.0 20-24 36.32470000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.2967 37.0 37.0 37.0 37.0 37.0 30-34 36.1928 37.0 37.0 37.0 37.0 37.0 35-39 36.1668 37.0 37.0 37.0 37.0 37.0 40-44 36.1278 37.0 37.0 37.0 37.0 37.0 45-49 36.1623 37.0 37.0 37.0 37.0 37.0 50-54 36.150999999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.13340000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.0904 37.0 37.0 37.0 37.0 37.0 65-69 36.0861 37.0 37.0 37.0 37.0 37.0 70-74 36.03529999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.0847 37.0 37.0 37.0 37.0 37.0 80-84 36.0149 37.0 37.0 37.0 37.0 37.0 85-89 36.0164 37.0 37.0 37.0 37.0 37.0 90-94 35.9469 37.0 37.0 37.0 37.0 37.0 95-99 35.793699999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.8121 37.0 37.0 37.0 37.0 37.0 105-109 35.892 37.0 37.0 37.0 37.0 37.0 110-114 35.86189999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.8168 37.0 37.0 37.0 37.0 37.0 120-124 35.71759999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.6279 37.0 37.0 37.0 37.0 37.0 130-134 35.727 37.0 37.0 37.0 37.0 37.0 135-139 35.7023 37.0 37.0 37.0 37.0 37.0 140-144 35.523399999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.581900000000005 37.0 37.0 37.0 37.0 37.0 150 35.777 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 4.0 26 3.0 27 8.0 28 18.0 29 23.0 30 23.0 31 61.0 32 73.0 33 111.0 34 195.0 35 441.0 36 2880.0 37 158.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.1360201511335 7.909319899244332 9.420654911838792 44.53400503778337 2 19.45 13.750000000000002 37.45 29.349999999999998 3 22.975 15.775 23.1 38.15 4 25.7 24.675 19.950000000000003 29.675 5 23.45 28.975 26.200000000000003 21.375 6 19.575 32.675 26.6 21.15 7 15.15 24.75 42.325 17.775 8 17.95 24.224999999999998 32.175 25.650000000000002 9 17.549999999999997 23.1 36.05 23.3 10-14 19.7 29.7 28.155 22.445 15-19 20.28 27.884999999999998 27.694999999999997 24.14 20-24 20.025000000000002 28.689999999999998 28.544999999999998 22.74 25-29 19.939999999999998 28.305000000000003 28.63 23.125 30-34 19.89 27.975 28.475 23.66 35-39 19.89 27.99 28.54 23.580000000000002 40-44 20.085 28.24 28.115000000000002 23.56 45-49 20.09 28.249999999999996 27.93 23.73 50-54 20.465 28.09 27.935 23.51 55-59 20.32 27.785 28.18 23.715 60-64 20.02 28.16 28.455000000000002 23.365 65-69 20.36 28.444999999999997 27.495000000000005 23.7 70-74 21.029999999999998 27.49 27.794999999999998 23.685000000000002 75-79 20.935000000000002 27.6 28.32 23.145 80-84 20.43 27.935 27.6 24.035 85-89 20.96 27.900000000000002 27.400000000000002 23.74 90-94 20.64 28.044999999999998 27.63 23.685000000000002 95-99 21.11 27.815 27.794999999999998 23.28 100-104 20.415 28.854999999999997 27.72 23.01 105-109 21.154999999999998 27.68 27.38 23.785 110-114 20.255000000000003 28.04 27.694999999999997 24.01 115-119 20.65 27.725 28.199999999999996 23.425 120-124 20.735 28.044999999999998 27.800000000000004 23.419999999999998 125-129 20.95 27.465 27.884999999999998 23.7 130-134 20.955 27.055 28.58 23.41 135-139 20.724999999999998 27.52 28.055000000000003 23.7 140-144 21.54 27.084999999999997 27.83 23.544999999999998 145-149 21.495 27.735 27.694999999999997 23.075000000000003 150 21.275 28.375 26.85 23.