Starting /dee2/code/volunteer_pipeline.sh SRR23047999 current disk space = 3050074050560 free memory = 1487028072 SRR23047999 SRAfilesize 10debaac2c762e09842cb65c0616e48f SRR23047999.sra SRR23047999.sra file validated SRR23047999 is paired end SRR23047999 is conventional basespace SRR23047999 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR23047999_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.03075 37.0 37.0 37.0 37.0 37.0 2 36.1775 37.0 37.0 37.0 37.0 37.0 3 36.2555 37.0 37.0 37.0 37.0 37.0 4 36.403 37.0 37.0 37.0 37.0 37.0 5 36.369 37.0 37.0 37.0 37.0 37.0 6 36.243 37.0 37.0 37.0 37.0 37.0 7 36.1625 37.0 37.0 37.0 37.0 37.0 8 36.1715 37.0 37.0 37.0 37.0 37.0 9 36.2645 37.0 37.0 37.0 37.0 37.0 10-14 36.3743 37.0 37.0 37.0 37.0 37.0 15-19 36.3131 37.0 37.0 37.0 37.0 37.0 20-24 36.324400000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.2033 37.0 37.0 37.0 37.0 37.0 30-34 36.041000000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.112100000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.064299999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.0759 37.0 37.0 37.0 37.0 37.0 50-54 36.0076 37.0 37.0 37.0 37.0 37.0 55-59 35.9935 37.0 37.0 37.0 37.0 37.0 60-64 35.994800000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.9855 37.0 37.0 37.0 37.0 37.0 70-74 35.9779 37.0 37.0 37.0 37.0 37.0 75-79 35.978300000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.9093 37.0 37.0 37.0 37.0 37.0 85-89 35.842200000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.86379999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.7201 37.0 37.0 37.0 37.0 37.0 100-104 35.7738 37.0 37.0 37.0 37.0 37.0 105-109 35.7748 37.0 37.0 37.0 37.0 37.0 110-114 35.690900000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.72430000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.6409 37.0 37.0 37.0 37.0 37.0 125-129 35.652699999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.6319 37.0 37.0 37.0 37.0 37.0 135-139 35.6086 37.0 37.0 37.0 37.0 37.0 140-144 35.377300000000005 37.0 37.0 37.0 34.6 37.0 145-149 35.5031 37.0 37.0 37.0 37.0 37.0 150 35.697 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 3.0 24 1.0 25 6.0 26 3.0 27 10.0 28 10.0 29 29.0 30 41.0 31 66.0 32 69.0 33 126.0 34 240.0 35 462.0 36 2777.0 37 157.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.2464096749811 8.868732678256487 10.506424792139079 42.378432854623334 2 19.2 12.45 39.225 29.125 3 23.225 16.425 21.9 38.45 4 25.825 26.125 18.275 29.775000000000002 5 24.6 29.075 23.925 22.400000000000002 6 18.95 31.175000000000004 28.7 21.175 7 13.450000000000001 25.55 43.525000000000006 17.474999999999998 8 18.675 23.200000000000003 33.324999999999996 24.8 9 19.875 20.325 36.625 23.175 10-14 20.115 29.13 27.865000000000002 22.89 15-19 19.965 28.835 27.87 23.330000000000002 20-24 20.669999999999998 27.775 28.375 23.18 25-29 20.549999999999997 28.405 27.825 23.22 30-34 20.13 27.685 28.355000000000004 23.830000000000002 35-39 20.225 28.249999999999996 27.88 23.645 40-44 20.665 27.91 27.525 23.9 45-49 19.86 27.33 27.944999999999997 24.865000000000002 50-54 21.07 27.26 28.48 23.189999999999998 55-59 20.72 28.384999999999998 27.155 23.74 60-64 19.975 27.900000000000002 27.865000000000002 24.26 65-69 20.34 28.15 28.050000000000004 23.46 70-74 19.91 27.67 28.194999999999997 24.224999999999998 75-79 20.830000000000002 27.150000000000002 27.644999999999996 24.375 80-84 20.485 27.655 27.735 24.125 85-89 20.979999999999997 27.700000000000003 27.785 23.535 90-94 20.875 27.939999999999998 