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 0.5 23 0.5 24 1.0 25 1.0 26 3.5 27 7.0 28 8.0 29 14.5 30 20.0 31 22.0 32 25.5 33 29.5 34 40.5 35 71.0 36 88.5 37 107.0 38 142.5 39 150.0 40 177.0 41 219.0 42 246.0 43 262.5 44 271.5 45 273.5 46 254.5 47 249.5 48 243.0 49 209.0 50 165.0 51 150.5 52 130.5 53 92.0 54 80.5 55 64.5 56 43.5 57 33.5 58 25.0 59 17.5 60 11.5 61 8.5 62 7.5 63 5.5 64 4.5 65 2.5 66 2.5 67 2.5 68 3.0 69 3.0 70 1.5 71 1.5 72 1.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.7 #Duplication Level Percentage of deduplicated Percentage of total 1 88.50056369785794 78.5 2 10.372040586245772 18.4 3 1.0146561443066515 2.7 4 0.11273957158962795 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTATAC 10 0.006973645 144.0 6 TTCTTAT 10 0.006973645 144.0 6 >>END_MODULE SRR23047998 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR23047998_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.177 37.0 37.0 37.0 37.0 37.0 2 35.766 37.0 37.0 37.0 37.0 37.0 3 35.7005 37.0 37.0 37.0 37.0 37.0 4 35.825 37.0 37.0 37.0 37.0 37.0 5 36.03 37.0 37.0 37.0 37.0 37.0 6 35.967 37.0 37.0 37.0 37.0 37.0 7 35.706 37.0 37.0 37.0 37.0 37.0 8 35.986 37.0 37.0 37.0 37.0 37.0 9 35.943 37.0 37.0 37.0 37.0 37.0 10-14 35.9427 37.0 37.0 37.0 37.0 37.0 15-19 35.893299999999996 37.0 37.0 37.0 37.0 37.0 20-24 35.8723 37.0 37.0 37.0 37.0 37.0 25-29 35.838300000000004 37.0 37.0 37.0 37.0 37.0 30-34 35.7699 37.0 37.0 37.0 37.0 37.0 35-39 35.6904 37.0 37.0 37.0 37.0 37.0 40-44 35.690799999999996 37.0 37.0 37.0 37.0 37.0 45-49 35.6164 37.0 37.0 37.0 37.0 37.0 50-54 35.6659 37.0 37.0 37.0 37.0 37.0 55-59 35.537099999999995 37.0 37.0 37.0 37.0 37.0 60-64 35.4385 37.0 37.0 37.0 37.0 37.0 65-69 35.5364 37.0 37.0 37.0 37.0 37.0 70-74 35.349900000000005 37.0 37.0 37.0 34.6 37.0 75-79 35.4169 37.0 37.0 37.0 37.0 37.0 80-84 35.2976 37.0 37.0 37.0 29.8 37.0 85-89 35.2828 37.0 37.0 37.0 32.2 37.0 90-94 35.2009 37.0 37.0 37.0 29.8 37.0 95-99 35.16289999999999 37.0 37.0 37.0 29.8 37.0 100-104 35.269 37.0 37.0 37.0 32.2 37.0 105-109 35.034 37.0 37.0 37.0 27.4 37.0 110-114 35.1289 37.0 37.0 37.0 25.0 37.0 115-119 35.047799999999995 37.0 37.0 37.0 25.0 37.0 120-124 34.9479 37.0 37.0 37.0 25.0 37.0 125-129 34.9686 37.0 37.0 37.0 25.0 37.0 130-134 34.9828 37.0 37.0 37.0 27.4 37.0 135-139 34.7065 37.0 37.0 37.0 25.0 37.0 140-144 34.778800000000004 37.0 37.0 37.0 25.0 37.0 145-149 34.815 37.0 37.0 37.0 25.0 37.0 150 34.9215 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 3.0 23 7.0 24 12.0 25 15.0 26 13.0 27 20.0 28 32.0 29 40.0 30 49.0 31 71.0 32 117.0 33 149.0 34 317.0 35 995.0 36 2098.0 37 61.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.656792645556685 23.36567926455567 15.015321756894789 27.96220633299285 2 20.625 33.45 32.6 13.325000000000001 3 19.575 34.4 27.175 18.85 4 23.849999999999998 37.425000000000004 20.4 18.325 5 23.875 38.574999999999996 21.525 16.025 6 18.675 40.400000000000006 24.075 16.85 7 17.849999999999998 22.3 39.25 20.599999999999998 8 20.275000000000002 25.55 30.875000000000004 23.3 9 22.975 24.575 28.849999999999998 23.599999999999998 10-14 22.755 30.36 26.125 20.76 15-19 22.845 29.354999999999997 26.56 21.240000000000002 20-24 22.919999999999998 29.09 26.86 21.13 25-29 22.935 29.299999999999997 27.13 20.635 30-34 22.29 29.175 27.36 21.175 35-39 22.465 29.060000000000002 27.555000000000003 20.919999999999998 40-44 22.23 29.26 27.425 21.085 45-49 22.884999999999998 28.799999999999997 27.16 21.154999999999998 50-54 23.205000000000002 27.77 27.655 21.37 55-59 23.055 28.83 26.77 21.345 60-64 23.005 28.77 26.85 21.375 65-69 23.200000000000003 28.23 27.625 20.945 70-74 23.405 28.249999999999996 27.235 21.11 75-79 22.62 28.21 27.694999999999997 21.475 80-84 22.11 28.634999999999998 27.16 22.095000000000002 85-89 23.32 28.299999999999997 27.515 20.865000000000002 90-94 23.135 28.475 27.089999999999996 21.3 95-99 23.1 28.775000000000002 27.41 20.715 100-104 22.755 27.74 27.82 21.685 105-109 23.215 28.42 27.05 21.315 110-114 22.55 28.845 27.075 21.529999999999998 115-119 23.294999999999998 27.82 27.13 21.755 120-124 23.055 28.375 27.38 21.19 125-129 23.135 28.425 27.605 20.835 130-134 22.935 28.98 26.755000000000003 21.33 135-139 22.735 28.050000000000004 27.650000000000002 21.565 140-144 23.06 28.09 27.575 21.275 145-149 23.06 28.425 27.544999999999998 20.97 150 23.25 29.275000000000002 27.175 20.3 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.0 6 2.5 7 1.5 8 0.5 9 0.5 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 1.0 16 1.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 2.5 24 4.5 25 3.0 26 3.5 27 7.0 28 8.5 29 11.0 30 17.5 31 20.5 32 26.0 33 36.5 34 48.5 35 64.0 36 86.0 37 118.0 38 142.0 39 161.0 40 174.0 41 231.5 42 279.0 43 281.0 44 307.0 45 291.0 46 255.0 47 244.5 48 237.5 49 202.5 50 153.0 51 129.5 52 109.5 53 81.5 54 58.5 55 43.5 56 35.0 57 23.0 58 15.0 59 18.0 60 19.0 61 15.0 62 7.0 63 5.0 64 4.5 65 1.5 66 0.5 67 0.0 68 1.0 69 1.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.35 #Duplication Level Percentage of deduplicated Percentage of total 1 89.14381645215444 79.65 2 9.848908785674315 17.599999999999998 3 0.9513150531617236 2.55 4 0.05595970900951316 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGAGGT 10 0.0069754543 143.9875 7 >>END_MODULE Read 1853757 spots for SRR23047998.sra Written 1853757 spots for SRR23047998.sra Read 1853757 spots for SRR23047998.sra Written 1853757 spots for SRR23047998.sra Read 1853757 spots for SRR23047998.sra Written 1853757 spots for SRR23047998.sra Read 1853757 spots for SRR23047998.sra Written 1853757 spots for SRR23047998.sra Read 1853757 spots for SRR23047998.sra Written 1853757 spots for SRR23047998.sra Read 1853757 spots for SRR23047998.sra Written 1853757 spots for SRR23047998.sra Read 1853757 spots for SRR23047998.sra Written 1853757 spots for SRR23047998.sra Read 1853757 spots for SRR23047998.sra Written 1853757 spots for SRR23047998.sra Read 1853757 spots for SRR23047998.sra Written 1853757 spots for SRR23047998.sra Read 1853769 spots for SRR23047998.sra Written 1853769 spots for SRR23047998.sra Read 1853757 spots for SRR23047998.sra Written 1853757 spots for SRR23047998.sra Read 1853757 spots for SRR23047998.sra Written 1853757 spots for SRR23047998.sra Read 1853757 spots for SRR23047998.sra Written 1853757 spots for SRR23047998.sra Read 1853757 spots for SRR23047998.sra Written 1853757 spots for SRR23047998.sra Read 1853757 spots for SRR23047998.sra Written 1853757 spots for SRR23047998.sra Read 1853757 spots for SRR23047998.sra Written 1853757 spots for SRR23047998.sra Read 1853757 spots for SRR23047998.sra Written 1853757 spots for SRR23047998.sra Read 1853757 spots for SRR23047998.sra Written 1853757 spots for SRR23047998.sra Read 1853757 spots for SRR23047998.sra Written 1853757 spots for SRR23047998.sra Read 1853757 spots for SRR23047998.sra Written 1853757 spots for SRR23047998.sra SRR ids: ['SRR23047998.