27.900000000000002 23.285 95-99 21.15 28.17 27.02 23.66 100-104 20.185 27.644999999999996 28.265 23.905 105-109 21.105 27.595 27.805000000000003 23.494999999999997 110-114 20.369999999999997 27.889999999999997 27.42 24.32 115-119 20.990000000000002 27.744999999999997 27.944999999999997 23.32 120-124 20.985 27.794999999999998 27.625 23.595 125-129 21.22 27.49 27.46 23.830000000000002 130-134 21.05 27.275 28.005000000000003 23.669999999999998 135-139 21.595 27.279999999999998 27.405 23.72 140-144 21.09 27.46 27.310000000000002 24.14 145-149 21.029999999999998 26.865 28.07 24.035 150 20.549999999999997 26.224999999999998 28.025 25.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.5 22 0.5 23 0.0 24 1.0 25 2.5 26 3.0 27 9.0 28 10.5 29 11.5 30 18.0 31 18.0 32 23.5 33 31.0 34 42.0 35 60.0 36 77.5 37 93.5 38 121.5 39 158.0 40 194.0 41 214.5 42 230.5 43 261.0 44 267.5 45 272.0 46 263.0 47 258.0 48 251.5 49 208.5 50 164.5 51 138.5 52 116.0 53 91.5 54 83.5 55 70.0 56 55.0 57 43.5 58 35.0 59 24.5 60 11.0 61 10.5 62 11.0 63 4.5 64 3.5 65 5.5 66 6.0 67 4.5 68 3.0 69 3.0 70 3.0 71 3.0 72 2.0 73 0.5 74 0.5 75 1.5 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.275 #Duplication Level Percentage of deduplicated Percentage of total 1 88.24695553667516 77.9 2 10.39365618804871 18.35 3 1.1894647408666101 3.15 4 0.16992353440951571 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTCGCA 10 0.006973645 144.0 7 CTCGCAC 10 0.006973645 144.0 8 GCCCTTC 10 0.006973645 144.0 2 >>END_MODULE SRR23047999 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR23047999_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.202 37.0 37.0 37.0 37.0 37.0 2 35.6005 37.0 37.0 37.0 37.0 37.0 3 35.7655 37.0 37.0 37.0 37.0 37.0 4 35.822 37.0 37.0 37.0 37.0 37.0 5 36.008 37.0 37.0 37.0 37.0 37.0 6 35.795 37.0 37.0 37.0 37.0 37.0 7 35.718 37.0 37.0 37.0 37.0 37.0 8 35.794 37.0 37.0 37.0 37.0 37.0 9 35.983 37.0 37.0 37.0 37.0 37.0 10-14 35.896 37.0 37.0 37.0 37.0 37.0 15-19 35.8555 37.0 37.0 37.0 37.0 37.0 20-24 35.8448 37.0 37.0 37.0 37.0 37.0 25-29 35.833800000000004 37.0 37.0 37.0 37.0 37.0 30-34 35.8301 37.0 37.0 37.0 37.0 37.0 35-39 35.7603 37.0 37.0 37.0 37.0 37.0 40-44 35.7419 37.0 37.0 37.0 37.0 37.0 45-49 35.692099999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.5988 37.0 37.0 37.0 37.0 37.0 55-59 35.5318 37.0 37.0 37.0 37.0 37.0 60-64 35.474900000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.51030000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.47930000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.4146 37.0 37.0 37.0 37.0 37.0 80-84 35.2898 37.0 37.0 37.0 34.6 37.0 85-89 35.3005 37.0 37.0 37.0 34.6 37.0 90-94 35.3236 37.0 37.0 37.0 34.6 37.0 95-99 35.1531 37.0 37.0 37.0 27.4 37.0 100-104 35.2214 37.0 37.0 37.0 27.4 37.0 105-109 35.0089 37.0 37.0 37.0 27.4 37.0 110-114 35.123200000000004 37.0 37.0 37.0 27.4 37.0 115-119 35.0793 37.0 37.0 37.0 25.0 37.0 120-124 35.0413 37.0 37.0 37.0 25.0 37.0 125-129 35.061699999999995 37.0 37.0 37.0 25.0 37.0 130-134 34.989999999999995 37.0 37.0 37.0 25.0 37.0 135-139 34.78 37.0 37.0 37.0 25.0 37.0 140-144 34.7687 37.0 37.0 37.0 25.0 37.0 145-149 35.0124 37.0 37.0 37.0 25.0 37.0 150 34.983 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 5.0 23 13.0 24 6.0 25 15.0 26 14.0 27 25.0 28 26.0 29 37.0 30 51.0 31 76.0 32 111.0 33 167.0 34 303.0 35 904.0 36 2182.0 37 64.