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jzqb_2xi SRR23047998.sra spots: 37075152 blocks: [[1, 1853757], [1853758, 3707514], [3707515, 5561271], [5561272, 7415028], [7415029, 9268785], [9268786, 11122542], [11122543, 12976299], [12976300, 14830056], [14830057, 16683813], [16683814, 18537570], [18537571, 20391327], [20391328, 22245084], [22245085, 24098841], [24098842, 25952598], [25952599, 27806355], [27806356, 29660112], [29660113, 31513869], [31513870, 33367626], [33367627, 35221383], [35221384, 37075152]] SRR23047998 file size 12505645 SRR23047998 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR23047998 SRR23047998_1.fastq SRR23047998_2.fastq Input file: SRR23047998_1.fastq Paired file: SRR23047998_2.fastq trimmed: SRR23047998-trimmed-pair1.fastq, SRR23047998-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 07:47:44 2025 >> started Wed Feb 12 07:48:28 2025 >> done (43.644s) 37075152 read pairs processed; of these: 2 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 37075150 (100.00%) read pairs available; of these: 92166 ( 0.25%) trimmed read pairs available after processing 36982984 (99.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 21 2 0.00% 22 0 0.00% 23 0 0.00% 24 1 0.00% 25 1 0.00% 26 0 0.00% 27 1 0.00% 28 1 0.00% 29 1 0.00% 30 1 0.00% 31 4 0.00% 32 6 0.00% 33 1 0.00% 34 5 0.00% 35 3 0.00% 36 2 0.00% 37 4 0.00% 38 5 0.00% 39 3 0.00% 40 4 0.00% 41 9 0.00% 42 7 0.00% 43 2 0.00% 44 2 0.00% 45 6 0.00% 46 9 0.00% 47 6 0.00% 48 5 0.00% 49 7 0.00% 50 6 0.00% 51 1 0.00% 52 6 0.00% 53 9 0.00% 54 6 0.00% 55 11 0.00% 56 10 0.00% 57 13 0.00% 58 7 0.00% 59 17 0.00% 60 9 0.00% 61 17 0.00% 62 19 0.00% 63 15 0.00% 64 17 0.00% 65 17 0.00% 66 7 0.00% 67 10 0.00% 68 16 0.00% 69 5 0.00% 70 11 0.00% 71 15 0.00% 72 15 0.00% 73 18 0.00% 74 13 0.00% 75 17 0.00% 76 17 0.00% 77 17 0.00% 78 22 0.00% 79 21 0.00% 80 18 0.00% 81 24 0.00% 82 15 0.00% 83 25 0.00% 84 17 0.00% 85 21 0.00% 86 17 0.00% 87 12 0.00% 88 20 0.00% 89 18 0.00% 90 21 0.00% 91 25 0.00% 92 21 0.00% 93 20 0.00% 94 30 0.00% 95 13 0.00% 96 13 0.00% 97 21 0.00% 98 13 0.00% 99 20 0.00% 100 13 0.00% 101 13 0.00% 102 19 0.00% 103 17 0.00% 104 29 0.00% 105 26 0.00% 106 31 0.00% 107 23 0.00% 108 27 0.00% 109 23 0.00% 110 24 0.00% 111 28 0.00% 112 32 0.00% 113 24 0.00% 114 24 0.00% 115 24 0.00% 116 26 0.00% 117 28 0.00% 118 37 0.00% 119 10 0.00% 120 15 0.00% 121 45 0.00% 122 51 0.00% 123 48 0.00% 124 41 0.00% 125 32 0.00% 126 15 0.00% 127 26 0.00% 128 23 0.00% 129 14 0.00% 130 37 0.00% 131 52 0.00% 132 35 0.00% 133 38 0.00% 134 41 0.00% 135 45 0.00% 136 30 0.00% 137 55 0.00% 138 0 0.00% 139 0 0.00% 140 14 0.00% 141 95 0.00% 142 105 0.00% 143 98 0.00% 144 0 0.00% 145 339 0.00% 146 21137 0.06% 147 22255 0.06% 148 22767 0.06% 149 23369 0.06% 150 36982984 99.75% 37075150 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=38 prefix-density=0.24 prefix-fanout=2.0 sequence=TGGCCACGGTCTAGACGGCGCCCACCGCCAGGTGAGGCTGCGGCCCACACAGTGTAAGGGCAATTGTTTCGGATTTCGAAGGTGGCTGCATTAGTAGAGATGATGAGAAGGCTAAAGAGGAGGGAGGAGGTGAGAAATTTGGTTAAGTGGCTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=38 