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.82737487231869 21.527068437180795 13.559754851889682 29.085801838610827 2 18.725 34.5 32.300000000000004 14.475 3 21.075 33.425 26.625 18.875 4 25.224999999999998 37.025000000000006 19.875 17.875 5 23.5 37.95 21.875 16.675 6 20.65 39.025 23.875 16.45 7 18.625 22.375 39.275 19.725 8 21.3 24.725 28.875 25.1 9 22.225 27.250000000000004 28.349999999999998 22.175 10-14 23.155 29.93 25.365 21.55 15-19 23.11 29.42 26.58 20.89 20-24 22.825 29.81 26.56 20.805 25-29 22.58 29.794999999999998 26.729999999999997 20.895 30-34 23.125 28.694999999999997 26.66 21.52 35-39 22.865 29.235 26.5 21.4 40-44 23.355 29.630000000000003 26.029999999999998 20.985 45-49 22.055 29.354999999999997 26.979999999999997 21.61 50-54 22.825 28.74 27.55 20.885 55-59 23.615 28.475 26.834999999999997 21.075 60-64 22.895 28.349999999999998 27.439999999999998 21.315 65-69 23.919999999999998 28.405 26.584999999999997 21.09 70-74 24.255 27.98 26.715 21.05 75-79 23.21 27.825 27.61 21.355 80-84 23.375 28.26 27.02 21.345 85-89 23.41 28.065 27.345000000000002 21.18 90-94 23.165 28.384999999999998 27.200000000000003 21.25 95-99 23.405 28.46 26.685 21.45 100-104 23.265 28.1 27.625 21.01 105-109 23.62 28.285 26.815 21.279999999999998 110-114 23.505000000000003 28.365000000000002 26.71 21.42 115-119 23.73 28.255000000000003 27.025 20.990000000000002 120-124 24.515 28.315 26.865 20.305 125-129 23.755000000000003 27.584999999999997 27.325 21.335 130-134 24.240000000000002 28.084999999999997 27.125 20.549999999999997 135-139 23.285 28.17 27.51 21.035 140-144 23.985 27.915 27.26 20.84 145-149 24.23 28.000000000000004 26.39 21.38 150 22.95 27.375 27.925 21.75 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 1.0 6 1.0 7 0.5 8 0.5 9 1.0 10 2.0 11 1.5 12 0.5 13 0.5 14 0.5 15 0.0 16 1.0 17 3.0 18 2.5 19 1.0 20 1.0 21 1.0 22 1.5 23 2.0 24 1.5 25 2.0 26 3.0 27 3.5 28 5.5 29 6.0 30 9.0 31 18.0 32 27.5 33 36.5 34 46.5 35 70.0 36 79.0 37 94.0 38 128.5 39 158.5 40 195.0 41 216.0 42 255.5 43 281.0 44 282.0 45 282.5 46 270.5 47 263.0 48 240.0 49 194.5 50 166.5 51 138.5 52 101.0 53 82.0 54 76.0 55 66.5 56 47.0 57 33.0 58 25.5 59 19.5 60 12.0 61 9.0 62 7.0 63 6.5 64 3.0 65 1.5 66 2.5 67 2.0 68 2.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.5 93 0.5 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.85 #Duplication Level Percentage of deduplicated Percentage of total 1 88.97017445132246 79.05 2 9.735509285312324 17.299999999999997 3 1.0692177827799663 2.85 4 0.22509848058525606 0.8 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACAGCA 10 0.0069754543 143.9875 6 TTGACAG 10 0.0069754543 143.9875 4 >>END_MODULE Read 1846863 spots for SRR23047999.sra Written 1846863 spots for SRR23047999.sra Read 1846863 spots for SRR23047999.sra Written 1846863 spots for SRR23047999.sra Read 1846863 spots for SRR23047999.sra Written 1846863 spots for SRR23047999.sra Read 1846863 spots for SRR23047999.sra Written 1846863 spots for SRR23047999.sra Read 1846863 spots for SRR23047999.sra Written 1846863 spots for SRR23047999.sra Read 1846863 spots for SRR23047999.sra Written 1846863 spots for SRR23047999.sra Read 1846863 spots for SRR23047999.sra Written 1846863 spots for SRR23047999.sra Read 1846863 spots for SRR23047999.sra Written 1846863 spots for SRR23047999.sra Read 1846874 spots for SRR23047999.sra Written 1846874 spots for SRR23047999.sra Read 1846863 spots for SRR23047999.sra Written 1846863 spots for SRR23047999.sra Read 1846863 spots for SRR23047999.sra Written 1846863 spots for SRR23047999.sra Read 1846863 spots for SRR23047999.sra Written 1846863 spots for SRR23047999.sra Read 1846863 spots for SRR23047999.sra Written 1846863 spots for SRR23047999.sra Read 1846863 spots for SRR23047999.sra Written 1846863 spots for SRR23047999.sra Read 1846863 spots for SRR23047999.sra Written 1846863 spots for SRR23047999.sra Read 1846863 spots for SRR23047999.sra Written 1846863 spots for SRR23047999.sra Read 1846863 spots for SRR23047999.sra Written 1846863 spots for SRR23047999.sra Read 1846863 spots for SRR23047999.sra Written 1846863 spots for SRR23047999.sra Read 1846863 spots for SRR23047999.sra Written 1846863 spots for SRR23047999.sra Read 1846863 spots for SRR23047999.sra Written 1846863 spots for SRR23047999.sra SRR ids: ['SRR23047999.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_129e2lj7 SRR23047999.sra spots: 36937271 blocks: [[1, 1846863], [1846864, 3693726], [3693727, 5540589], [5540590, 7387452], [7387453, 9234315], [9234316, 11081178], [11081179, 12928041], [12928042, 14774904], [14774905, 16621767], [16621768, 18468630], [18468631, 20315493], [20315494, 22162356], [22162357, 24009219], [24009220, 25856082], [25856083, 27702945], [27702946, 29549808], [29549809, 31396671], [31396672, 33243534], [33243535, 35090397], [35090398, 36937271]] SRR23047999 file size 13568912 SRR23047999 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR23047999 SRR23047999_1.fastq SRR23047999_2.fastq Input file: SRR23047999_1.fastq Paired file: SRR23047999_2.fastq trimmed: SRR23047999-trimmed-pair1.fastq, SRR23047999-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 07:14:00 2025 >> started Wed Feb 12 07:14:42 2025 >> done (42.164s) 36937271 read pairs processed; of these: 2 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 36937269 (100.00%) read pairs available; of these: 88397 ( 0.24%) trimmed read pairs available after processing 36848872 (99.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 1 0.00% 27 0 0.00% 28 2 0.00% 29 3 0.00% 30 2 0.00% 31 4 0.00% 32 3 0.00% 33 7 0.00% 34 3 0.00% 35 7 0.00% 36 3 0.00% 37 5 0.00% 38 3 0.00% 39 11 0.00% 40 5 0.00% 41 5 0.00% 42 3 0.00% 43 6 0.00% 44 8 0.00% 45 3 0.00% 46 8 0.00% 47 3 0.00% 48 8 0.00% 49 9 0.00% 50 6 0.00% 51 9 0.00% 52 9 0.00% 53 10 0.00% 54 10 0.00% 55 14 0.00% 56 7 0.00% 57 8 0.00% 58 17 0.00% 59 6 0.00% 60 16 0.00% 61 14 0.00% 62 13 0.00% 63 7 0.00% 64 16 0.00% 65 14 0.00% 66 10 0.00% 67 13 0.00% 68 12 0.00% 69 16 0.00% 70 17 0.00% 71 12 0.00% 72 21 0.00% 73 10 0.00% 74 10 0.00% 75 15 0.00% 76 11 0.00% 77 15 0.00% 78 17 0.00% 79 16 0.00% 80 16 0.00% 81 16 0.00% 82 9 0.00% 83 22 0.00% 84 20 0.00% 85 19 0.00% 86 23 0.00% 87 15 0.00% 88 20 0.00% 89 20 0.00% 90 19 0.00% 91 17 0.00% 92 20 0.00% 93 15 0.00% 94 20 0.00% 95 14 0.00% 96 24 0.00% 97 29 0.00% 98 16 0.00% 99 24 0.00% 100 22 0.00% 101 16 0.00% 102 20 0.00% 103 22 0.00% 104 25 0.00% 105 25 0.00% 106 21 0.00% 107 25 0.00% 108 29 0.00% 109 24 0.00% 110 29 0.00% 111 16 0.00% 112 20 0.00% 113 25 0.00% 114 20 0.00% 115 22 0.00% 116 25 0.00% 117 21 0.00% 118 27 0.00% 119 10 0.00% 120 28 0.00% 121 31 0.00% 122 40 0.00% 123 40 0.00% 124 38 0.00% 125 28 0.00% 126 20 0.00% 127 12 0.00% 128 21 0.00% 129 28 0.00% 130 41 0.00% 131 43 0.00% 132 32 0.00% 133 31 0.00% 134 44 0.00% 135 45 0.00% 136 33 0.00% 137 37 0.00% 138 0 0.00% 139 0 0.00% 140 24 0.00% 141 81 0.00% 142 78 0.00% 143 81 0.00% 144 0 0.00% 145 269 0.00% 146 20442 0.06% 147 21237 0.06% 148 21898 0.06% 149 22388 0.06% 150 36848872 99.76% 36937269 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=38 prefix-density=0.23 prefix-fanout=2.0 sequence=TGGCCACGGTCTAGACGGCGCCCACCGCCAGGTGAGGCTGCGGCCCACACAGTGTAAGGGCAATTGTTTCGGATTTCGAAGGTGGCTGCATTAGTAGAGATGATGAGAAGGCTAAAGAGGAGGGAGGAGGTGAGAAATTTGGTTAAGTG