fanout-score=31.25 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=8.9 sequence=CAACCATCATCATGCATGCTCTCCCCCACAAAGAATTGCAAGTCCTTGATTTTTGAAAGCAAGAACTTGGTTGCTCCCTCAATGTTCTTTCTAAAATGTTCCTTCTGGTCCTCATCAAGTTTCTCCGACAGATTCTTGATAAATTTCTTAATCTGTGTAAGAAACTGCTTCTTGTCAAATGGAGGTTGCTCCTGGAGCCTAAATGTGTCAACGATGTCAACAACCTTGGCAGCTTGGTCATCAACACCCTCATCCTCATC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.68 fanout-score-rank=24 prefix-density=0.45 prefix-fanout=2.7 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=147.08 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=18.1 sequence=CAAGAAGATCAACTGTCTCTCTGCCTGGTTTGTATTCCAAGAAATGGAGAAAGTCCAAAAGCTCCTTTGTGTGGCTCTATTGCTTGCAGTACTAGCCATAGCAAGCAATATTGCGAATGCCCAGAGTACCATATGCAAAATGCCTGTTGCTGGCCTAATGTCATGCAAGCCTTCTGTAACTCCTCCTAACCCTACCGCACCCTCGGCAGACTGCTGCTCGGCACTTTCGCATGCTGACATAAACTGCCTTTGCTCCTACAAAAATTCCAACCTGCTCCCTTCCCTTGGAATCGACCCAAAACTTGCCATGCAGCTCCCT SRR23047998 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 07:49:11 Started mapping on | Feb 12 07:49:11 Finished on | Feb 12 07:52:24 Mapping speed, Million of reads per hour | 691.56 Number of input reads | 37075150 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 35394864 Uniquely mapped reads % | 95.47% Average mapped length | 298.93 Number of splices: Total | 34462262 Number of splices: Annotated (sjdb) | 33770429 Number of splices: GT/AG | 33919756 Number of splices: GC/AG | 444939 Number of splices: AT/AC | 32364 Number of splices: Non-canonical | 65203 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 3.01 Insertion rate per base | 0.01% Insertion average length | 2.01 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 980516 % of reads mapped to multiple loci | 2.64% Number of reads mapped to too many loci | 207857 % of reads mapped to too many loci | 0.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.14% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 699770 699770 699770 N_multimapping 980516 980516 980516 N_noFeature 1074800 35079909 1220773 N_ambiguous 363020 2149 192636 UnstrandedReadsAssigned:33957044 PositiveStrandReadsAssigned:312806 NegativeStrandReadsAssigned:33981455 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR23047998 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR23047998-trimmed-pair1.fastq SRR23047998-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,075,150 reads, 34,502,139 reads pseudoaligned [quant] estimated average fragment length: 293.967 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,165 rounds 52401 SRR23047998.ke.tsv 34699 SRR23047998.se.tsv 87100 total ==> SRR23047998.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1725.03 5222 77.5498 Potri.005G024800.1.v4.1 1035 742.033 1271 43.8797 Potri.004G059700.1.v4.1 961 668.038 117 4.48669 Potri.007G009000.2.v4.1 1416 1123.03 0 0 Potri.003G141000.2.v4.1 2943 2650.03 1667.26 16.1173 Potri.016G087400.1.v4.1 270 47.4073 1225 661.961 Potri.015G069301.1.v4.1 564 272.777 0 0 Potri.010G195200.1.v4.1 1773 1480.03 934.945 16.1829 Potri.012G127500.1.v4.1 977 684.033 11253 421.437 ==> SRR23047998.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 15 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 706 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1750 SRR23047998 completed mapping pipeline successfully