criterion=fanout-score sequence-density=0.03 sequence-density-rank=38 fanout-score=28.95 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=8.0 sequence=CAACCATCATCATGCATGCTCTCCCCCACAAAGAATTGCAAGTCCTTGATTTTTGAAAGCAAGAACTTGGTTGCTCCCTCAATGTTCTTTCTAAAATGTTCCTTCTGGTCCTCATCAAGTTTCTCCGACAGATTCTTGATAAATTTCTTAATCTGTGTAAGAAACTGCTTCTTGTCAAATGGAGGTTGCTCCTGGAGCCTAAATGTGTCAACGATGTCAACAACCTTGGCAGCTTGGTCATCAACACCCTCATCCTCATC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=29 prefix-density=0.37 prefix-fanout=2.2 sequence=ACCAAATTTCTCACCTCCTCCCTCCTCTTTAGCCTTCTCATCATCTCTACTAATGCAGCCACCTTCGAAATCCGAAACAATTGCCCTTACACTGTGTGGGCCGCAGCCTCACCTGGCGGTGGGCGCCGTCTAGACCGTGGCCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=168.24 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=19.6 sequence=CAAGAAGATCAACTGTCTCTCTGCCTGGTTTGTATTCCAAGAAATGGAGAAAGTCCAAAAGCTCCTTTGTGTGGCTCTATTGCTTGCAGTACTAGCCATAGCAAGCAATATTGCGAATGCCCAGAGTACCATATGCAAAATGCCTGTTGCTGGCCTAATGTCATGCAAGCCTTCTGTAACTCCTCCTAACCCTACCGCACCCTCGGCAGACTGCTGCTCGGCACTTTCGCATGCTGACATAAACTGCCTTTGCTCCTACAAAAATTCCAACCTGCTCCCTTCC SRR23047999 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 07:15:25 Started mapping on | Feb 12 07:15:25 Finished on | Feb 12 07:18:43 Mapping speed, Million of reads per hour | 671.59 Number of input reads | 36937269 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 35035138 Uniquely mapped reads % | 94.85% Average mapped length | 298.94 Number of splices: Total | 34307134 Number of splices: Annotated (sjdb) | 33663679 Number of splices: GT/AG | 33771934 Number of splices: GC/AG | 442502 Number of splices: AT/AC | 30245 Number of splices: Non-canonical | 62453 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 2.89 Insertion rate per base | 0.01% Insertion average length | 2.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1017000 % of reads mapped to multiple loci | 2.75% Number of reads mapped to too many loci | 350346 % of reads mapped to too many loci | 0.95% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.19% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 885131 885131 885131 N_multimapping 1017000 1017000 1017000 N_noFeature 931340 34733487 1057185 N_ambiguous 372518 2376 195120 UnstrandedReadsAssigned:33731280 PositiveStrandReadsAssigned:299275 NegativeStrandReadsAssigned:33782833 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR23047999 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR23047999-trimmed-pair1.fastq SRR23047999-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,937,269 reads, 34,479,155 reads pseudoaligned [quant] estimated average fragment length: 295.377 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,181 rounds 52401 SRR23047999.ke.tsv 34699 SRR23047999.se.tsv 87100 total ==> SRR23047999.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1723.62 4738 68.0184 Potri.005G024800.1.v4.1 1035 740.623 1678 56.062 Potri.004G059700.1.v4.1 961 666.637 143 5.30787 Potri.007G009000.2.v4.1 1416 1121.62 0 0 Potri.003G141000.2.v4.1 2943 2648.62 1439.45 13.4477 Potri.016G087400.1.v4.1 270 47.5666 1454 756.373 Potri.015G069301.1.v4.1 564 271.461 0 0 Potri.010G195200.1.v4.1 1773 1478.62 1295.95 21.6873 Potri.012G127500.1.v4.1 977 682.623 6834 247.724 ==> SRR23047999.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 13 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 546 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 1457 SRR23047999 completed mapping pipeline successfully